ID: 1078659698

View in Genome Browser
Species Human (GRCh38)
Location 11:13277386-13277408
Sequence GCGGCTAGTGGGAGACCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078659684_1078659698 19 Left 1078659684 11:13277344-13277366 CCGGGCGACCCCGAGGAGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1078659698 11:13277386-13277408 GCGGCTAGTGGGAGACCTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 82
1078659688_1078659698 11 Left 1078659688 11:13277352-13277374 CCCCGAGGAGCGCGGCTTGGGCA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1078659698 11:13277386-13277408 GCGGCTAGTGGGAGACCTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 82
1078659690_1078659698 9 Left 1078659690 11:13277354-13277376 CCGAGGAGCGCGGCTTGGGCACC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1078659698 11:13277386-13277408 GCGGCTAGTGGGAGACCTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 82
1078659683_1078659698 20 Left 1078659683 11:13277343-13277365 CCCGGGCGACCCCGAGGAGCGCG 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1078659698 11:13277386-13277408 GCGGCTAGTGGGAGACCTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 82
1078659689_1078659698 10 Left 1078659689 11:13277353-13277375 CCCGAGGAGCGCGGCTTGGGCAC 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1078659698 11:13277386-13277408 GCGGCTAGTGGGAGACCTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078659698 Original CRISPR GCGGCTAGTGGGAGACCTGA GGG Intronic
902304071 1:15524137-15524159 GCGGCTGGTGGAAGAGCTGCAGG - Exonic
904350093 1:29899412-29899434 GCGGGTAGAGAGAGACCTGTTGG - Intergenic
904437721 1:30509567-30509589 GTGGGTAGAGGGAGACCTGGAGG + Intergenic
905588514 1:39141809-39141831 GTGGGTAGTGGGAGACCAGGAGG + Intronic
905987745 1:42302461-42302483 CCTGCTATTGGGAGACCTGTAGG - Intronic
912957320 1:114164721-114164743 GCTGGTAGTGGGAGACGGGAGGG + Intergenic
916072461 1:161178338-161178360 ATGGCTAATGGGAAACCTGAAGG + Intergenic
917969886 1:180199752-180199774 GAGGCTTCTGCGAGACCTGAAGG + Exonic
921077674 1:211712751-211712773 GGGGCGAGGGGGAGGCCTGAGGG - Intergenic
1062787050 10:273429-273451 ACGGCTGGTGTGAGACCTGCAGG - Intergenic
1064972618 10:21081445-21081467 GCTCCTAGTGGGAAAACTGAAGG + Intronic
1075949267 10:126463040-126463062 GGGGCTAGTGTTAGGCCTGAAGG - Intronic
1076668306 10:132105103-132105125 GCAGGCAGTGGGAGACTTGAGGG + Intronic
1077008027 11:368383-368405 GCGGCATGTGGCAAACCTGAGGG + Intergenic
1077887650 11:6397609-6397631 GCACCTAGTTGGAGCCCTGAAGG - Intronic
1078659698 11:13277386-13277408 GCGGCTAGTGGGAGACCTGAGGG + Intronic
1081805962 11:45890698-45890720 GTGTCCAGTGGGAGACCAGAGGG + Intronic
1085535242 11:77213613-77213635 TCGGAAATTGGGAGACCTGAGGG - Intronic
1085769976 11:79316163-79316185 GCAGATAGTGGGAGAAATGAGGG + Intronic
1089741798 11:120589691-120589713 GCGGGTGGTGAGAGACCTGAGGG - Intronic
1091057246 11:132430502-132430524 GCGGCTCCTGGGAGCCATGAGGG - Intronic
1091601034 12:1917934-1917956 GCAGCTTCTGGGACACCTGAAGG - Intronic
1102580392 12:113882710-113882732 GGGGCTAATGGGAGTCCAGAGGG - Intronic
1103264194 12:119615143-119615165 GCGGGTAGACTGAGACCTGAGGG - Intronic
1120140360 14:80923832-80923854 GCATTTAGTGAGAGACCTGATGG + Intronic
1120665008 14:87295284-87295306 GCGGCCAGTGGGACACCCCAAGG + Intergenic
1121429375 14:93876198-93876220 GTGGCCAGTGGGAGACCTCTAGG + Intergenic
1122492824 14:102131275-102131297 GTGGCTTGTGGGAGAAATGAAGG - Intronic
1128912761 15:71531124-71531146 GGAGCTAGAGGGAGACCAGAGGG + Intronic
1129479002 15:75808233-75808255 GGGGCTGGAGGGAGACCTCATGG - Intergenic
1130276052 15:82476887-82476909 GCAGCTTGTGGGAGACCACAAGG - Intergenic
1135533979 16:23278554-23278576 GGGGGTAGTGGGAGACGGGAGGG + Intronic
