ID: 1078667525

View in Genome Browser
Species Human (GRCh38)
Location 11:13339053-13339075
Sequence TGTCACATGGGGCATGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078667515_1078667525 19 Left 1078667515 11:13339011-13339033 CCCTGGATGGGTGGATGGTGTAC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1078667525 11:13339053-13339075 TGTCACATGGGGCATGTACCTGG 0: 1
1: 0
2: 1
3: 8
4: 94
1078667519_1078667525 -9 Left 1078667519 11:13339039-13339061 CCTCTTCCTCCAGCTGTCACATG 0: 1
1: 0
2: 1
3: 35
4: 410
Right 1078667525 11:13339053-13339075 TGTCACATGGGGCATGTACCTGG 0: 1
1: 0
2: 1
3: 8
4: 94
1078667514_1078667525 22 Left 1078667514 11:13339008-13339030 CCTCCCTGGATGGGTGGATGGTG 0: 2
1: 0
2: 0
3: 20
4: 186
Right 1078667525 11:13339053-13339075 TGTCACATGGGGCATGTACCTGG 0: 1
1: 0
2: 1
3: 8
4: 94
1078667516_1078667525 18 Left 1078667516 11:13339012-13339034 CCTGGATGGGTGGATGGTGTACA 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1078667525 11:13339053-13339075 TGTCACATGGGGCATGTACCTGG 0: 1
1: 0
2: 1
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078667525 Original CRISPR TGTCACATGGGGCATGTACC TGG Intronic
901012741 1:6210526-6210548 TGTCACCTGGAGCCTGGACCAGG + Intronic
907289402 1:53403199-53403221 TGTTACGAGGGGCATGTAACAGG - Intergenic
908695416 1:66835100-66835122 TATAACATGGGACATGTAACAGG - Intronic
911801858 1:102150114-102150136 TGTCACATAGGGCAGGTCACTGG + Intergenic
912690704 1:111802691-111802713 TGTCACATTGAGCCTGTAGCAGG + Intronic
913042380 1:115040046-115040068 TGTCAAAGGGGCCATGAACCAGG + Intergenic
916685874 1:167145383-167145405 TTGCACATGGGGCATTTTCCAGG - Intergenic
918959322 1:191251990-191252012 TGTCACATCTGGCCTGTATCAGG + Intergenic
921954674 1:220969733-220969755 TGCCACATGGTGTATGTACATGG + Intergenic
924477714 1:244395984-244396006 TGTCAGGTGGGGCAGGTACTGGG - Intergenic
1063912750 10:10848922-10848944 TCTCACATGGTCCAGGTACCTGG + Intergenic
1073033243 10:100545063-100545085 TGTCACATGGGTGATGAACAGGG - Exonic
1075922037 10:126221707-126221729 TGTCACAGGGGGCAAGAAGCAGG + Intronic
1076109352 10:127849162-127849184 TGTTACCTGGGGAATGGACCGGG + Intergenic
1078667525 11:13339053-13339075 TGTCACATGGGGCATGTACCTGG + Intronic
1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG + Intergenic
1090941120 11:131389235-131389257 TGTCACCTGGGGCAGGTAAGGGG - Intronic
1093515376 12:19979849-19979871 TGGCACATGCTGTATGTACCAGG + Intergenic
1095736205 12:45559075-45559097 TGGCATATGTGCCATGTACCTGG + Intergenic
1097698815 12:62800229-62800251 AGGCACATGGTGCATGTTCCAGG - Intronic
1102396912 12:112593920-112593942 TGTTATATGGGGGAAGTACCAGG - Intronic
1103803124 12:123552555-123552577 TGACATAAGGGGCATGTACGAGG - Intergenic
1107185885 13:37519573-37519595 TTTCAGATGGGGCATGAAGCTGG - Intergenic
