ID: 1078656765

View in Genome Browser
Species Human (GRCh38)
Location 11:13247708-13247730
Sequence CATGTTTAAGAATCCACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078656762_1078656765 6 Left 1078656762 11:13247679-13247701 CCTGTCTGACATCCTTTTGGCCA No data
Right 1078656765 11:13247708-13247730 CATGTTTAAGAATCCACTGCAGG No data
1078656760_1078656765 28 Left 1078656760 11:13247657-13247679 CCAAGCAGTTCTCTGGTCTCTTC No data
Right 1078656765 11:13247708-13247730 CATGTTTAAGAATCCACTGCAGG No data
1078656763_1078656765 -6 Left 1078656763 11:13247691-13247713 CCTTTTGGCCACAATTTCATGTT No data
Right 1078656765 11:13247708-13247730 CATGTTTAAGAATCCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078656765 Original CRISPR CATGTTTAAGAATCCACTGC AGG Intergenic