1141192166 16:81832818-81832840 GCAGCTAGTGGGAGACCCTGTGG + Intronic
1142540474 17:654915-654937 GCGGCCAGAGGGAGGCCAGAGGG - Intronic
1143594411 17:7905945-7905967 GTGGCTGGTGCGGGACCTGAGGG + Exonic
1146372046 17:32270711-32270733 GCAGCAGGTGGGAGACCTGAGGG + Intronic
1149109115 17:53005511-53005533 GCTGCTACTGAGAAACCTGAGGG + Intergenic
1149238383 17:54619009-54619031 GGGACTAGTGGGAGACCCAATGG + Intergenic
1152930985 17:83109760-83109782 GTGGCCAGTGGGAGGCCTGCTGG - Intergenic
1156733863 18:40229210-40229232 GGGGGTAGTGGGAGACGGGAGGG - Intergenic
1165092424 19:33394115-33394137 CAGGCTGTTGGGAGACCTGAGGG - Intronic
1167287476 19:48606703-48606725 GCGGCCAGTGGGAACCCTGAGGG + Intronic
1168304229 19:55426236-55426258 GAGGTTTGTGGGAGAACTGAGGG + Intergenic
929564559 2:42976439-42976461 GCGTCAAGAGGGAAACCTGAGGG + Intergenic
930909246 2:56610890-56610912 GAAGCTAGTGGGATTCCTGAAGG + Intergenic
935159878 2:100520992-100521014 GCGTCTAGAGAGAGACCTGGTGG + Intergenic
935800732 2:106692655-106692677 AAGGCTAGTGGGAGTCCTGGGGG - Intergenic
944688789 2:202140855-202140877 GCAGCCAGTGGGGGAACTGATGG - Intronic
1171249535 20:23637742-23637764 GCGCCTAGTGGGAGGCCCCATGG - Exonic
1172598955 20:36170525-36170547 GGGGCTAGTGAGAGAAATGATGG - Intronic
1173259741 20:41422974-41422996 GAGGCTACAGGGAGGCCTGAAGG + Intronic
1175894558 20:62330348-62330370 GCAGCTAGTTTGAGAACTGATGG + Intronic
1176918884 21:14662333-14662355 GAGGCTCTTGGGAGGCCTGATGG - Intergenic
1178689779 21:34741331-34741353 GAGAATAGTGGGAGACCTGGAGG + Intergenic
1181318203 22:21984863-21984885 GCGGCAAGGTGGAGACCTGGAGG - Intergenic
1183514014 22:38252709-38252731 GAGTCTAGTGGGAGTCCTGTAGG - Intronic
1185296973 22:50059138-50059160 GGGGCTGGTGGGGGACTTGAAGG + Intergenic
951304262 3:21039147-21039169 GGGGCAAGAGTGAGACCTGACGG - Intergenic
952317736 3:32246251-32246273 GCGGCCAGTGGGACATCAGATGG - Intronic
957132349 3:76238778-76238800 GTGTCTAGGGGGAGACCTGTGGG - Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
970149019 4:13069451-13069473 GCTGCCAGTGGGAAACTTGAAGG - Intergenic
984391705 4:179142541-179142563 GAGGCAAGTGGGTCACCTGAGGG + Intergenic
1000467024 5:161592251-161592273 GCAGCTACTGGGAGATCTGTAGG - Intronic
1003201953 6:3969573-3969595 GGGCCTAGTGGGTGACTTGAGGG + Intergenic
1005954292 6:30652840-30652862 GCTGCTAGTGGGAGCCCTGGTGG + Exonic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1009913518 6:69963570-69963592 CGGGCTAGTAGGAGAGCTGAGGG - Intronic
1017410116 6:154159239-154159261 GTGGCATGTGGGAGAGCTGAAGG - Exonic
1019105517 6:169664125-169664147 GGGCCAAGTGGGAGGCCTGAGGG + Intronic
1021303976 7:19008834-19008856 GTGGCACGTGGGAGAGCTGATGG - Intergenic
1021852275 7:24820223-24820245 GCGGATGGTGGCTGACCTGATGG + Exonic
1029536891 7:101162622-101162644 GGGGCTCGTGGGAGGCCCGAAGG + Exonic
1032301805 7:130694527-130694549 GAGGCTAGTGGGAGATTGGAGGG + Intergenic
1040673127 8:49716248-49716270 AGGGCTAGTGGGCGACCTGAGGG - Intergenic
1044586987 8:93877262-93877284 GTGGCAAGGGGGAGAACTGAAGG + Intronic
1045457433 8:102395098-102395120 GAGGCTGGTGGGAGAGCTGTAGG - Intronic
1048989612 8:139753457-139753479 ACGGCTATTGGGAAATCTGATGG - Intronic
1050170359 9:2809555-2809577 GCGGCAAGTGGCAGCTCTGATGG - Intronic
1052864436 9:33456587-33456609 GTGGCTAATGGCAGCCCTGAAGG + Intergenic
1053412982 9:37927792-37927814 GAGGCTGGTGGGAACCCTGAGGG - Intronic
1062731556 9:138112984-138113006 GCATCTCGTGGGAGACGTGAGGG + Intronic
1189700955 X:43716024-43716046 GGGGCAAGGGGGTGACCTGAAGG + Intronic
1195108529 X:101623355-101623377 GCGGCGAGTGGGAGAGACGACGG - Intronic
1197583071 X:128310128-128310150 GTGTTTAGGGGGAGACCTGATGG - Intergenic
1197583357 X:128312021-128312043 GTGTTTAGGGGGAGACCTGATGG - Intergenic
1200163661 X:154021441-154021463 GCCGCTCGTGGCAGGCCTGAAGG + Intergenic