ID: 1078655166

View in Genome Browser
Species Human (GRCh38)
Location 11:13231911-13231933
Sequence CAGGTGCATGCATGCTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078655160_1078655166 3 Left 1078655160 11:13231885-13231907 CCCGATGCAGGCTTCCCCATGGC No data
Right 1078655166 11:13231911-13231933 CAGGTGCATGCATGCTTTTGTGG No data
1078655161_1078655166 2 Left 1078655161 11:13231886-13231908 CCGATGCAGGCTTCCCCATGGCT No data
Right 1078655166 11:13231911-13231933 CAGGTGCATGCATGCTTTTGTGG No data
1078655158_1078655166 9 Left 1078655158 11:13231879-13231901 CCAGTTCCCGATGCAGGCTTCCC No data
Right 1078655166 11:13231911-13231933 CAGGTGCATGCATGCTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078655166 Original CRISPR CAGGTGCATGCATGCTTTTG TGG Intergenic
No off target data available for this crispr