1108208578 13:48115800-48115822 TGTCACATAGGAGATGTGCCAGG - Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1110812971 13:79830681-79830703 TGTCACACGGGGTATTTCCCTGG + Intergenic
1112985945 13:105450040-105450062 TGTGACATGGGGTATGTCACAGG - Intergenic
1118440705 14:65809012-65809034 AGGCAGATGGGGCAAGTACCTGG - Intergenic
1120196271 14:81486788-81486810 TGTCAAATGGGGCTTTTAACAGG - Intronic
1120760889 14:88284261-88284283 TGTCACATTGAGCATGCACCTGG + Intronic
1121741055 14:96252696-96252718 TCTCAGAAGGGGCTTGTACCAGG - Intronic
1122124493 14:99571788-99571810 TGTCACAGGGGGCATTGAACTGG - Intronic
1122653041 14:103236758-103236780 CGTGAAATGGGGCATGTCCCTGG + Intergenic
1124808122 15:32906884-32906906 TCTCACATGGAGCATGGTCCAGG - Intronic
1128366612 15:67008176-67008198 TGGCACAGAGGGCATGTGCCAGG - Intergenic
1129407056 15:75327064-75327086 TGTGACCTGGGGCAGGTACGGGG - Intergenic
1131145589 15:90009557-90009579 GGGCACATGGGGAATGGACCAGG - Intronic
1133008084 16:2895747-2895769 TGTCACAGGGAGCATGGGCCAGG - Intronic
1137010440 16:35315471-35315493 TGTAACCTCGGGCATGCACCTGG - Intergenic
1140476913 16:75243703-75243725 GGCCACATGGAGCACGTACCCGG - Intronic
1141637475 16:85322193-85322215 TGTCACATGGCACACGTTCCAGG + Intergenic
1142672893 17:1495478-1495500 TGCCAAATGGGGCATGTGCCTGG + Exonic
1143513998 17:7410399-7410421 GGGCACGTGGGGCATGTACTGGG - Intronic
1153186887 18:2496333-2496355 TGTCACATGGTTAATGTAACGGG - Intergenic
1156475793 18:37404557-37404579 TCTCACATGGGGGCTGTGCCTGG + Intronic
1164724143 19:30453897-30453919 TGTGACATGTGGCATGTGTCTGG + Intronic
1164869526 19:31631622-31631644 TGGCCCATGAGGCATGTACCAGG - Intergenic
1165190734 19:34061111-34061133 TGTCACATGGGCTATTTCCCAGG - Intergenic
926399153 2:12478053-12478075 TGTAACATGTGCCATGTGCCAGG + Intergenic
932164571 2:69494352-69494374 AGCCACCTGGGGCATGTGCCTGG + Intronic
932457456 2:71858510-71858532 TGTCACAGGAGGCATGGACAGGG - Intergenic
933870101 2:86557715-86557737 TGTCACAAGTGGCATTCACCAGG - Intronic
934677518 2:96260155-96260177 TGTTACATGGGGCAGGCCCCTGG - Intronic
936271682 2:111054045-111054067 TGTAGCATGGGGAATGTTCCAGG - Intronic
943265111 2:185720565-185720587 TGTCAGATGAGGCATGTCACAGG + Intergenic
948061269 2:235044733-235044755 GGTCACATGTGGCACATACCCGG + Intronic
1169422251 20:5470114-5470136 TCTCACATGGGGCTTCTGCCTGG + Intergenic
1173105786 20:40132774-40132796 TTTCACAAAGGGCATGCACCAGG - Intergenic
1179523691 21:41961817-41961839 TGTCACCTGGGGCTTCTACTAGG - Intergenic
1181305194 22:21912528-21912550 GGTCCCATGGGGCCTGCACCTGG + Intergenic
1181860638 22:25815354-25815376 TGTCACATGGGGCACCTGCAGGG - Intronic
950359103 3:12437769-12437791 TGTTAAATGGAGGATGTACCAGG - Intergenic
951035791 3:17930582-17930604 TGTGACATGGGGCAAGTGACTGG + Intronic
955458101 3:59147354-59147376 GGTCACATGGGACATTTTCCAGG - Intergenic
