ID: 1078668583

View in Genome Browser
Species Human (GRCh38)
Location 11:13345810-13345832
Sequence CCTGTTCCTGCTCTTGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078668583 Original CRISPR CCTGTTCCTGCTCTTGGATC AGG Intronic
900297099 1:1957356-1957378 CCTGGTCCTGCCCCTGGAGCAGG - Intronic
901559572 1:10059412-10059434 CCTGTTTCCCCTCCTGGATCTGG - Intronic
901789396 1:11646503-11646525 CCTGTTCCCGCCCTTGGCTTTGG + Intergenic
902684619 1:18067813-18067835 CCTGCTCCAGCTCTTGGTTCAGG + Intergenic
904966048 1:34373507-34373529 CCTGTTCCTCTTCTAGGATCAGG + Intergenic
905389791 1:37629081-37629103 ACTGTTCCTGCCCTATGATCTGG + Intronic
906099985 1:43254086-43254108 CCTGCTCTTGCTCTTGGATCTGG - Intronic
907594639 1:55708133-55708155 CCTGTTCCTCCTCATGCCTCAGG + Intergenic
911885977 1:103300099-103300121 CATTTTCCTGCTCTTGATTCTGG - Intergenic
914244237 1:145873742-145873764 CCTGCGCCTGCTCTCGAATCTGG + Exonic
914513042 1:148351563-148351585 CCAGTCCCTGCTCTTGGACAGGG - Intergenic
919966451 1:202531617-202531639 TCTGTTCCTCCTTTTGGAACAGG - Intronic
920832348 1:209477136-209477158 CCTATTCTTGCTGTGGGATCAGG + Intergenic
921327133 1:213997474-213997496 CCATTTCCTGCTCTCTGATCAGG - Exonic
922551206 1:226495840-226495862 CCTGTTCCAGGTCCTGGCTCAGG - Intergenic
922890569 1:229058694-229058716 CCTGTTCCTGCTCCAGGATGGGG - Intergenic
924243631 1:242061765-242061787 CCTTTTCCTGCTCTGAGAACAGG - Intergenic
1062763579 10:45509-45531 CCTTTTCCTGCTCTTAGAACAGG + Intergenic
1064396614 10:14987324-14987346 CCTGTCCCTGTCCTTGTATCTGG - Intronic
1065766989 10:29039474-29039496 CCTAGTCCTGCTCCTGGCTCAGG + Intergenic
1065977741 10:30858117-30858139 CGTGTCCCTGCTCTTGAAACAGG + Intronic
1067015683 10:42755132-42755154 CCTGCTTCTTCTCTTGGCTCCGG + Intergenic
1067687387 10:48475222-48475244 CTTGTTCCTTCACTTGGCTCAGG + Intronic
1069915671 10:71785205-71785227 CCCGTTCCTGCACTGGGATGAGG + Intronic
1072028625 10:91493167-91493189 CCTGTTTCTACCCTTGGTTCAGG + Intronic
1074571605 10:114629449-114629471 CCTGTTCCTGCTCTGACAACGGG + Intronic
1075377331 10:121989175-121989197 CCTGATCCTTCCCTTGGAGCAGG - Exonic
1078668583 11:13345810-13345832 CCTGTTCCTGCTCTTGGATCAGG + Intronic
1079110993 11:17605140-17605162 CCTGTGCCTGCTTGTGGATTTGG + Intronic
1079867730 11:25756969-25756991 CCTGTTGCTGCTGCTGGCTCAGG - Intergenic
1080103342 11:28484922-28484944 ACTGTGCCTGCTCATGAATCAGG + Intergenic
1081897329 11:46597744-46597766 ACTGTTCCTTATCTTGGCTCTGG + Intergenic
1084161947 11:67354922-67354944 CCTTTCCCTGCTCTGGGGTCTGG + Intronic
1084355137 11:68633461-68633483 CCTCTTCATGCTATTGTATCGGG + Intergenic
1084475595 11:69386916-69386938 CCTGTCCCTGCTCCTGGATCTGG + Intergenic
