ID: 1078661612

View in Genome Browser
Species Human (GRCh38)
Location 11:13292023-13292045
Sequence GTTCACTCCATTCCTAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078661612_1078661614 -3 Left 1078661612 11:13292023-13292045 CCTTTCCTAGGAATGGAGTGAAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1078661614 11:13292043-13292065 AACTGCTAAAAGAAGAGCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 269
1078661612_1078661615 3 Left 1078661612 11:13292023-13292045 CCTTTCCTAGGAATGGAGTGAAC 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1078661615 11:13292049-13292071 TAAAAGAAGAGCTCTGGTTGTGG 0: 1
1: 0
2: 1
3: 18
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078661612 Original CRISPR GTTCACTCCATTCCTAGGAA AGG (reversed) Intronic
907527988 1:55065009-55065031 ATTCATTTCATTCCTAGGATAGG - Intergenic
908474331 1:64472807-64472829 CTTCACTCCATCCCTAGGGCTGG + Intronic
910120393 1:83782126-83782148 GTTCCAACCATTCCTAGGACTGG - Intergenic
910230797 1:84984558-84984580 CTTCAATCCCTTCCTGGGAAAGG + Intronic
910440255 1:87244541-87244563 ATTCTCTCCATGCCTAAGAAAGG - Intergenic
910736426 1:90463058-90463080 TCTCAGTCCACTCCTAGGAATGG - Intergenic
911050698 1:93668484-93668506 GTTTAGTGCATTCCGAGGAATGG - Intronic
913699123 1:121357106-121357128 GTTCACATCATGCCAAGGAATGG + Intronic
914138423 1:144922939-144922961 GTTCACATCATGCCAAGGAATGG - Intronic
918452447 1:184672549-184672571 TTCCACTCCATTGCTAGGAGAGG + Intergenic
920486533 1:206375818-206375840 GTTCACATCATGCCAAGGAATGG + Intronic
922124726 1:222711721-222711743 GTTCCCTCCTTTCCTACGCATGG + Intronic
922183248 1:223252776-223252798 GTCTTCTCCATTCCTAGGAAGGG - Intronic
1063208065 10:3853902-3853924 GTCCACTCCACTCCTGGGAAAGG + Intergenic
1066479410 10:35781100-35781122 GATCACTTTGTTCCTAGGAAAGG - Intergenic
1070731944 10:78835309-78835331 GTTCAGAACATTCCCAGGAAAGG + Intergenic
1072877598 10:99189848-99189870 GGTCAATTCATTCCAAGGAAGGG - Intronic
1074707463 10:116147741-116147763 GTTGTCTCCAGTTCTAGGAAAGG - Intronic
1078661612 11:13292023-13292045 GTTCACTCCATTCCTAGGAAAGG - Intronic
1080641536 11:34161221-34161243 GGCCACTCCATGCCCAGGAAGGG - Intronic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1085072368 11:73558936-73558958 GTTCAGTGTATACCTAGGAATGG - Intronic
1085170909 11:74449169-74449191 ATTCTCTCCATTCCTAGGTGAGG + Intergenic
1085647965 11:78240233-78240255 GTTCCCTGCATTCCAGGGAAAGG + Intronic
1085725051 11:78947830-78947852 GTTCCCTCCATGCCCAGGAAGGG + Intronic
1087616174 11:100488931-100488953 TGTCACCCCTTTCCTAGGAAAGG - Intergenic
1087673249 11:101129598-101129620 GTACAGCCCATTCCCAGGAAGGG + Exonic
1092060956 12:5549856-5549878 GTCAAATCCATTCCTAGTAAAGG - Intronic
1092226566 12:6752192-6752214 GTTCCAACCATTCCTAGCAATGG + Intronic
