ID: 1078659740

View in Genome Browser
Species Human (GRCh38)
Location 11:13277566-13277588
Sequence CAGCCCGCTGGCCAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078659740_1078659752 15 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659752 11:13277604-13277626 ATTGGCTGGGGGCGGCCGCCGGG 0: 1
1: 0
2: 1
3: 12
4: 147
1078659740_1078659747 3 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659747 11:13277592-13277614 AGCCGCGCGCGGATTGGCTGGGG 0: 1
1: 0
2: 1
3: 4
4: 63
1078659740_1078659755 30 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659755 11:13277619-13277641 CCGCCGGGACCGGCTCCCTTCGG 0: 1
1: 0
2: 1
3: 4
4: 74
1078659740_1078659746 2 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659746 11:13277591-13277613 GAGCCGCGCGCGGATTGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 29
1078659740_1078659743 -3 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659743 11:13277586-13277608 CTGCCGAGCCGCGCGCGGATTGG 0: 1
1: 0
2: 1
3: 1
4: 24
1078659740_1078659750 7 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659750 11:13277596-13277618 GCGCGCGGATTGGCTGGGGGCGG 0: 1
1: 0
2: 2
3: 15
4: 170
1078659740_1078659748 4 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659748 11:13277593-13277615 GCCGCGCGCGGATTGGCTGGGGG 0: 1
1: 1
2: 1
3: 13
4: 73
1078659740_1078659742 -8 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659742 11:13277581-13277603 GCGGGCTGCCGAGCCGCGCGCGG 0: 1
1: 0
2: 0
3: 19
4: 176
1078659740_1078659745 1 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659745 11:13277590-13277612 CGAGCCGCGCGCGGATTGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 53
1078659740_1078659751 14 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659751 11:13277603-13277625 GATTGGCTGGGGGCGGCCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 235
1078659740_1078659753 20 Left 1078659740 11:13277566-13277588 CCACACAACTGGCCAGCGGGCTG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1078659753 11:13277609-13277631 CTGGGGGCGGCCGCCGGGACCGG 0: 1
1: 0
2: 7
3: 47
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078659740 Original CRISPR CAGCCCGCTGGCCAGTTGTG TGG (reversed) Intronic
900080759 1:855713-855735 CATCACGCTGGGCAGCTGTGAGG + Intergenic
901451060 1:9337395-9337417 CAGGTGGCTGGCCAGGTGTGAGG - Intronic
903009259 1:20318730-20318752 CAGCCCAGGGGCCCGTTGTGGGG - Intronic
903458783 1:23506630-23506652 CAGCAGGCTGGCCAGGCGTGTGG + Exonic
903961609 1:27061348-27061370 CAGCATGCAGGCCAGGTGTGTGG + Intergenic
911457676 1:98147495-98147517 CAGCCTGCTGGCCTGCTTTGTGG + Intergenic
917240834 1:172946802-172946824 CAACTCTCTGGCCACTTGTGAGG + Intergenic
917802271 1:178581548-178581570 CAGCTCGCAAGCCAGTTCTGAGG + Intergenic
919805529 1:201379102-201379124 CCGCCCGCTGGCCAGCATTGTGG + Intronic
922055685 1:222040440-222040462 CAGCAAGCTGGCGAGCTGTGGGG + Intergenic
922792776 1:228319235-228319257 CACCTTGCTGGCCAGTGGTGAGG - Exonic
923014397 1:230114628-230114650 CAGCCCGCAGGCCAGTTCGCCGG - Intronic
1069840741 10:71337866-71337888 GAGCCAGCTGGCCAGATGTGAGG - Intronic
1071524651 10:86351422-86351444 CAGCCTGCTGGACATTTCTGAGG + Intronic
1072542750 10:96410730-96410752 TAGCTCTCTGGCCAGCTGTGTGG + Intronic