1085288580 11:75380870-75380892 TGTGTTCCAGCTCTTGGTTCAGG - Intergenic
1085454990 11:76660632-76660654 CCTTTCCCAGCTCTTGAATCTGG - Exonic
1085636690 11:78164660-78164682 CCTGTCCCTGATCTTGGACTTGG - Intergenic
1090281896 11:125463552-125463574 CCTCTTCTTTCTCATGGATCTGG + Exonic
1091296764 11:134479369-134479391 CCTTTTCTTTCTGTTGGATCAGG + Intergenic
1091597329 12:1886855-1886877 CCTCTTCCTGCTCTTGTGTCGGG + Intronic
1092978794 12:13772664-13772686 CCTCTTCTTGCTCTTAGTTCAGG - Intronic
1093658573 12:21726214-21726236 CCTGATCCTGCTCTCCTATCAGG + Intronic
1093756245 12:22855382-22855404 GATGTACCTGCTCTTGTATCTGG - Intergenic
1096706286 12:53424436-53424458 CCTGTGCCCGGTCTTGGGTCAGG - Exonic
1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG + Exonic
1100239146 12:92693154-92693176 CATGTTACTGCTCTGGGATGTGG + Intergenic
1102876065 12:116449666-116449688 CCTTCTCCTGCTCTTGGACTGGG + Intergenic
1103415912 12:120741424-120741446 CCTGTCCCTGCCCTGGGCTCAGG + Intergenic
1103736599 12:123064679-123064701 CCTGTTCCTGCTGTTGTATTTGG - Intronic
1104485658 12:129149436-129149458 CATGTTCCTGCTTTTGTTTCAGG - Intronic
1104952550 12:132448249-132448271 CCTGTCCCTGCTGTTTGAACGGG + Intergenic
1107297206 13:38921889-38921911 CCTGCTCTTGGTCCTGGATCTGG + Intergenic
1107887962 13:44890318-44890340 CCAGTTCCTGCTGTTAGCTCTGG - Intergenic
1108268555 13:48736079-48736101 ACTGTTTCTGCTCTGGGGTCTGG - Intergenic
1108355511 13:49625719-49625741 CCTGGTGCTGCTCTGGGAACTGG + Intergenic
1114678458 14:24461669-24461691 ACCATTCCTGCTCATGGATCAGG - Intergenic
1116195869 14:41723905-41723927 CCTGTTCTTGGTCCTGGGTCTGG + Intronic
1119663183 14:76465807-76465829 CATCTCCCCGCTCTTGGATCTGG - Intronic
1119824827 14:77648917-77648939 GCTGTTACTGCTCTTGGAAGTGG - Intergenic
1119935588 14:78589692-78589714 CCTGGTTCTGCTCTTGGGCCAGG + Intronic
1121326364 14:93022187-93022209 CCTTTGCCTGCTCTTGGACCTGG - Intronic
1121813593 14:96912635-96912657 CCTTTTCCAGCTCTTGAATCTGG - Intronic
1122309552 14:100785835-100785857 CCTGTTCTTGCCTTTGCATCTGG + Intergenic
1122976426 14:105172718-105172740 GCTGTGCCTCCTCTTGGAGCTGG - Intergenic
1126420730 15:48469602-48469624 CTTGGTCCTCCCCTTGGATCTGG + Intronic
1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG + Intergenic
1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1129165932 15:73777472-73777494 CCTGGTCCTGCCATTGCATCTGG - Intergenic
1129177223 15:73848669-73848691 TCTGCTCCTGCACTTGGCTCTGG - Intergenic
1129614856 15:77090346-77090368 ACTGTTTCTGCCCTAGGATCAGG - Intergenic
1130868029 15:87948790-87948812 CCTGTTGCTGCCCTGGGACCAGG + Intronic
1131068154 15:89447615-89447637 CCTGTTCCTGCTTGTGGCTGAGG - Intergenic
