ID: 1078659662

View in Genome Browser
Species Human (GRCh38)
Location 11:13277266-13277288
Sequence GGGGAGAAGAAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4922
Summary {0: 1, 1: 5, 2: 64, 3: 709, 4: 4143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078659650_1078659662 29 Left 1078659650 11:13277214-13277236 CCGGAGGGAGAGAGGGAGTCAGG 0: 1
1: 1
2: 6
3: 100
4: 679
Right 1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG 0: 1
1: 5
2: 64
3: 709
4: 4143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078659662 Original CRISPR GGGGAGAAGAAGAAGGAGGA GGG Intronic
Too many off-targets to display for this crispr