1094485397 12:30922683-30922705 TGTGACTCCATTTCTAGGAATGG + Intergenic
1100886351 12:99074864-99074886 GTGTGCTCCATACCTAGGAAAGG + Intronic
1101324192 12:103699904-103699926 GTTCCCTCCCATCCTAGGCACGG - Intronic
1102373902 12:112405509-112405531 TTTCACAGCATTCCAAGGAAAGG - Intronic
1102611410 12:114115686-114115708 TTTCACTCCAAGTCTAGGAAAGG + Intergenic
1106562415 13:30858264-30858286 GTTCCCTCAATTCTTAGGACAGG + Intergenic
1109310861 13:60691543-60691565 TTTCAGTCTGTTCCTAGGAAAGG + Intergenic
1111172812 13:84551142-84551164 GTTGACTTCATTAGTAGGAATGG - Intergenic
1111634649 13:90888402-90888424 ATTCACTCAACTCCTAGAAATGG + Intergenic
1118747796 14:68786422-68786444 GTTTACTCCAGTCCTAAGAAGGG + Intergenic
1121576138 14:94989691-94989713 GTTCCCTGCATTCCTAGGGGAGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1123215849 14:106808708-106808730 GCTCACTCTATTCCTGAGAAAGG - Intergenic
1123463910 15:20499782-20499804 CTCCACTCCATTCCTAAGGAAGG + Intergenic
1123654153 15:22500641-22500663 CTCCACTCCATTCCTAAGGAAGG - Intergenic
1124155870 15:27224938-27224960 GGTCACTCAGTTGCTAGGAATGG + Intronic
1124308060 15:28595837-28595859 CTCCACTCCATTCCTAAGGAAGG - Intergenic
1131045024 15:89307544-89307566 GCTTCCCCCATTCCTAGGAAAGG - Intronic
1134801132 16:17085786-17085808 GTTCACCTCATTCCTATGGAGGG + Intergenic
1136873524 16:33829372-33829394 GCTCACTCTATTCCTGAGAATGG + Intergenic
1142128917 16:88423469-88423491 GTTCTCTACATTGCTAGGAGGGG + Intergenic
1203098650 16_KI270728v1_random:1286683-1286705 GCTCACTCTATTCCTGAGAATGG - Intergenic
1143165983 17:4897532-4897554 GCCCACTCAATTCCTGGGAAGGG - Exonic
1143328746 17:6118967-6118989 GCTAATTCCATTCCCAGGAAGGG + Intronic
1146215198 17:30973502-30973524 CTGCACTCCATCCCTGGGAAAGG - Intronic
1146352140 17:32103816-32103838 GTTCTCTCTTTTCCCAGGAAAGG + Intergenic
1149829659 17:59861097-59861119 CTTCACTCCATTCCTAGAACTGG - Intronic
1149869648 17:60170188-60170210 GTTCTCTCCTTTCCCAGGAAAGG + Intronic
1150226395 17:63526925-63526947 GTTCTCACCACTCCTAGCAAAGG - Intronic
1150300735 17:64045036-64045058 GGTCACTCCACACCTAGGCATGG + Intronic
1153557416 18:6330167-6330189 GTTAAGTCCATGCCTAGGAGTGG + Intronic
1155655408 18:28186114-28186136 GTTCACTCCATTCCCACTAACGG + Intergenic
1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG + Intergenic
1167383131 19:49149892-49149914 GTTCACTCCCGCCCTGGGAAGGG - Intronic
927112189 2:19871562-19871584 GGTCACGTCATTCATAGGAATGG - Intergenic
933980571 2:87547029-87547051 TTTCACTAAAATCCTAGGAAGGG - Intergenic
935569745 2:104646710-104646732 GTACACTTCATTCCTAGAATTGG - Intergenic
936313256 2:111403762-111403784 TTTCACTAAAATCCTAGGAAGGG + Intergenic
938383839 2:130850990-130851012 GTTCACTCAGCTCCTTGGAATGG + Intronic
940025241 2:149199853-149199875 GCTCACTCCCTTCCTTGCAAGGG - Intronic