956208368 3:66777261-66777283 TTCCACAAGGGGCATTTACCTGG + Intergenic
962411295 3:135143672-135143694 TGTCAACTGGGGCATGTCACTGG - Intronic
965070284 3:163909482-163909504 TGTCAAATGGGCCATGAACTGGG - Intergenic
972037672 4:34547158-34547180 AGAAATATGGGGCATGTACCTGG + Intergenic
975042106 4:69758886-69758908 TAACACATGGGGCTTGTACATGG - Intronic
975480407 4:74873157-74873179 TGTTTCATTGGGCATGTTCCAGG - Intergenic
976729175 4:88245008-88245030 TGTCACATGGGACAGCTGCCTGG - Intergenic
977786246 4:101038092-101038114 CATAACATGGGGCATGAACCTGG + Intronic
978775956 4:112507189-112507211 TGTGACATTGGGCATGTGCACGG - Intergenic
984082832 4:175270316-175270338 TGTCATATGGGGCATCTATCTGG - Intergenic
986805212 5:11302525-11302547 TCCCACATGCGGCATTTACCGGG - Intronic
988334901 5:29894342-29894364 TGTCTCATGGGTCATTTAGCAGG - Intergenic
991619929 5:68534634-68534656 TGTCCCATGGGGCATATATCAGG - Intergenic
994324878 5:98436826-98436848 TGGCACTTGAGGCAAGTACCTGG - Intergenic
996726043 5:126674113-126674135 TGTCAAATGGGCCATGAACTGGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999224907 5:150013412-150013434 TGTCAAATGGGGTTTGTCCCAGG - Intronic
999884940 5:155911828-155911850 TGTCACCTGGGTTATATACCTGG + Intronic
1001539647 5:172528431-172528453 TGTCCCTTGGGCCATGGACCTGG - Intergenic
1007273421 6:40655837-40655859 TGAGACATGGGTCATGTCCCTGG - Intergenic
1011522436 6:88223474-88223496 TCTCACATGTCACATGTACCAGG - Intergenic
1027270242 7:76514985-76515007 TGCCACATGGGGCACGTGCTGGG - Intronic
1028864030 7:95687299-95687321 TGTGAAATGAGGCATGTACAAGG + Intergenic
1030205309 7:106946703-106946725 TGTTACATGGCCCATGTAACAGG - Intergenic
1031893820 7:127324998-127325020 TGCCACATTGGGCATGTGGCTGG - Intergenic
1035055031 7:156029368-156029390 TTTCCCATGGGGCTTGAACCTGG - Intergenic
1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG + Intergenic
1042788366 8:72575051-72575073 TTTCCCATGGGGCATATACCTGG + Intronic
1044934345 8:97278556-97278578 TGTAACCTGGGGAATGTGCCCGG - Intergenic
1047302987 8:123630667-123630689 TGTGAGATGGGGCCTGCACCTGG + Intergenic
1048718899 8:137299755-137299777 TGTCATATGGGGCATGAAGAAGG + Intergenic
1050362147 9:4840287-4840309 TGTCACGTGGGGTTTGTATCAGG + Intronic
1050596938 9:7213479-7213501 TGTTGCATGGGGCAGGCACCTGG + Intergenic
1053360984 9:37486428-37486450 TGTCACTTTAGGTATGTACCAGG + Intronic
1058886993 9:109329358-109329380 TGTCACCTGGGGCATGTCCCAGG - Intergenic
1059520030 9:114932408-114932430 TGTTTTCTGGGGCATGTACCTGG + Intergenic
1187337258 X:18392071-18392093 TGTCACATGAGACATGTCCATGG - Intergenic
1192238149 X:69309293-69309315 TGTCACATGGGGGCTGTAGGTGG + Intergenic
1199512464 X:148637964-148637986 TGTGACCTGGGGCAAGTTCCTGG - Intronic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic