ID: 1078668922

View in Genome Browser
Species Human (GRCh38)
Location 11:13348074-13348096
Sequence GGAGCTGCTGCAGGAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 2, 2: 10, 3: 74, 4: 742}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078668913_1078668922 21 Left 1078668913 11:13348030-13348052 CCTACAAGCAGAGAATGGTCACA 0: 1
1: 0
2: 1
3: 16
4: 180
Right 1078668922 11:13348074-13348096 GGAGCTGCTGCAGGAGAGCCAGG 0: 1
1: 2
2: 10
3: 74
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078668922 Original CRISPR GGAGCTGCTGCAGGAGAGCC AGG Intronic
900114473 1:1022620-1022642 GGAGATGCAGCTGGGGAGCCAGG - Intronic
900195842 1:1375090-1375112 GGCGCTGCGGCAGGCGGGCCCGG - Exonic
900207416 1:1437523-1437545 GGAGCCGCAGAAGGAGAGGCTGG + Intronic
900228073 1:1542110-1542132 CGAGCTGCTGCAGGAGTTCGAGG - Exonic
900512741 1:3068228-3068250 GGCGCGGCGGCAGGAGAGCGCGG + Intergenic
900894214 1:5471992-5472014 GGAGGTCCCGGAGGAGAGCCTGG - Intergenic
900916004 1:5639096-5639118 AGAGCTGCTGCAGGAGAGGGTGG - Intergenic
900983355 1:6059042-6059064 AGGGCTGCTGCAGGAGAGGTGGG + Intronic
901234505 1:7660796-7660818 GGAGCTGGTGCTGGGGATCCAGG - Intronic
901458631 1:9378166-9378188 GGGACGGCTGCAGGAGACCCAGG - Intergenic
902377423 1:16036408-16036430 GGAGCTGCTCCAGGACAGGCGGG + Intergenic
902382600 1:16059666-16059688 GGAGCTGCTCCAGGACAGGCGGG + Intronic
902410039 1:16207065-16207087 GGAGCTGCTGGGGGAGAGGTTGG + Exonic
902511721 1:16970321-16970343 GCGGCTGCTGCAGGAGCGCCTGG + Exonic
902649443 1:17826974-17826996 GGCATTGCTGCAGGTGAGCCTGG + Exonic
902891520 1:19447716-19447738 GGAGCTGGTGGAGGAGGGCACGG + Intronic
903492968 1:23743533-23743555 GGAGAAGCTGCAGGCGCGCCTGG + Exonic
903786268 1:25863273-25863295 GGAGCCAATGCAGGAAAGCCAGG + Exonic
904266840 1:29323221-29323243 GGAGCTGCTGAAGGTGAGTCTGG + Intronic
904496717 1:30891318-30891340 GGAGCTGGTGCTTGGGAGCCAGG - Intronic
905027962 1:34864324-34864346 TTAGCTGCTGAAGGAGGGCCAGG - Intergenic
905199139 1:36304754-36304776 GGAGCTGCTGGTGGAGAACGGGG - Exonic
905206778 1:36347105-36347127 GCCGCTTCTGCTGGAGAGCCAGG - Intronic
905240889 1:36580774-36580796 GTGGCTGCTGCAGGTGAGCTGGG + Intergenic
905581277 1:39084186-39084208 GGGGCTGCTGCAGGAGGGCCTGG - Exonic
905864443 1:41369048-41369070 GGTTCTGGAGCAGGAGAGCCTGG - Intronic
906196229 1:43932233-43932255 GGGGCTGCTGCAGGCGTGCCAGG - Intergenic
906264312 1:44417224-44417246 GGAGCAGCTGAGGGAGAGTCAGG - Intronic
907069291 1:51519303-51519325 GGAGCGGCCGCAGGCGAGGCCGG + Exonic
907104674 1:51871782-51871804 TGATCTGCTGTAGGAGAGTCAGG - Intronic
907551707 1:55310385-55310407 GGAGCTGCAGCAGCTGGGCCTGG + Intergenic
908627724 1:66064349-66064371 GGAGCTGATGCAGAAGAGAAGGG + Intronic
908852401 1:68388498-68388520 GGAGGTTCTGGAGGAAAGCCTGG - Intergenic