1074880184 10:117650652-117650674 CAGTCAGCTGGGCAGTTGTAAGG + Intergenic
1077391756 11:2303575-2303597 CAGCCCGGTGGGCAGATGTAGGG + Intronic
1078659740 11:13277566-13277588 CAGCCCGCTGGCCAGTTGTGTGG - Intronic
1081436598 11:43033999-43034021 CAGCCCCCTGCCCTGTGGTGTGG - Intergenic
1082637915 11:55619293-55619315 CAGCCACCGGGCCTGTTGTGGGG - Intergenic
1083807395 11:65083270-65083292 CAGCTCCCTGGGCAGATGTGAGG + Intronic
1084324022 11:68388692-68388714 CAGCCCACTAGTCAGATGTGAGG + Intronic
1085742529 11:79089257-79089279 CAGCCATCTAGCCTGTTGTGGGG - Intronic
1089735063 11:120545055-120545077 CTGGCCTCTGGCCAGCTGTGAGG - Intronic
1090831257 11:130422291-130422313 CAACACCCTGGCCAGTTGGGTGG + Intronic
1093752204 12:22812650-22812672 CTGCCCGCTGGACACTGGTGTGG - Intergenic
1095439500 12:42227759-42227781 CAGCACGCTGGCCAGGCGGGGGG - Intronic
1096967930 12:55643419-55643441 CAGTCTGCTGGGCAGTTGGGAGG - Intergenic
1101446296 12:104739003-104739025 CAGCCTGCTGGGCAGGGGTGAGG + Intronic
1101520406 12:105477244-105477266 TATACCGTTGGCCAGTTGTGGGG - Intergenic
1103428122 12:120856463-120856485 GAGCCCCCTGGCCACTGGTGTGG + Intronic
1103936121 12:124477809-124477831 CTGCCCCCTGGCAACTTGTGCGG - Intronic
1104035714 12:125095885-125095907 CATGCCTCTGGCCAGTTGTGAGG + Intronic
1106337317 13:28795996-28796018 CAACCCTCTGGACAGGTGTGTGG + Intergenic
1106722983 13:32455171-32455193 CAGCCCTCTGGATAGATGTGGGG - Intronic
1107808410 13:44176136-44176158 CACTCCGCAGGCCAGGTGTGAGG - Intergenic
1109200246 13:59422787-59422809 CAGACAGCTGGGCAGTTGTGAGG - Intergenic
1109264910 13:60187007-60187029 CAGCCCACAGGCAAGGTGTGAGG + Intergenic
1113797483 13:113066816-113066838 CAAGCCGCTGTCCAGCTGTGCGG - Intronic
1114723693 14:24910871-24910893 CAACCCAGTGGCCACTTGTGAGG + Intronic
1116966605 14:51021681-51021703 AAGCCTGCTGGCCACATGTGTGG + Intronic
1120631278 14:86894326-86894348 CAGCCAGTGGGCCACTTGTGTGG - Intergenic
1126352515 15:47759297-47759319 CAGCCCTCTGGCTATTTTTGAGG + Intronic
1127774710 15:62255755-62255777 CAGGCAGCTGGCCAGATCTGTGG + Intergenic
1132746386 16:1438083-1438105 CAGCTCGCCAGCCAGCTGTGCGG + Exonic
1133302116 16:4788595-4788617 TATCCCGCTAGCCAGCTGTGGGG - Exonic
1134095401 16:11415380-11415402 CACCCTGCTGGCCAGATGGGAGG - Intronic
1134307622 16:13047279-13047301 CAGCCTGCTGGCCAGTGGCAGGG - Intronic
1135974625 16:27099930-27099952 CAACTCCCTGGCCAGGTGTGTGG - Intergenic
1139648033 16:68346290-68346312 CAGCCCCTTGGCTTGTTGTGGGG + Intronic
1140301873 16:73765871-73765893 AAGCCTCCTGGCCAGTGGTGTGG - Intergenic
1140540560 16:75752997-75753019 CATTCCCATGGCCAGTTGTGAGG + Intronic
1148467377 17:47873004-47873026 CCTCCCGGTTGCCAGTTGTGTGG - Intergenic
1148784708 17:50140436-50140458 CACCCCTCTGGCCAGTATTGCGG + Intronic
1152693763 17:81733864-81733886 CAGGCCGCTGGCCAGCCGGGTGG - Intergenic
1152785477 17:82245790-82245812 CAGTCCGCTGCCCAGTCTTGGGG - Intronic
1152877617 17:82796038-82796060 CAGCCGGCTGGCCAGCTCAGTGG - Intronic
1153531877 18:6054868-6054890 GAGCCCGAAGCCCAGTTGTGTGG - Intronic
1153640191 18:7150119-7150141 CAGCCAGCTGGTCAGAAGTGAGG - Intergenic
1155367124 18:25059679-25059701 GAGCCCGATGCCCAGTCGTGTGG + Intergenic
1157300139 18:46473251-46473273 CAGCCCCCTGGGTAGATGTGGGG - Intergenic
1166856887 19:45786652-45786674 CAACCCGCTGGCCAAGTGGGCGG - Exonic
