ID: 1078660286

View in Genome Browser
Species Human (GRCh38)
Location 11:13280178-13280200
Sequence AAGTTAAGCAGATCAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078660283_1078660286 13 Left 1078660283 11:13280142-13280164 CCAGAATATCTGAGCTGAAGCCC 0: 1
1: 0
2: 1
3: 10
4: 189
Right 1078660286 11:13280178-13280200 AAGTTAAGCAGATCAACAGATGG 0: 1
1: 0
2: 1
3: 13
4: 170
1078660285_1078660286 -8 Left 1078660285 11:13280163-13280185 CCTATTTTCATAAGAAAGTTAAG 0: 1
1: 0
2: 2
3: 61
4: 427
Right 1078660286 11:13280178-13280200 AAGTTAAGCAGATCAACAGATGG 0: 1
1: 0
2: 1
3: 13
4: 170
1078660284_1078660286 -7 Left 1078660284 11:13280162-13280184 CCCTATTTTCATAAGAAAGTTAA 0: 1
1: 0
2: 4
3: 56
4: 547
Right 1078660286 11:13280178-13280200 AAGTTAAGCAGATCAACAGATGG 0: 1
1: 0
2: 1
3: 13
4: 170
1078660281_1078660286 23 Left 1078660281 11:13280132-13280154 CCTGGCACCTCCAGAATATCTGA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1078660286 11:13280178-13280200 AAGTTAAGCAGATCAACAGATGG 0: 1
1: 0
2: 1
3: 13
4: 170
1078660280_1078660286 26 Left 1078660280 11:13280129-13280151 CCTCCTGGCACCTCCAGAATATC 0: 1
1: 0
2: 1
3: 23
4: 181
Right 1078660286 11:13280178-13280200 AAGTTAAGCAGATCAACAGATGG 0: 1
1: 0
2: 1
3: 13
4: 170
1078660282_1078660286 16 Left 1078660282 11:13280139-13280161 CCTCCAGAATATCTGAGCTGAAG 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1078660286 11:13280178-13280200 AAGTTAAGCAGATCAACAGATGG 0: 1
1: 0
2: 1
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078660286 Original CRISPR AAGTTAAGCAGATCAACAGA TGG Intronic
901835032 1:11918646-11918668 GAGGTGAGCAGATCACCAGAGGG - Intergenic
902285145 1:15403438-15403460 AAATTAATCAAATCCACAGAAGG - Intergenic
903299082 1:22365317-22365339 AAGAAAAGCAGATGAACAGAAGG - Intergenic
904549318 1:31302252-31302274 ATGTTGGACAGATCAACAGATGG - Intronic
906453892 1:45976844-45976866 AAGTTAAGGGTATCAACACATGG - Intronic
907224306 1:52930009-52930031 AATTTAAGTAGATGAAAAGAGGG - Intronic
910239192 1:85068246-85068268 AAGTTCAGGAGTTCAACTGAAGG - Intronic
912979963 1:114362499-114362521 AAGTTAAGCAAAACAAATGATGG - Intergenic
912990625 1:114482799-114482821 AAGTTAAGCACATCTTCATACGG - Intronic
913482933 1:119306561-119306583 AAGATAAACAGATAAACTGATGG - Intergenic
918474926 1:184914270-184914292 AAGGAAAGCAGATGAGCAGATGG - Intronic
918843129 1:189570734-189570756 AAGTGAAGAATATCAAAAGAGGG - Intergenic
921247409 1:213259109-213259131 AAACTATGCAGATGAACAGAAGG + Intronic
921997340 1:221435394-221435416 AACTTTAGAAGATCAACACAAGG + Intergenic
923991707 1:239444965-239444987 AGGATCAGCAGATCAACAGGTGG + Intronic
1063304354 10:4883237-4883259 AATGTAAGCAATTCAACAGATGG - Intergenic
1064521919 10:16211432-16211454 AAGGAAAACAGATCAAAAGATGG - Intergenic
1064980248 10:21159423-21159445 AAGTTCAGGAGAGCAAAAGAAGG - Intronic
1066510154 10:36086746-36086768 AAGTTAAGAAGACCAAAGGAAGG + Intergenic
1069214255 10:65799639-65799661 GAGTTAAGCAGGTGAAGAGAGGG + Intergenic
1072204599 10:93191939-93191961 AAGCAAGGCAGATCAACTGATGG + Intergenic
1075437813 10:122458629-122458651 AAGACAAGCAGCTCTACAGAGGG - Intergenic
1078049266 11:7947437-7947459 AAGTTAACCAGGTGAACAGTGGG + Intergenic
1078498741 11:11847567-11847589 AACTTAAGCATATAAATAGATGG - Intronic
1078660286 11:13280178-13280200 AAGTTAAGCAGATCAACAGATGG + Intronic
1079816740 11:25070179-25070201 AAGTTAAGCAGAAAGACAAATGG + Intronic
1080205812 11:29727175-29727197 AAATTAAGGAGATCTATAGATGG - Intergenic
1081311956 11:41585224-41585246 GAGATAAGCAGATCAACAAAAGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1083754169 11:64780807-64780829 AAGTAAAGCAGGACAACAAAAGG - Intergenic
1091084482 11:132707212-132707234 AAGTTAGGCAGAGCAATATACGG + Intronic
1092901882 12:13067428-13067450 ATGTTAACCAGATCAGAAGATGG - Intronic
1095405561 12:41863371-41863393 AAATTAAGTAGCTCTACAGATGG + Intergenic
1096798165 12:54091436-54091458 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1098633326 12:72751367-72751389 AAGTGAAGCAGTGCCACAGAGGG - Intergenic
1098783642 12:74721737-74721759 AAGCTAAGAAAATAAACAGAGGG + Intergenic
1099728226 12:86462391-86462413 AAGATAAGAATATCATCAGATGG + Intronic
1106012774 13:25841492-25841514 AAGTGTATCAGAACAACAGAGGG + Intronic
1106298697 13:28442093-28442115 AAGTTAATCAGATAGACACAAGG + Intronic
1106984464 13:35328949-35328971 AAGATAGACAGATCAACGGAAGG + Intronic
1107305372 13:39013284-39013306 AAGGCAAGCAGATAAACTGATGG + Exonic
1107557602 13:41531080-41531102 AAGATAAGAATATAAACAGATGG + Intergenic
1109501901 13:63248837-63248859 AATATAAGTAGACCAACAGAGGG - Intergenic
1109809225 13:67489111-67489133 AAGTGCAGCAGATGTACAGATGG + Intergenic
1110697554 13:78509583-78509605 ATGTTCAGCAGATCTCCAGAAGG + Intergenic
1112724335 13:102285189-102285211 ACATTAATCAGATCACCAGAGGG - Intronic
1112817119 13:103285875-103285897 AAGTGAAGCAGAGCAAGAAAGGG + Intergenic
1113351621 13:109535135-109535157 AAGTTAAGGAGATAAACTGAGGG - Intergenic
1113997018 14:16097113-16097135 AAGTTATGTAGTTGAACAGAGGG - Intergenic
1114518224 14:23315170-23315192 AAATTAAGCAGCCCAACAGAGGG + Intronic
1116667987 14:47802100-47802122 ATGTTAGGCAGATCAAGATATGG - Intergenic
1120442117 14:84554742-84554764 AAGTTAATCAGACAAACAGGAGG - Intergenic
1121621445 14:95352228-95352250 CAGATGAGCAGATCAACAAACGG - Intergenic
1121922407 14:97894425-97894447 TAGATAAACAGATCCACAGATGG + Intergenic
1122311845 14:100802364-100802386 CAGGTAAACAGATCAACAGATGG + Intergenic
1126421801 15:48482002-48482024 CAGTTAATCAAATAAACAGATGG + Intronic
1128378664 15:67095121-67095143 GTGTTAAGCATATCAAAAGATGG + Intronic
1129308589 15:74687607-74687629 GAGGTGAGCAGATCACCAGAAGG - Intronic
1129357704 15:75002739-75002761 AAGTTAAGCAGAAAAAAAAAAGG - Intronic
1130881084 15:88056818-88056840 AAGTGAGGCTGATCATCAGAAGG - Intronic
1130997233 15:88910721-88910743 AAGAAAAGCAGATGCACAGAGGG + Intronic
1131342110 15:91612034-91612056 AAGTCAAGCAGCCCCACAGACGG + Intergenic
1134288215 16:12880782-12880804 AAGTTAAAAACATAAACAGAGGG + Intergenic
1134868356 16:17629359-17629381 AAGTTAAGCACATGATCATAGGG - Intergenic
1136619945 16:31421909-31421931 AAAGTAAGCAGACCAGCAGAGGG - Intronic
1137841239 16:51642782-51642804 AAATTAAACAGAACAAGAGAAGG + Intergenic
1139248055 16:65467143-65467165 CACTTAAACAGAACAACAGAGGG + Intergenic
1141922544 16:87145734-87145756 AGGTTAAGCTGACCCACAGAAGG + Intronic
1144072949 17:11690596-11690618 AAGTTAGGCAGAGGAAAAGAGGG + Intronic
1146567859 17:33928760-33928782 AAATGGAGCAGATCCACAGATGG + Intronic
1146630370 17:34465243-34465265 AAGTCAAGCAGACCTGCAGATGG + Intergenic
1148151504 17:45398999-45399021 AAATTAAACAGAACACCAGAGGG + Intronic
1203182487 17_KI270729v1_random:75302-75324 AAATTAAGCAGATCATGGGAAGG + Intergenic
1155827447 18:30465807-30465829 AAGTAAAGAAAATAAACAGAAGG - Intergenic
1156623625 18:38882534-38882556 AAAGTCAGCACATCAACAGATGG + Intergenic
1158052512 18:53240578-53240600 AAGTCAAGCAAATGAAAAGAGGG - Intronic
1159994575 18:74951388-74951410 AGTTTAGGCAAATCAACAGAGGG - Intronic
1162619358 19:11828913-11828935 AAGGTAGGCAGATCACCTGAGGG - Intronic
1163074574 19:14878474-14878496 ATTTTAAGCAGGACAACAGAAGG + Intergenic
1165016526 19:32885028-32885050 TACTTAAGCAGGTGAACAGAAGG - Intronic
1168692926 19:58387609-58387631 AAGTTACACAGAGCAAAAGAGGG - Exonic
928741840 2:34363797-34363819 AAGCAAAGCAGAACAACAAAGGG - Intergenic
931110319 2:59103414-59103436 GAGTTAAGCAGTTCACCAAAGGG - Intergenic
931564573 2:63601999-63602021 AGGCTAAGCAGATCAATAGCTGG + Intronic
936641965 2:114323319-114323341 AAGTTAAGAAGATGAACAGCTGG - Intergenic
937636408 2:124160415-124160437 AAGGTGATCAGATCAACAGTCGG + Intronic
939825603 2:147011697-147011719 AGATTAAGCAGATGAGCAGAAGG - Intergenic
942436220 2:175980074-175980096 AATTTAAGGGGATCATCAGAAGG - Intronic
942502109 2:176602368-176602390 GAGATAAACAGATCAACTGAGGG - Intergenic
942645902 2:178111203-178111225 AAGTTGAGTAAATCAACAGATGG + Intergenic
942776641 2:179589875-179589897 AAAATTAGCAGATCAACAGTAGG - Intronic
944345335 2:198658431-198658453 AAGTGAAGGACATGAACAGATGG + Intergenic
945307344 2:208270435-208270457 AAGCTAACCACATCACCAGATGG - Intronic
945806029 2:214490805-214490827 AAGTTAAACAGAGAAAAAGAAGG + Intronic
946865340 2:224037412-224037434 AAGTTGAGCATCTCAAGAGAGGG + Intronic
1170239165 20:14143983-14144005 AAGTCAATCAGATTAAAAGAGGG - Intronic
1171849995 20:30301256-30301278 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1171877564 20:30592932-30592954 AAGGTGAGCAGATCACCCGAGGG + Intergenic
1172953130 20:38734978-38735000 AAGTCAAGCAAATGAAGAGAAGG + Intergenic
1183064388 22:35353224-35353246 AAATCAAGCCGATTAACAGATGG - Intergenic
949277673 3:2304709-2304731 AACAGAAGCAGATAAACAGAAGG + Intronic
949313104 3:2722175-2722197 AAGTTAAGTATATCAAGAAAGGG - Intronic
950010248 3:9717962-9717984 AAGATAAGCAGGTGAACAGATGG + Intronic
952320392 3:32271664-32271686 AATTTAATCAGTTCAAAAGATGG - Intronic
955689904 3:61580806-61580828 AACTTAAGAAGATCTACTGAAGG - Intronic
956210910 3:66800265-66800287 CATTAAAGCAGATCTACAGATGG - Intergenic
957147030 3:76437408-76437430 AAGGAAAGAAAATCAACAGATGG + Intronic
957479033 3:80767764-80767786 AATTTAAAAACATCAACAGAGGG + Intergenic
958688615 3:97431771-97431793 ATTTTAAAAAGATCAACAGATGG + Intronic
960626216 3:119684806-119684828 AAGTTAGGGAGTTCAAGAGATGG - Intergenic
967548748 3:190764581-190764603 TACTTAAACAGATCCACAGATGG + Intergenic
969048095 4:4352947-4352969 AAGCTAAGCTGACCAAAAGAGGG - Intronic
969510532 4:7614997-7615019 TGGATAAGCAGATGAACAGATGG - Intronic
969954992 4:10880014-10880036 AAGATTAGCAGATGAACAGTTGG - Intergenic
971656988 4:29361040-29361062 AAGTTATGTATATCAACATATGG - Intergenic
972417882 4:38860678-38860700 GAGCAAAGGAGATCAACAGATGG + Intergenic
972944813 4:44241504-44241526 AAGTTAAGCAGCTAAATAAATGG + Intronic
974895781 4:67936580-67936602 AAGGTAATCAGATCATCAAATGG + Intronic
975322587 4:73025304-73025326 GAGTTAAGAAGATCAAGGGATGG + Intergenic
976054655 4:81049585-81049607 AAGTTAAACAGATACACACAAGG - Intronic
978542464 4:109832775-109832797 AAGTTAAGCTGACAAAAAGAGGG + Intronic
978646589 4:110940255-110940277 AAGTTAATCAAGTCAATAGAAGG + Intergenic
979278379 4:118837667-118837689 AAGTCAAGCAGGTCATCACATGG - Intronic
979800761 4:124905838-124905860 AAGTTAGGCAAATCATCAGATGG + Intergenic
981428797 4:144636070-144636092 AAGCTATGGAGATCCACAGAGGG + Intergenic
981736744 4:147961580-147961602 AGGTAAAGCAGATCAAGAAAGGG - Intronic
982914311 4:161186176-161186198 AAGTAAAGCAGATGAACAGATGG - Intergenic
984906727 4:184634772-184634794 AAGTGAAGCAGAACAGAAGATGG + Intronic
986567870 5:9133416-9133438 AAGTTAAGCATATACAAAGAAGG - Intronic
987323472 5:16791754-16791776 AATTTAAGAAGATTAACAGAAGG - Intronic
987533123 5:19146944-19146966 AAATTAAGAAAATCAACAGCTGG + Intergenic
989285388 5:39693040-39693062 ACGATAAGCACATCAAAAGATGG - Intergenic
989978126 5:50609030-50609052 AAGGTCAGCAGATAAACACATGG - Intergenic
990848802 5:60176962-60176984 AAGATAAGCAAAGCAACAGGGGG + Intronic
991275699 5:64844105-64844127 AAGTCAAGCACAACACCAGATGG + Intronic
993045297 5:82859598-82859620 ACTGTAAGCAGAGCAACAGATGG + Intergenic
997126380 5:131231720-131231742 AAGTTAATGATTTCAACAGAAGG - Intergenic
998613380 5:143713316-143713338 AATGTAAGCAGATGACCAGAAGG - Intergenic
1000597641 5:163234080-163234102 AAATTAAGCAGATCTGCAGTTGG - Intergenic
1000924630 5:167178758-167178780 AAGTCAAGTATCTCAACAGAGGG + Intergenic
1001355602 5:171019744-171019766 AACTTAAGGAGATCAAGACATGG - Intronic
1001790521 5:174453762-174453784 AAGTTTAGAAGCTCAAGAGAAGG - Intergenic
1001980877 5:176036279-176036301 TAGCTTAGCAGATCAAGAGAAGG - Intergenic
1002236585 5:177807786-177807808 CAGCTCAGCAGATCAAGAGAAGG + Intergenic