909931342 1:81503049-81503071 GGAGCAGCTGCGGGAGCGGCTGG + Intronic
911320080 1:96403106-96403128 GGAGCTGCTGCACTCCAGCCTGG + Intergenic
911618249 1:100038194-100038216 GGAGTGGCTGCAGCAGCGCCAGG + Exonic
912089515 1:106054236-106054258 GGAGCTGATGCTGGAAAGGCAGG + Intergenic
913105284 1:115608796-115608818 GGTGCTGCCGCAGAAGAGCATGG - Intergenic
914474560 1:148012536-148012558 GAAGCTGCTGGAGGAAAGTCGGG + Intergenic
915108429 1:153548359-153548381 GGAGCTGCTGCAGAAGGAGCTGG - Exonic
915244485 1:154546666-154546688 GGAGCTTCTTCAGGTGACCCAGG + Intronic
915316799 1:155033356-155033378 AGAGATGCTGGAGGAGAGGCAGG - Intronic
915637073 1:157194880-157194902 GGAGCTGCTGCGGCTGGGCCGGG + Intergenic
915752907 1:158228587-158228609 GGAGATGCTTCCTGAGAGCCAGG - Intergenic
915914938 1:159935225-159935247 GTGGCAGCTGCAGGGGAGCCTGG - Intronic
916284707 1:163093680-163093702 GGGGCAGTTGGAGGAGAGCCCGG + Intergenic
917725935 1:177827336-177827358 GGAGCAGCAGCAAGAGAACCTGG - Intergenic
917968954 1:180195202-180195224 CCAGCTGCTGCTGGAGGGCCAGG + Intronic
919025593 1:192165200-192165222 GGGGGTGCTGCAGGAGACCAGGG - Intronic
919332993 1:196194790-196194812 GGAGCAGCTACATGATAGCCAGG + Intergenic
919525695 1:198647269-198647291 CCAGTTGCTGCAAGAGAGCCTGG - Intronic
919765892 1:201127204-201127226 GGTGCTGTGGCAGGAAAGCCCGG - Intergenic
919784475 1:201250638-201250660 GGCCATGCTGCAGGAGAGGCAGG + Intergenic
919815006 1:201431692-201431714 GCATCTGCTGCAGCAGAGGCTGG + Intergenic
920099453 1:203507815-203507837 GGAGGGGCTGCTGGAGAGGCTGG + Intronic
920182842 1:204143190-204143212 GTAGCTTCTTAAGGAGAGCCAGG - Intronic
920848897 1:209615375-209615397 GGAGCTGCTGCGGGGCAGCCAGG - Exonic
921074156 1:211686226-211686248 GGAGCAGCAGCAGGAGAGTGCGG - Intergenic
921373821 1:214452594-214452616 ACAGCTGCTGCAGGAGCCCCTGG + Intronic
922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG + Exonic
922514325 1:226195542-226195564 GGAGAGGCTGCAGGAGAGGCTGG + Intergenic
922603203 1:226872136-226872158 GGGGCTGCTGCTGGGGTGCCTGG + Intronic
922808082 1:228400954-228400976 GGGGCTGCTGCAGGTGAGCTGGG - Exonic
924138580 1:240998528-240998550 GGAGCAGCAGCAGCAGAGGCGGG + Intronic
924624647 1:245688410-245688432 GGAGCTGCTGCAGGGTGGCGCGG + Exonic
1062883147 10:995007-995029 GCAGCAGGTGCAGGAGACCCAGG + Intronic
1062988339 10:1790828-1790850 GGAGCAGCTGTAGGAGAAGCAGG - Intergenic
1063379006 10:5572574-5572596 GGAGCTGTTGCAGAAGGGTCTGG + Intergenic
1063619937 10:7637378-7637400 GGAGCTTCTGCAGAGGCGCCTGG - Exonic
1064213907 10:13383638-13383660 GGAGGTGCGGCTGGAGAGGCAGG + Intergenic
1064245002 10:13661301-13661323 GGAGGTGCTGTGGGAGAGGCTGG + Intronic
1064583478 10:16817042-16817064 GAAGTTGGTGGAGGAGAGCCGGG - Exonic
1064985669 10:21207635-21207657 GGAGCCCCTGCAGGAGATCATGG + Intergenic
1065380367 10:25083974-25083996 GGATCAGCTGAAGGAGAGTCAGG - Intergenic