940054653 2:149500765-149500787 GTTTACCCCATTGCCAGGAAGGG + Intergenic
942447702 2:176088960-176088982 GTTCTCTCCATCCCAAAGAAGGG + Intergenic
944456680 2:199902069-199902091 GATCCCTCTATTCCTGGGAAAGG - Intergenic
947555082 2:231085128-231085150 GTCCACCCCATTCCCAAGAAAGG - Intronic
949024783 2:241762011-241762033 GTTCCCTCCATTCCCCCGAAGGG - Intronic
1169537960 20:6566578-6566600 GGTCACTCCTGTCTTAGGAAAGG + Intergenic
1173068967 20:39743121-39743143 GTTCTATCCCTTCATAGGAAAGG + Intergenic
1173118418 20:40268486-40268508 GTAAACTACATTCCTAGTAATGG + Intergenic
1175479649 20:59301975-59301997 GTTCACTTCATTCAGAGGGAGGG - Intronic
1177665086 21:24146238-24146260 ATTCACTCCATTTCCAGCAATGG + Intergenic
1185346047 22:50311287-50311309 GTTCACCCCTTACCAAGGAAAGG + Exonic
949526272 3:4907714-4907736 TGTCACTTCATTCTTAGGAAGGG + Intergenic
950424596 3:12918256-12918278 GTGCACCCCATTCCCAAGAAGGG - Intronic
950516126 3:13466665-13466687 CTTCTCTTTATTCCTAGGAATGG - Intergenic
951336232 3:21425594-21425616 TTTCACTCCTGCCCTAGGAAAGG + Exonic
951835961 3:26983785-26983807 GTTATCTGCATTCCTAGGAAAGG + Intergenic
953752379 3:45618590-45618612 CTTCCCTCCCTTTCTAGGAAAGG - Intronic
954401812 3:50323047-50323069 CTTCACTCCTTCCCTAGGATTGG + Intronic
955940562 3:64143468-64143490 GTCCACTCCCTCCTTAGGAATGG + Intronic
964878443 3:161396361-161396383 GTTCACTCCAATCCAAGCAAAGG + Intergenic
968065133 3:195754263-195754285 GTCCACTGCGTTCCTGGGAAGGG - Exonic
968085268 3:195871291-195871313 GCTCACTCCATACCTGGGAGAGG - Intronic
969343797 4:6558786-6558808 GTCCACTCCAGACCCAGGAAAGG + Intronic
970854900 4:20639893-20639915 GTTTATTTAATTCCTAGGAAGGG - Intergenic
971592276 4:28483256-28483278 TTTCACTCCTTTCCTGGGAAAGG + Intergenic
972399538 4:38687959-38687981 GTACAATCCATGCCTAGGACTGG - Intronic
976224795 4:82787438-82787460 GTTGCCTCCATTCCCTGGAAAGG - Intronic
986185501 5:5432519-5432541 TTTCAGTTCATACCTAGGAATGG + Intronic
987194576 5:15513225-15513247 GTTTGCTCAATTTCTAGGAAAGG - Intronic
989244197 5:39235185-39235207 GTTCACACCATAACTAGAAATGG + Intronic
989310423 5:40010779-40010801 TTTCACTCCATTGATAAGAAAGG + Intergenic
989692864 5:44166316-44166338 GTTCTTTCTATTCCTAGGCATGG + Intergenic
995404439 5:111778623-111778645 TTTCACTCCATTTCTTGGAATGG + Intronic
996746162 5:126847970-126847992 GTTCATTCTCTTCCTAGGACTGG + Intergenic
999073490 5:148772749-148772771 ATTCTCTCAATTCCTAGAAAGGG - Intergenic
999702853 5:154244157-154244179 GGTCACTCCATTCCCAGCAGTGG - Intronic
1006341019 6:33447129-33447151 GTTCACTCCAAACCTAAGCAGGG + Intronic
1007914706 6:45550451-45550473 ATTCCCTCAATTCCGAGGAAAGG + Exonic
1008022190 6:46592164-46592186 ATTCATTCCATTTCCAGGAAAGG + Intronic
1009830623 6:68927526-68927548 GTTCTCTCCATACCTTGCAATGG - Intronic
1010927063 6:81755542-81755564 GTGCCCTCCATTTCTGGGAATGG - Intergenic