1133001678 16:2854905-2854927 CCTGTTCCCACTCTGGAATCAGG + Intronic
1133244162 16:4436283-4436305 TCTTTTCCCACTCTTGGATCAGG - Intronic
1134856583 16:17525088-17525110 CCTATTCCTGTGCTTGGAACGGG - Intergenic
1136057417 16:27700705-27700727 CTTCTTCCTGCTCCTTGATCAGG - Intronic
1138562653 16:57811090-57811112 GATGCTCCTGCCCTTGGATCAGG - Intronic
1138574873 16:57901176-57901198 TCCGCTCCTGCTCTTGGGTCTGG + Intronic
1139029117 16:62857897-62857919 CCTGGTCCTTTTCTTGGCTCTGG - Intergenic
1140051341 16:71484251-71484273 CCAGTTCCTGCTCTAGATTCCGG - Intronic
1140336399 16:74109033-74109055 CATGTGCCTGCCCCTGGATCTGG - Intergenic
1143290526 17:5824482-5824504 CCTGGTCCTGCTGTTGGAAAAGG + Intronic
1143802796 17:9398501-9398523 CCTTTTCCTGTTCTAGGATACGG - Intronic
1144343609 17:14331312-14331334 CCTGTTCCTGTTCCTGGAAGGGG - Intronic
1144802566 17:17940576-17940598 CTTATTCCTGCTCTTTGTTCAGG - Intronic
1145063199 17:19745003-19745025 CCTGCTCCTGCTCCTGGATCAGG + Exonic
1149372538 17:56009421-56009443 CCTATTCCAGCTCTGGCATCTGG - Intergenic
1149997432 17:61412350-61412372 TCTGTTCCTCCTATTGGATGGGG + Exonic
1150017840 17:61577120-61577142 CTTGTTTCTGTTTTTGGATCTGG - Intergenic
1151642304 17:75405270-75405292 CCTCCTCCGGCTCTTGGCTCTGG - Exonic
1151651475 17:75472751-75472773 CCTGCTCCTGCCCATGGATTTGG + Intronic
1152395406 17:80030027-80030049 CCTGATCCTGCGATTGCATCAGG + Intronic
1152486985 17:80600983-80601005 GCTGTTCTTTCCCTTGGATCTGG + Intronic
1152956488 18:45840-45862 CCTTTTCCTGCTCTTAGAACAGG + Intergenic
1153162385 18:2222190-2222212 CCAGGTGCTGCTCTAGGATCTGG - Intergenic
1157131832 18:45014421-45014443 CATCCTCCTGCTGTTGGATCAGG + Intronic
1157630223 18:49087941-49087963 CCTGTGCCTGCTTTTTGATGGGG + Intronic
1158188837 18:54802390-54802412 TCAGTGCCTGCTCTTGTATCTGG + Intronic
1158432809 18:57405266-57405288 CCAGTTCCTGGTCTTGGCTCAGG - Intergenic
1158594556 18:58804776-58804798 GATCTCCCTGCTCTTGGATCTGG + Intergenic
1160804781 19:987752-987774 CCCCTTCCTGTTCTTGGCTCGGG + Intronic
1161134064 19:2609426-2609448 CCTGGTCCTGCCCTGGGATTTGG + Intronic
1161819107 19:6518197-6518219 CCTCTTCATGCTCTTGGAAGGGG + Intergenic
1162548740 19:11346603-11346625 CCTGTTCATGCTCTCCCATCAGG - Exonic
1162660231 19:12163148-12163170 CCTGTACCTGCCTTGGGATCCGG + Exonic
1163498963 19:17664217-17664239 CCTCTCCCAGCTCTTGGATAAGG + Intronic
1164567658 19:29339469-29339491 CCTCTTCCTTCTCTTGGTTGAGG - Intergenic
1164896719 19:31883319-31883341 CCTGTTCCTGCTCCTACAGCAGG + Intergenic
1168324998 19:55533992-55534014 CCTGTTACTGCTCATGCCTCCGG + Intronic
1168493315 19:56829567-56829589 CCTCTTCCTGCCTTTGGCTCTGG - Intronic
925155708 2:1647759-1647781 CGGGTTCCTGCTGTTGTATCAGG - Intronic