1066621281 10:37354101-37354123 GGGGGTGCTGCAGGAGACCAGGG - Intronic
1066984624 10:42454231-42454253 GTGGCTGCTGCTGTAGAGCCTGG - Intergenic
1067090477 10:43263801-43263823 GGAGGTGCTGCAGCAGAGCCGGG + Intronic
1067207655 10:44233525-44233547 GGAGGTCCTGCAGGGAAGCCCGG + Intergenic
1067255530 10:44635125-44635147 GGAGATGAGGCAGGAGAGGCTGG + Intergenic
1067440896 10:46308752-46308774 GGAGCAGGGGCAGGAGACCCGGG - Intronic
1067577030 10:47415442-47415464 GGAGCAGGGGCAGGAGACCCGGG - Intergenic
1068404739 10:56574382-56574404 GGTGCTGCTGCAGGGGGTCCAGG + Intergenic
1069555925 10:69398619-69398641 CTAGCTGCTGGAGGATAGCCCGG - Exonic
1069594805 10:69663721-69663743 GGAGCTCTTCCAGCAGAGCCAGG - Intergenic
1069628322 10:69881592-69881614 AGAGCAGGGGCAGGAGAGCCAGG + Intronic
1069984629 10:72274780-72274802 GCAGCTGCTGCAGGAGAGCCTGG + Exonic
1070829119 10:79407924-79407946 GGGGCTGGGCCAGGAGAGCCAGG - Intronic
1071052829 10:81472895-81472917 GCTGCTGCTGCAGGGGAGGCAGG + Intergenic
1071074323 10:81732824-81732846 GGGGCAGTTGGAGGAGAGCCTGG + Intergenic
1071491651 10:86140456-86140478 CAAGCTGCTGCAGGAGTCCCAGG + Intronic
1072107740 10:92290718-92290740 GGCTCTGCCGCAGGAGAGGCTGG + Intronic
1072370898 10:94765646-94765668 GGAGCTGCTGCAGGGGATCCAGG + Intronic
1073096524 10:100983568-100983590 GGAGCTGGGGCAGGAGTGGCTGG - Exonic
1073101082 10:101007057-101007079 GGAGCTGCAGCAGCTCAGCCTGG + Exonic
1073256012 10:102151851-102151873 GGATCTTCTGCAGCAGAGGCAGG + Intergenic
1074185055 10:111093835-111093857 AGAGCTGCTGCAGATGAGCAAGG - Intergenic
1074426719 10:113358093-113358115 GGAGCAGCTGGAGGAGAGGCAGG + Intergenic
1074823997 10:117201794-117201816 GGGGATGCTGCAGGAGAGTTAGG + Intronic
1075047528 10:119158164-119158186 GGAGCTGGGGCAGGAGAGGATGG + Intronic
1075336615 10:121613463-121613485 GGAGCTGCAGGAGGAGAGAAAGG - Intergenic
1075390152 10:122085903-122085925 AGCGCTGGTGCAGGAGACCCAGG + Exonic
1075571628 10:123550672-123550694 AGAGCCGGTGCAGGAGACCCGGG - Intergenic
1075679609 10:124322907-124322929 AGAGCTGCTACAGGAGAGGAAGG - Intergenic
1075688830 10:124381881-124381903 GGTGCTTCTGCAGCATAGCCAGG - Intergenic
1076026236 10:127116188-127116210 GGAGGAGCCCCAGGAGAGCCAGG - Intronic
1076132826 10:128025756-128025778 GGACCTGCTCCAGGGGACCCAGG + Intronic
1076139461 10:128068107-128068129 GGAGCTGCTGCGGGGGACGCGGG - Exonic
1076394568 10:130129243-130129265 GGGGCTGCTCCCGGGGAGCCTGG + Intergenic
1076517481 10:131056183-131056205 GGAAATTCAGCAGGAGAGCCAGG - Intergenic
1076621125 10:131788876-131788898 GGAGCTTCTCCAGCAGAGCTAGG - Intergenic
1076806784 10:132862781-132862803 GGAGCAGGTTCAGGAGAGGCTGG + Intronic
1076837700 10:133029412-133029434 GGAGCTGATTCAGGGGAGCCTGG + Intergenic
1077094055 11:791920-791942 GGGGCTGCTGCAGGACCCCCAGG - Exonic
1077131208 11:973673-973695 GGCGCTGGTGCAGGAGAGGGAGG + Intronic
1077546211 11:3171148-3171170 GGACTTGCTGCAGGAAAGCAGGG + Intergenic
1077625687 11:3769380-3769402 GGAGCCACTGCACGACAGCCTGG + Intronic
1077695352 11:4388290-4388312 GGAACTGCTGCAGGTGAGACAGG - Exonic
1078021119 11:7656660-7656682 GCAGCTGCCGCAGGGCAGCCTGG + Intronic
1078405557 11:11067466-11067488 GGAGCGGCTGCAGGAGCTCAGGG + Intergenic
1078509851 11:11977091-11977113 GGAGCAGCCCCAGGCGAGCCAGG - Intronic
1078668922 11:13348074-13348096 GGAGCTGCTGCAGGAGAGCCAGG + Intronic
1079393060 11:20039023-20039045 GGAGCTGATGCTGGACAGCTGGG - Intronic
1080774100 11:35369804-35369826 GGAGCTGGGGCAGGATAGCATGG + Intronic
1080849782 11:36058158-36058180 GGAGCTGCTGCTGAAGAGACAGG - Intronic
1081620884 11:44618660-44618682 GGCGTGGCTGCAGGAGAACCTGG + Exonic
1081730546 11:45369037-45369059 GCAGCTGCAGCAAGGGAGCCCGG + Intergenic
1081814642 11:45931727-45931749 GGAGATGCTCCAGCAGGGCCAGG + Intronic
1081932185 11:46879171-46879193 GGAGACTCTGCAGGAGAACCTGG - Exonic
1082175763 11:49057138-49057160 GGAGCTGCTCCAGGTGAGGAGGG - Exonic
1083562024 11:63680730-63680752 TGAGCTGATGAAGAAGAGCCAGG - Intergenic
1083647953 11:64184046-64184068 GGAGCTGCCTCAGGGTAGCCAGG - Intergenic
1084044639 11:66561580-66561602 CCAGCTGCTGCAGGAGAGCCTGG + Exonic
1084105047 11:66975548-66975570 GGAGCGGGTGCCGGGGAGCCTGG + Exonic
1084266137 11:68006182-68006204 GGAGCTGCTCTTGGGGAGCCTGG + Intergenic
1084274311 11:68043874-68043896 GCAGCTGCAACAGCAGAGCCAGG + Exonic
1084603433 11:70159742-70159764 GGAGGTGCAGCTGGAGCGCCAGG - Intronic
1084631585 11:70355349-70355371 GGAGCTGCTGGAGGGGAAGCAGG + Intronic
1084696275 11:70757452-70757474 GGAGCTGCTGCCGCAGGGCTGGG - Intronic
1084711167 11:70844563-70844585 AGGGCTGCAGCAGGAGGGCCAGG - Intronic
1084936522 11:72589963-72589985 TCAGCTGCAGCAGGAGACCCGGG - Exonic
1084944891 11:72633118-72633140 AGAACTGCTGCTGGAGAACCAGG + Intronic
1084954618 11:72684712-72684734 GGGGCTGCTGCAGGGCTGCCAGG + Intergenic
1085036709 11:73305325-73305347 TGAGCTGCGGAAGGTGAGCCTGG + Intergenic
1085133991 11:74068325-74068347 AGAGCTGCTGTGGTAGAGCCAGG - Intronic
1085134555 11:74074353-74074375 GGTGCTGCTGCAGGGGACCTGGG + Exonic
1085323343 11:75588289-75588311 GCAGCTCTTGCTGGAGAGCCAGG + Intronic
1085413745 11:76306907-76306929 GGAGATGAAGCACGAGAGCCAGG + Intergenic
1085463390 11:76708571-76708593 GGGGGGGCTGCTGGAGAGCCAGG + Intergenic
1085585572 11:77701349-77701371 TCAGCTGCCTCAGGAGAGCCAGG + Exonic
1086054119 11:82627590-82627612 GGCGCTGCTGCAGGCGGTCCAGG - Intergenic
1086192757 11:84098932-84098954 GGAGGTGCTGCAGCAGAGGATGG - Exonic
1086689980 11:89778931-89778953 GGAGCTGCTCCAGGTGAGGAGGG + Intergenic
1086707489 11:89970462-89970484 GGAGCTGCTCCAGGTGAGGAGGG + Exonic
1086715874 11:90061024-90061046 GGAGCTGCTCCAGGTGAGGAGGG - Intergenic