1005630422 6:27702165-27702187 AAGATTAGCAGATCCAGAGAAGG - Intergenic
1009351953 6:62691421-62691443 AAGTTAGGCAGTTCAAGAGCAGG - Intergenic
1011826752 6:91316277-91316299 AAGTTAAGAGCATCAACAAATGG + Intergenic
1014699006 6:124660176-124660198 AAGATAGGCAGTTCTACAGAAGG - Intronic
1015486217 6:133772997-133773019 AGGGTAAGCATATCAACAAATGG - Intergenic
1017130957 6:151107898-151107920 AAGTTAAGCAAAACCACAGGAGG + Intergenic
1017491190 6:154946691-154946713 AAGGTAGGCAGATCAACTTAAGG - Intronic
1017966190 6:159268903-159268925 TAGACAAGCAGATGAACAGATGG - Intronic
1017991903 6:159496856-159496878 AAAATAAGCAGTTCAAAAGAAGG - Intergenic
1022073594 7:26942548-26942570 AAGTTAAGCAGATGCACCTAAGG + Intronic
1023274841 7:38507298-38507320 AAATTAAGCAGATAAACTAAAGG + Intronic
1023560618 7:41469907-41469929 AAGTTAAAAAGGGCAACAGAAGG + Intergenic
1028678948 7:93503161-93503183 ATGTGGAGCAGATCCACAGAGGG - Intronic
1030190254 7:106803562-106803584 TGGTTAAGCAAATCAGCAGATGG - Intergenic
1032842620 7:135726390-135726412 AAGTTAAACAGTTAAACAGAGGG - Intronic
1033896591 7:146079086-146079108 AAAATAAATAGATCAACAGAAGG + Intergenic
1037229666 8:16642114-16642136 TATATAAGCATATCAACAGATGG - Intergenic
1043361044 8:79472294-79472316 TAGATAAGCAGATCATCAGTAGG + Intergenic
1047407104 8:124594809-124594831 ATGTTAAGCACTTCCACAGATGG - Intronic
1047743132 8:127823356-127823378 AATTTAAGCATATCAAAAGCAGG - Intergenic
1049158442 8:141081911-141081933 AAGTTAAGCAAACCCAAAGAGGG - Intergenic
1051296786 9:15604861-15604883 AAGATATGAACATCAACAGATGG + Intronic
1052133428 9:24880038-24880060 AAGTGAGGCAGTTTAACAGAAGG - Intergenic
1053787770 9:41664549-41664571 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1054157356 9:61650218-61650240 GAGATAAGCAGAACAGCAGAGGG + Intergenic
1054176046 9:61875891-61875913 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1054477130 9:65581223-65581245 GAGATAAGCAGAACAGCAGAGGG + Intergenic
1054661493 9:67704917-67704939 GAGATAAGCAGAACAGCAGAGGG + Intergenic
1055043078 9:71896625-71896647 AAGTCAAGCAAATAAACAGGGGG + Intronic
1055259242 9:74413237-74413259 ATGTTAAACAGGTGAACAGAGGG + Intergenic
1056646657 9:88418117-88418139 AAGCTAAGCTGATCACCAGTGGG - Intronic
1059807909 9:117824422-117824444 AAGTTAAGCATAGAAAAAGAAGG + Intergenic
1188387300 X:29576779-29576801 AACTTCAGCAGAACAACAAAGGG - Intronic
1188727730 X:33606789-33606811 AAGTCAAGCAGATCCAAAGTGGG + Intergenic
1189007030 X:37007612-37007634 AAGTTAAAGTAATCAACAGAGGG + Intergenic
1189694628 X:43651861-43651883 AAGATATGCAGCTCACCAGAAGG - Intergenic
1190233717 X:48600786-48600808 AAGGGAAGCAGATCAGAAGACGG + Intronic
1192055199 X:67766704-67766726 AAGTAAAGCAGATAAAAGGATGG - Intergenic
1197232022 X:124015334-124015356 AAATTAGGGAGATTAACAGAGGG + Intronic
1198132317 X:133708882-133708904 AAGTTAATCAGATAAACAAATGG - Intronic
1200362421 X:155622772-155622794 GAGTCAAGCAGACCAACAGATGG + Intronic