925473123 2:4184184-4184206 CAGGCAGCTGGCCAGGTGTGGGG - Intergenic
925617322 2:5756027-5756049 CAGCCCACTGTACAGCTGTGAGG - Intergenic
926116283 2:10215367-10215389 CAGCCTGCTCTCCAGTAGTGAGG - Intergenic
927511212 2:23644820-23644842 CAGACCGAGGGCCAGGTGTGAGG + Intronic
928399363 2:30966685-30966707 CTACCCACTGGCCAGTGGTGTGG - Intronic
929049597 2:37824798-37824820 AAGCTCTCTGGCCAGTTGTAGGG + Intergenic
930583440 2:53241721-53241743 CAGCCTGCTGGACACTTGTTGGG + Intergenic
932141056 2:69278535-69278557 CTGGCAGCTGTCCAGTTGTGTGG - Intergenic
933024491 2:77237891-77237913 CAGCCCCATGGCCAGTGGTAGGG - Intronic
934529719 2:95077265-95077287 CAGCCCGCTGGGCAGAGCTGGGG + Intergenic
936145155 2:109975885-109975907 CAGGGCGCTGGCCAGCTGGGTGG + Intergenic
936199530 2:110395593-110395615 CAGGGCGCTGGCCAGCTGGGTGG - Intergenic
936529912 2:113268939-113268961 CAGCCCCATGGCCAGCAGTGGGG + Intronic
941002669 2:160218347-160218369 CAGACCCCTGGCTAGATGTGGGG + Intronic
942907571 2:181202319-181202341 AAGCCAGCTGCCCTGTTGTGAGG + Intergenic
946443983 2:219722419-219722441 CTGCCCGCTGGGCAGCTCTGAGG + Intergenic
947836368 2:233178881-233178903 CTGCCCGCTGGCCACCTTTGTGG + Intronic
948828074 2:240583762-240583784 CAGGCCACTGGCCAGCAGTGGGG + Intergenic
1170594612 20:17795577-17795599 CAACTCTCTGGCCAGTTCTGTGG - Intergenic
1171386004 20:24769925-24769947 CGGCCACCTGGCCAGTGGTGGGG - Intergenic
1172232144 20:33343958-33343980 TAGGCCGCTTGCCGGTTGTGTGG - Intergenic
1173648040 20:44645920-44645942 CAGGCCCCTGAGCAGTTGTGGGG - Intronic
1173999355 20:47363027-47363049 CACCCCACTTGCCAGCTGTGCGG + Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1179722431 21:43323341-43323363 CAGCCCGCTGGCCCTGTTTGCGG + Intergenic
1180959823 22:19757472-19757494 CAGGGCACTGGCCAGATGTGGGG - Intronic
1181168670 22:20996336-20996358 CCGTCCTCTGGGCAGTTGTGAGG - Intronic
1181954820 22:26580466-26580488 CAGCCCTCTCACCTGTTGTGGGG + Intronic
1181983852 22:26785468-26785490 CAGCTGGCTGGCCTTTTGTGAGG + Intergenic
1183659461 22:39210215-39210237 CAGCTCTCTGGCCAGAAGTGAGG - Intergenic
1184445186 22:44542915-44542937 CAGCTCCCTGGCCAGCAGTGCGG + Intergenic
1185275882 22:49950082-49950104 CCCCCCGCTGGCCAGAGGTGAGG + Intergenic
950133020 3:10560546-10560568 CAGCAGGCTGACCAGCTGTGGGG - Intronic
950456291 3:13094693-13094715 CAGCCCTCTGTCCAGTAGTATGG - Intergenic
954075904 3:48180043-48180065 CAGGCTGCTGGGCAGTTTTGGGG - Intronic
954373668 3:50183327-50183349 CAGCCCGGTGGCGAGCTGTGGGG + Intronic
954461276 3:50628324-50628346 CCCCCAACTGGCCAGTTGTGTGG - Intronic
961552411 3:127676872-127676894 CAGCCAGGTGGCCAGGTGGGAGG + Intronic
961620853 3:128223398-128223420 CAGCCAGCTGGTCAGAAGTGTGG + Intronic
963200810 3:142584124-142584146 CAGGCCACTGGCCAGTACTGTGG + Intergenic
966893932 3:184428236-184428258 CACCCCGCTCCCCAGTTGTAGGG - Intronic
970034682 4:11719768-11719790 AAGCAGGCTGGCTAGTTGTGTGG + Intergenic
973829728 4:54746591-54746613 CACCCAGGTGGCCTGTTGTGTGG - Intergenic
977220075 4:94327820-94327842 CAGCCCTCTGGGTTGTTGTGGGG + Intronic
977346357 4:95821513-95821535 CTGCCCGTTGGCCAGTGTTGGGG - Intergenic
985546703 5:513561-513583 CAGCCCCATGGACAGTTGGGTGG + Intronic
986560712 5:9058218-9058240 CAACCCCCAGGGCAGTTGTGAGG - Intronic
986744016 5:10728718-10728740 CAGCCCCCTGTCCAGTGCTGTGG - Intronic