1011680109 6:89774962-89774984 GTTCACTCCATATATAGGTAGGG - Intronic
1013271711 6:108551511-108551533 GTTTACTCCATTTCTAGATATGG + Intergenic
1013520298 6:110926569-110926591 GTTCCCTCCGTGCCTAGGAGGGG + Intergenic
1017342555 6:153342421-153342443 ATTCTTTCCATTCCTAGGCAAGG - Intergenic
1019623098 7:2002169-2002191 GTTCCCTGCAGTCCTAGAAATGG - Intronic
1023217928 7:37885369-37885391 GTCCACTCCGTCCCCAGGAAAGG - Intronic
1024202370 7:47120353-47120375 GTTCAGTCCATTCCCACGCAAGG + Intergenic
1027737831 7:81956695-81956717 ATTCACTCCATTCATAGTAATGG + Intronic
1029551016 7:101237193-101237215 CTTCACTCCAGTTCTAGGCATGG + Intronic
1029931626 7:104377234-104377256 GTTTAAACCATCCCTAGGAAAGG + Intronic
1032329975 7:130969216-130969238 GTGGACCCAATTCCTAGGAAAGG - Intergenic
1032532543 7:132634148-132634170 GTGCCCTGCATTCCAAGGAATGG - Intronic
1035092678 7:156327554-156327576 CTTGACTCCCTTCCTAGGACTGG + Intergenic
1036017927 8:4806884-4806906 GCTCATTCAACTCCTAGGAAGGG - Intronic
1036997748 8:13678568-13678590 GTTCTTGCCAATCCTAGGAAGGG - Intergenic
1043769304 8:84177994-84178016 GTTAATTTCATTCCTAGAAAAGG + Intergenic
1043775303 8:84259948-84259970 GTTCACTGTATTCCCTGGAAAGG + Intronic
1045484612 8:102621461-102621483 CTTGTCTCCATTCCTGGGAAGGG + Intergenic
1045890783 8:107154600-107154622 GTTCAATACATTCCAAAGAAGGG + Intergenic
1045976732 8:108138010-108138032 CTTCGCTCTATTCCTAGAAATGG + Intergenic
1048474519 8:134731231-134731253 GTTGAGTCCATTCCTAGGAGTGG - Intergenic
1057059968 9:91995003-91995025 CTTCACTCCAGTCCGTGGAAGGG + Intergenic
1058069806 9:100590401-100590423 GGTCCCTTCATCCCTAGGAAGGG + Intergenic
1059342126 9:113603221-113603243 GTTCTGTCCATTCCAAGGAAGGG + Intergenic
1060072685 9:120564036-120564058 GTTCTTTCAATTCCTTGGAAAGG + Intronic
1062689051 9:137832159-137832181 CTTCCCTCCAGTCCTAGGATTGG + Intronic
1062689071 9:137832226-137832248 CTTCATTCCAGTCCTAGGATTGG + Intronic
1062689169 9:137832561-137832583 CTTCTCTCCAGTCCTAGGATTGG + Intronic
1186380252 X:9050528-9050550 GTTGAGTATATTCCTAGGAATGG - Intronic
1186711222 X:12199447-12199469 GTTCACTACCTTACTAGAAATGG + Intronic
1187728351 X:22227226-22227248 GTTCTTTCCATTCCTAGCAGGGG - Intronic
1188583007 X:31738155-31738177 GTTAACTGTATTTCTAGGAATGG - Intronic
1189613920 X:42765305-42765327 TTCCACTCCTTTGCTAGGAATGG + Intergenic
1190072537 X:47291105-47291127 TCTCACTCCTTTACTAGGAAGGG - Intergenic
1193012067 X:76687647-76687669 TTTCAGTCCAGTCCTACGAAGGG + Intergenic
1194316644 X:92384963-92384985 GTTCAGCCTATTCCCAGGAATGG + Intronic
1195595117 X:106680132-106680154 GTCCACTCCATGCCTAGCACTGG + Intergenic
1197158173 X:123292927-123292949 GTGCACTCCATTTCTAGGGAAGG + Intronic
1198107899 X:133478409-133478431 TTTCACTCCATTCCCAGGCGAGG + Intergenic
1200624820 Y:5498285-5498307 GTTCAGCCTATTCCCAGGAATGG + Intronic