926247404 2:11131529-11131551 TCTGTTCCTCCCCTTGGAGCTGG - Intergenic
929997897 2:46840443-46840465 CATCTTCCTGCTCCTGGATTTGG + Intronic
932126829 2:69152204-69152226 CCTGTTCCTGCTCCTAGCCCTGG + Exonic
934154365 2:89182116-89182138 CCTTTTCCTTATCTGGGATCAGG + Intergenic
934212866 2:89999824-89999846 CCTTTTCCTCATCTGGGATCAGG - Intergenic
934619351 2:95794481-95794503 CCTTTTCTTCCTCTTGGCTCTGG - Intergenic
934641541 2:96030076-96030098 CCTTTTCTTCCTCTTGGCTCTGG + Intronic
935126190 2:100224897-100224919 CCTTTTTCTGCTGTTGGATATGG - Intergenic
936042511 2:109160718-109160740 CCTGCTCCTACTCTGGGAGCTGG + Intronic
937766648 2:125669000-125669022 CCTGTTGCTGCTCCTAGGTCTGG + Intergenic
939080197 2:137651049-137651071 CCCGTTTCTGGTCTTGGATCAGG + Intronic
946441887 2:219703816-219703838 CCAGTTCCAACTCTTGTATCTGG + Intergenic
946498054 2:220216054-220216076 GCTGTTCCTGGTCCTGGGTCAGG + Intergenic
946863559 2:224022810-224022832 CCTGGTCCTGCCCTTGGCACAGG - Intronic
947265422 2:228274335-228274357 CCTGTGCCTGGCCTTGGCTCTGG + Intergenic
947542303 2:230987456-230987478 CCTGATCCTGCTCCTGATTCTGG - Intergenic
1168981481 20:2007633-2007655 CCCGTTACTGCTCTTCAATCTGG - Intergenic
1169015426 20:2289067-2289089 TCTCTTCCGGCTCTGGGATCCGG + Intergenic
1169197193 20:3689619-3689641 CCTGCTCCTGCTGTTGGGCCTGG - Exonic
1169481080 20:5981368-5981390 CCTGTTCCTGCTGTTCAATGTGG - Intronic
1175479259 20:59300229-59300251 TCTGTTCTTGCTCTTGGATGGGG + Intergenic
1176086724 20:63298751-63298773 ACTGTTCCTGCTCTAGGAACAGG - Intronic
1179431848 21:41326802-41326824 CCTGTTCCTCCTCCTGCCTCAGG - Intronic
1179716998 21:43293530-43293552 CCAGTTCGTGCCCCTGGATCTGG - Intergenic
1181414940 22:22752600-22752622 CTTCTTCCTGCTCCTGGTTCAGG - Intronic
1181804577 22:25367103-25367125 CCTGTTCCTTCTCGTGGACTGGG + Intronic
1183102992 22:35595198-35595220 CCTCTTCCTGCCTTTGGATGTGG + Intergenic
1183886354 22:40886397-40886419 CTTGTTCTTGCTCTTGGCTTTGG - Exonic
1184511894 22:44938771-44938793 CCTGTTCCTGATCCTGGTCCTGG - Intronic
1184832358 22:46996751-46996773 CATGTTCCTGCTGTGGGATGAGG + Intronic
1185385152 22:50528505-50528527 CCCGTACCTGCTCTGGGCTCTGG + Exonic
1185414278 22:50701188-50701210 CCGGTGCCTGCTGTGGGATCGGG + Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
952440053 3:33317467-33317489 CCTGTCCCTGCTCCTGAATATGG - Intronic
953118090 3:40012736-40012758 TCTTTTCCTGCCCTTGGATTGGG + Intronic
955957531 3:64305658-64305680 CCTGTTCCTACTGTGGGACCTGG + Intronic
956314560 3:67919921-67919943 GCAGTTCCAGCTCCTGGATCTGG + Intergenic
960728055 3:120691878-120691900 GCTGGTCTTGGTCTTGGATCTGG - Intronic
961430079 3:126875204-126875226 CCTCTTCCTGCTCTGGATTCTGG - Intronic