1087036130 11:93758352-93758374 TGAGCTGCTGCAGCTGCGCCTGG - Intronic
1087261131 11:96013726-96013748 GGGGCTGTTGGAGGAGAGCCAGG + Intronic
1087327993 11:96746783-96746805 GGGGCAGTTGGAGGAGAGCCTGG + Intergenic
1087682581 11:101233016-101233038 GGCGCTGCTGCAGGGGGTCCAGG + Intergenic
1087788734 11:102384789-102384811 GGGGCAGTTGAAGGAGAGCCCGG - Intergenic
1088579440 11:111300573-111300595 GGAGCTGCTGCAGCAAAGACGGG + Exonic
1088590009 11:111395218-111395240 GGAGCTGTGCCAGGAGAGACCGG + Intronic
1088817330 11:113430568-113430590 GGAGCTGCAGCAGGGAAGCCTGG - Intronic
1089457133 11:118632236-118632258 GGATCAGCTGCAGGAGAAGCTGG + Exonic
1089949245 11:122510038-122510060 GGGGCAGTCGCAGGAGAGCCCGG - Intergenic
1090361579 11:126176295-126176317 GGGGCTGATGAAGGAGTGCCAGG - Intergenic
1090387708 11:126366241-126366263 GCAGCTGCTGTAGCTGAGCCCGG + Intronic
1091286889 11:134412646-134412668 CGGGCTGCTGCAGGAGGGCGGGG + Intergenic
1091850724 12:3694592-3694614 GGACCTGCTCCAGGAGAACCGGG + Intronic
1092265633 12:6978317-6978339 TGAGCTGCTGGTGGGGAGCCTGG - Intronic
1092860919 12:12718139-12718161 GGTGCCGGCGCAGGAGAGCCAGG + Exonic
1092903936 12:13085216-13085238 GCAGCAGGTGAAGGAGAGCCAGG + Exonic
1093509024 12:19904082-19904104 GGGGCAGTTGGAGGAGAGCCCGG + Intergenic
1093737242 12:22635257-22635279 GGAGATACTGAAGGTGAGCCAGG - Intronic
1093996909 12:25652835-25652857 GGAACAGATGTAGGAGAGCCGGG + Intergenic
1094494563 12:30981263-30981285 CGTGCTGCTGCTGGAGGGCCGGG - Intronic
1095998650 12:48111055-48111077 GGATCTGCTGGATCAGAGCCTGG - Intronic
1096495493 12:52037258-52037280 GGCGCGGCTGCAGGAGCGCGAGG + Intronic
1096630942 12:52926361-52926383 GGAGGTGCTTCAGGAGAGGAGGG - Intronic
1097699097 12:62802037-62802059 GGAGCAGCTGCAGGACATCGTGG - Exonic
1097872402 12:64611592-64611614 GGAGCCGCACCAGGGGAGCCGGG + Intronic
1098467828 12:70808153-70808175 GGGGGTGCTGCAGGAGAGTAGGG - Intronic
1099377004 12:81904134-81904156 GGTGCTGCTGCAGGGGGTCCAGG - Intergenic
1100563297 12:95770440-95770462 GGTGCTGCATCAGGAGAGCCGGG - Intronic
1101416660 12:104514328-104514350 AGAGCTGCTGCTTGAGAGACAGG - Intronic
1101903182 12:108806760-108806782 GGATCTGCTGCAGCTGGGCCGGG - Intronic
1102436319 12:112926804-112926826 GGGGGTGCTGCAGGAGACCAGGG + Intronic
1102470020 12:113154584-113154606 GGCACAGCTGCAGGAGCGCCTGG + Exonic
1103197998 12:119062263-119062285 GGAGTTGCTCCTGGTGAGCCAGG + Intronic
1103391533 12:120577398-120577420 GGTACAGCTGCAGGAGAGCAGGG + Exonic
1103623659 12:122203752-122203774 GGAGCTCGTGCAGCGGAGCCAGG - Exonic
1103723405 12:122986435-122986457 GAAGCTGCAGCAGCAGTGCCAGG - Exonic
1104143389 12:126009375-126009397 GGAGCTGAAGCAGGAGGGCCTGG + Intergenic
1104329379 12:127830164-127830186 GAAGCTGCTGCAGCTGAGCTGGG + Intergenic
1104811298 12:131621874-131621896 GCTGCGGCAGCAGGAGAGCCAGG - Intergenic