986776241 5:11016614-11016636 CAGCCCCCTGGCCACTTGCAGGG - Intronic
987409542 5:17601406-17601428 CACCCTGTTGGCCAGGTGTGAGG + Intergenic
988941364 5:36151548-36151570 CAGCCCGCCGGCCAGGTGAGAGG - Exonic
991005085 5:61821032-61821054 CAGCCAGCTGTGCTGTTGTGTGG - Intergenic
999210618 5:149885417-149885439 CAGCCCACTGGGTGGTTGTGAGG + Intronic
999802721 5:155052766-155052788 CTGCCTCTTGGCCAGTTGTGAGG + Intergenic
1001337452 5:170811262-170811284 CAGGCCGCTTGCTAGGTGTGGGG - Intronic
1001389408 5:171366721-171366743 CAGCCCGCTGGCCAGGATTCCGG - Intergenic
1001827640 5:174758748-174758770 CAGCCAGCTGCCATGTTGTGAGG + Intergenic
1003256414 6:4479060-4479082 CAGCCCCCTGGCCATTTTTAGGG - Intergenic
1005469861 6:26152607-26152629 CAGGCTGCAGCCCAGTTGTGGGG + Intergenic
1009790904 6:68400219-68400241 CAGCCCATTAGGCAGTTGTGGGG - Intergenic
1016854014 6:148648340-148648362 CAGCCCACTGGCCAGTATTCTGG + Intergenic
1017547855 6:155470607-155470629 CACCACTCTGGTCAGTTGTGGGG - Intergenic
1019644583 7:2122172-2122194 CAGCCCTCTGGCCACATGCGGGG - Intronic
1024881941 7:54096554-54096576 GAGCCCGCTGGTCACTAGTGTGG - Intergenic
1029448266 7:100626892-100626914 CAGCCCGCGGGCCTGGGGTGGGG + Exonic
1029517261 7:101032976-101032998 CATGCCGGTGGCCAGTTCTGAGG + Exonic
1029517956 7:101039165-101039187 CAAGCCGTTGGCCAGTTCTGAGG + Exonic
1029518046 7:101040050-101040072 CACGCCGGTGGCCAGTTCTGAGG + Exonic
1029518085 7:101040404-101040426 CATGCCGGTGGCCAGTTCTGAGG + Exonic
1029518167 7:101041109-101041131 CACGCCGGTGGCCAGTTCTGAGG + Exonic
1029518251 7:101041817-101041839 CACGCCGGTGGCCAGTTCTGAGG + Exonic
1029518272 7:101041994-101042016 CACACCGGTGGCCAGTTCTGAGG + Exonic
1030502733 7:110380423-110380445 CAGCCAGTTGGCCCGGTGTGGGG - Intergenic
1033156722 7:138963156-138963178 CTGCAGGCAGGCCAGTTGTGTGG - Intronic
1033219960 7:139521253-139521275 CAACCAGATGGCCAGCTGTGGGG - Intergenic
1034264833 7:149775901-149775923 CAGCCCAGTGGCCAGTTCTGGGG - Intergenic
1035905873 8:3509804-3509826 CAGCCCACCAGCCAGGTGTGAGG + Intronic
1036771126 8:11578977-11578999 CACCCCGCTGGGCTGTGGTGAGG + Intergenic
1040482206 8:47836390-47836412 CAGCTCGCTGGCCAGTGGCAGGG - Exonic
1041883870 8:62785947-62785969 CACCTGGCTGTCCAGTTGTGAGG - Intronic
1042454877 8:68989463-68989485 CACCACCCTGGTCAGTTGTGGGG - Intergenic
1056601432 9:88050194-88050216 CACCCTGCTGCCCAGGTGTGGGG + Intergenic
1057273509 9:93664158-93664180 GAGCCCGGTGGCCAGTGGGGAGG + Intronic
1057999491 9:99850549-99850571 CAGCCCGCTGCCCATTTATGTGG + Intronic
1061732801 9:132629512-132629534 CAGCCTGGGGGCCTGTTGTGGGG - Intronic
1062280469 9:135749509-135749531 CACCTCGCAGGCCAGCTGTGGGG - Intronic
1062425695 9:136505172-136505194 CAGCCCACTGGCCAGCCGCGGGG + Intronic
1062439442 9:136563178-136563200 GAGCCCGCTGGCTGGGTGTGTGG + Intergenic
1186450774 X:9671636-9671658 CATCACCCTGGCCAGCTGTGTGG + Intronic
1187183101 X:16961860-16961882 CAACCTGCTGGCCATTTGTATGG - Intronic
1189040497 X:37537723-37537745 CAGTCTGCTGGCCTCTTGTGGGG - Intronic
1191191968 X:57677342-57677364 CATCCCTCTGTTCAGTTGTGAGG - Intergenic
1195788963 X:108560353-108560375 CTGCCTGCTGGCCAACTGTGAGG - Intronic
1195807890 X:108795987-108796009 CAGGGCACTGGACAGTTGTGAGG - Intergenic
1201605557 Y:15780448-15780470 CTCCCTGCTGCCCAGTTGTGGGG - Intergenic