962352370 3:134665272-134665294 CCTGGTGCTGCCCCTGGATCTGG + Intronic
964577417 3:158188481-158188503 CCTCTTCCTGCTCTATCATCTGG + Intronic
967264490 3:187678323-187678345 CCTTTTCCTTCTCTTGGCTTTGG - Intergenic
968357843 3:198122390-198122412 CCTTTTCCTGCTCTTAGAACAGG - Intergenic
968500514 4:947751-947773 CCAGTGCCTGCTCTGGGGTCCGG - Exonic
968833415 4:2945302-2945324 CCAGATCCTGTTCTTGGCTCCGG - Intronic
969073549 4:4558876-4558898 CATTTTCCTGCTCTAGGAGCTGG - Intergenic
970450437 4:16161490-16161512 CATGTTCCTGCTCTGAAATCAGG + Exonic
981638884 4:146912702-146912724 CCCCTCCCTTCTCTTGGATCAGG - Intronic
981815327 4:148824699-148824721 CCTGCTCCTGCCCCTGGATTCGG + Intergenic
982922655 4:161294682-161294704 CCTGATTCTTCTCTTGGAGCAGG - Intergenic
985182803 4:187283063-187283085 CCTGTTCCTGCTCTTGTAATTGG + Intergenic
985440606 4:189980684-189980706 CCTTTTCCTGCTCCTAGAACAGG + Intergenic
985495132 5:199897-199919 CCTGCACCTGCTCCTGGAGCAGG + Exonic
986237014 5:5920349-5920371 CTGGTTCATGGTCTTGGATCAGG + Intergenic
986357455 5:6942805-6942827 ATTGTTCCTCCTCTTGAATCTGG + Intergenic
990651206 5:57901507-57901529 AATGTTTCTGCTCTTGGATTTGG - Intergenic
992328243 5:75685238-75685260 CCTGTTTCTGCTCTTGGTGCAGG - Exonic
995888728 5:116925008-116925030 CCTATTCCTGTTTTTGAATCAGG + Intergenic
997201179 5:132011164-132011186 TCTGTTCCTGGCCTTGGCTCAGG + Intronic
999628888 5:153549349-153549371 CCTGCTTCTGCTCTTGGAGGTGG - Intronic
1000152745 5:158519293-158519315 CCTGTTCCTTCTCCTGGAACAGG - Intergenic
1000895309 5:166848081-166848103 AATCTTCCTGCTCTTGGTTCTGG - Intergenic
1003311655 6:4974261-4974283 CCGGTTCTGGCTCTTGGCTCCGG + Intergenic
1006892821 6:37444353-37444375 CCTGTTTCTGCTGTTCTATCTGG + Intronic
1008167541 6:48157040-48157062 CCTGTTCTTGGTCCTGGGTCTGG + Intergenic
1009849804 6:69180897-69180919 CCTGCTCTTGCTCCTGGTTCTGG + Intronic
1015189122 6:130454368-130454390 CCTTTCCCTACTCTTGTATCCGG - Intergenic
1018453180 6:163928025-163928047 CATGTCCCTGCTCTTTAATCTGG + Intergenic
1019329083 7:453917-453939 CCTGGTCCTGCTGCTGGGTCAGG - Intergenic
1019341706 7:511659-511681 CCTGGTGCTGCTCATGGCTCTGG - Intronic
1021112584 7:16712493-16712515 CCTGTTCCTGCTGAAGGAGCTGG - Intergenic
1021462195 7:20901036-20901058 CTTTTTCCTGCTCTAGGCTCTGG + Intergenic
1022103484 7:27182963-27182985 CCCGTTCCAGCTCTCGGATCTGG + Exonic
1022817102 7:33924269-33924291 CCTGTTACTGCTCTTGACTTTGG + Intronic
1022908869 7:34881138-34881160 CCTGAGGCTGCTCTTGGATGGGG - Intergenic
1023592669 7:41796098-41796120 TCTGATCCTGCCTTTGGATCCGG + Intergenic
1023857285 7:44192357-44192379 AGTGTGGCTGCTCTTGGATCAGG - Intronic
1029346635 7:99983498-99983520 CCTGTTCCTCCCCTGGGATTGGG - Intergenic
1029378227 7:100195305-100195327 CCTCTTGATGCTCTTGGAGCTGG - Exonic
1029558583 7:101287367-101287389 CCTGTTCCTCCTCTGGGATTGGG + Intergenic
1030519920 7:110586347-110586369 CCTATTCCTGCAGTGGGATCTGG - Intergenic
1031185696 7:118477084-118477106 CCTGTTCCTGTTGTTGCTTCAGG - Intergenic
1032305435 7:130729719-130729741 CTAATTCCTGGTCTTGGATCTGG + Intergenic
1032683449 7:134208867-134208889 CCTGAGCCAGCTCTTGGTTCTGG - Intronic
1034150909 7:148914710-148914732 CGTGTTCCTGTTCTAGGAACTGG - Intergenic
1034340413 7:150349993-150350015 CCTGTTAGTTCTCTTGGATTTGG - Intergenic
1034495254 7:151417037-151417059 CCCGTTCCTGCTCTGTGGTCTGG - Intergenic
1035595208 8:852257-852279 CCTCTCCCTGCACGTGGATCTGG + Intergenic
1036819561 8:11929422-11929444 CCTGTTCCTGTCCATGTATCTGG - Intergenic
1038038943 8:23707717-23707739 GCTGTTACTACTCCTGGATCAGG + Intergenic
1044459525 8:92428719-92428741 CCAGTTGCTGCTCCTGGCTCGGG + Intergenic
1045808627 8:106195157-106195179 CTTGTTCCTGCTATTAAATCTGG + Intergenic
1047771602 8:128034336-128034358 CCTGTTCATCCTTCTGGATCTGG + Intergenic
1048975755 8:139672243-139672265 CCTGGTCCTGCTCCTGCCTCTGG - Intronic
1050553559 9:6769734-6769756 CATGTGCTTGCTCTTGGAGCAGG - Intronic
1050631024 9:7558898-7558920 CCTCTTCCTCCTCCTGGAGCTGG + Intergenic
1051164529 9:14247820-14247842 CCTGTTCCTGCTTTTAGTTTAGG - Intronic
1053151661 9:35747654-35747676 CCTGTTCCTGTTAATGGGTCTGG + Intronic
1055329809 9:75171896-75171918 CATGTTCCTTCCCCTGGATCTGG - Intergenic
1057177551 9:93010923-93010945 CCAGTTGCTGCCCTTGGACCAGG - Intronic
1058062615 9:100514421-100514443 TCTGTTCCAGCTCTAAGATCTGG - Intronic
1058938466 9:109791363-109791385 CATGTTCCTGCTTTTGCCTCTGG + Intronic
1060343855 9:122800212-122800234 GCTGTTCTTGCTCTTGTATGTGG + Exonic
1061913660 9:133738115-133738137 CCTGGTCCTGCTCATGCAGCTGG + Intronic
1062304419 9:135895151-135895173 GCTGTTTCTCCTCTTTGATCTGG - Intronic
1062397803 9:136359416-136359438 CCTGTCCCTGCTCTCGGGTGCGG - Exonic
1062543820 9:137053124-137053146 CCTGTTGATGCTCTGGGCTCTGG - Intronic
1062741718 9:138178950-138178972 CCTTTTCCTGCTCCTAGAACAGG - Intergenic
1186338695 X:8620096-8620118 CCTGTTCTTTTTCTTGGAGCAGG + Intronic
1188844618 X:35058114-35058136 CCTGTCCCTGCTATCAGATCTGG + Intergenic
1193968004 X:88013271-88013293 TCTGTTCATGCACTTGGATTGGG + Intergenic
1199694625 X:150335148-150335170 CTTGTGCCTGCTATTGAATCAGG + Intergenic
1201758566 Y:17515302-17515324 CCTTTTCCTGCTCTGAGAACAGG + Intergenic
1201842989 Y:18390688-18390710 CCTTTTCCTGCTCTGAGAACAGG - Intergenic
1202302069 Y:23427415-23427437 TCTGTTCCTCCTTTTGGAACAGG - Intergenic
1202568742 Y:26243183-26243205 TCTGTTCCTCCTTTTGGAACAGG + Intergenic