1104858259 12:131911956-131911978 GCAGCAGCTGCAGAAGACCCTGG + Exonic
1104892699 12:132148108-132148130 TGAGTTGCTTCTGGAGAGCCGGG + Intronic
1107037513 13:35916881-35916903 TGACCTGCTGCAGGAGAGAAGGG - Intronic
1107733730 13:43374287-43374309 GGAGCTGCTGCACTCCAGCCTGG - Intronic
1108322040 13:49299247-49299269 GGGGATGCTGGAGCAGAGCCCGG - Intergenic
1108952949 13:56115897-56115919 GGAGGTTCTGCAGGAATGCCTGG + Intergenic
1109425006 13:62156618-62156640 GGTGCTGCTGCAGGGGTTCCAGG - Intergenic
1110464020 13:75780265-75780287 GGGGGTGCTGCAGGAGACCAGGG + Intronic
1111262500 13:85760460-85760482 GGAGTGGTTGCAGGAGAGTCTGG - Intergenic
1111911020 13:94311984-94312006 GGACCAGCTGCAGGAAAACCTGG - Intronic
1112307256 13:98286223-98286245 GGAGCAGATGCAGGAGAGAGGGG - Intronic
1112325799 13:98442142-98442164 GGGGCTGCTGCAGTCGAGGCAGG + Intronic
1112732479 13:102380585-102380607 AGAGCTGCAGCAGGAGAGGCTGG + Intronic
1112868324 13:103936533-103936555 GGAGCTGCTGAAGCAAACCCTGG + Intergenic
1113095935 13:106663736-106663758 AGAGCTGCTGCTTGAGAGACAGG - Intergenic
1113267381 13:108634408-108634430 GAAGCTGATGCAGGAGAGAAAGG - Intronic
1113279387 13:108772254-108772276 GAGGCTGAGGCAGGAGAGCCTGG + Intronic
1113550705 13:111191066-111191088 GGCGCTGCTGCAGGGGGTCCAGG + Intronic
1113734159 13:112665168-112665190 GCACCTGCTGCAGCAGAGGCAGG - Intronic
1113879097 13:113612942-113612964 GGAGCTGCTGCCGGCGATCCAGG - Intronic
1113906551 13:113822015-113822037 CGCGCAGCTGCAGGAGAGGCTGG - Exonic
1113952180 13:114078104-114078126 GGGGCTGCTGCAGCACGGCCTGG + Intronic
1114307504 14:21437229-21437251 GGAACTGGTGCTGGAGAGACAGG - Intronic
1114495238 14:23127419-23127441 GAACCTGGAGCAGGAGAGCCAGG - Intronic
1114673885 14:24428876-24428898 CGAGCTGCTGCAGGGGGGCCCGG - Exonic
1115261344 14:31457342-31457364 GGCACTGCTGTAGGAGCGCCCGG + Exonic
1117145146 14:52829957-52829979 GGAGCTGATGCAGGAGGGTGTGG + Intergenic
1117956457 14:61127262-61127284 GGAGCCCCTGCAGGGGAGTCTGG + Intergenic
1118318187 14:64738101-64738123 GGAGGAGCAGGAGGAGAGCCTGG + Intronic
1118379389 14:65205180-65205202 GCAGAAGCTGCAGGAGAGACTGG - Intergenic
1118468983 14:66057195-66057217 GGAGCTTCTGGAGGACAGACAGG - Intergenic
1118510355 14:66465242-66465264 GGAGCTCCTGCATAAGAGCTAGG - Intergenic
1118786244 14:69047669-69047691 GGAGTTGCTGCATGAGACTCGGG - Intergenic
1118930388 14:70234936-70234958 TGGCCTGCTGCAGGTGAGCCAGG + Intergenic
1120840382 14:89080380-89080402 GGAGCTGAGGCAGGAGAACTGGG + Intergenic
1120953530 14:90062328-90062350 GGAGCTGGCGCACGAGCGCCAGG + Exonic
1121666766 14:95678159-95678181 GGAGCTGGTGAGGGAGAACCAGG - Intergenic
1122055136 14:99092817-99092839 GGAGTGGCTGCTGGAGAGTCTGG + Intergenic
1122100128 14:99401974-99401996 GCACCTGCTGCAGGAGCTCCTGG - Intronic
1122522136 14:102352221-102352243 GGAGCTGCTGCAGGACTCACAGG - Intronic
1122701756 14:103594321-103594343 GGAGCTGCAGCTGGAGGACCCGG + Intronic
1122783532 14:104153677-104153699 GGGGCTGCAGCAGGTGAGCTGGG + Intronic
1122858695 14:104572413-104572435 GGGGCTGCTGCAAGACACCCTGG - Intronic
1122876168 14:104666367-104666389 GGCCCTGCTGCAGGGGAGCTGGG - Intergenic
1122947665 14:105020669-105020691 GGAGCCGCTTCACGAGGGCCCGG - Intronic
1123051065 14:105542837-105542859 GGAGCTGTTGCAAGAGATACAGG + Intergenic
1123058621 14:105584297-105584319 GGACTTGCCGCAGGAGACCCTGG - Intergenic
1123082952 14:105704531-105704553 GGACTTGCCGCAGGAGACCCTGG - Intergenic
1123091906 14:105745670-105745692 AGAGCAGCTGCAGGTGAGCAGGG - Intergenic
1123097414 14:105773083-105773105 AGAGCCGCTGCAGGTGAGCAGGG - Intergenic
1123116397 14:105896096-105896118 GGAGCAGGTGCAGGTGAGGCCGG + Intergenic
1202848641 14_GL000225v1_random:1836-1858 GAAGCTCCTCCAGCAGAGCCCGG - Intergenic
1124013563 15:25858951-25858973 GGTGCTGCTGGAGGAGGACCTGG - Intronic
1124270277 15:28274403-28274425 TGAGCTGTTGCAGGAGTCCCTGG - Exonic
1124420745 15:29519345-29519367 GGAGGGGCAGCAGGAGAGGCAGG - Intronic
1124626116 15:31308405-31308427 GGAGAGGCTGCAGGTGGGCCGGG + Intergenic
1125200758 15:37099091-37099113 GCAGCGGCAGCAGGAGAACCGGG + Intronic
1125510706 15:40291065-40291087 GGAGCTGCTGCGGCAGGGCGAGG - Exonic
1125510782 15:40291350-40291372 GGAGCTGCTGCAGCGGGGCGCGG - Exonic
1125525142 15:40369757-40369779 GGAGCTGCTGCTGGACCACCAGG + Exonic
1126278863 15:46918912-46918934 GGAGCCGTTGGAGGAGAGCCAGG + Intergenic
1127397031 15:58551173-58551195 GGAGGGGCTGCAGGAGAACTGGG - Intronic
1127591219 15:60425483-60425505 GAAGCTGCTGCAAGAAAGACTGG + Intronic
1127774348 15:62253760-62253782 GGAGGAGCTGCAGGAGAAGCTGG - Intergenic
1127867259 15:63042785-63042807 GGGGCTGCAGCAGGAGCGGCGGG - Exonic
1128997403 15:72306998-72307020 GAAGCGGGTGCAGGAGAGGCAGG + Intronic
1129160745 15:73746427-73746449 GCAGCTGGAGCAGGAGAGGCTGG - Intronic
1129182820 15:73887694-73887716 GCAGGTGCTGCAGGAAAGCATGG + Exonic
1129188532 15:73924749-73924771 GCAGCTGCTGCAGCAGAGGAGGG - Intergenic
1129271450 15:74421364-74421386 GGAGCTGCAGCACTAGGGCCCGG + Intronic
1129275494 15:74442714-74442736 GGAGCTGCTGCAGGGGAGCTGGG - Intergenic
1129294336 15:74591657-74591679 GGAGCAGCTGCGGGAGCGGCTGG + Exonic
1129333541 15:74839659-74839681 GGAGCCGCTGCAGTAGGTCCCGG + Exonic
1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG + Exonic
1129570766 15:76681842-76681864 GGAACGTCTGCAGTAGAGCCTGG + Intronic
1129881685 15:79010875-79010897 AGAGCTGCTGCGGGAAGGCCTGG + Intronic
1130371115 15:83285533-83285555 ACAGCTGCTGCAGCAGCGCCCGG + Intergenic
1130756730 15:86772120-86772142 GGAGATGCTGAAGGAGATGCTGG - Intronic
1130829555 15:87585386-87585408 GGAGCTGCTGCAGATGTGCATGG - Intergenic
1131116471 15:89799222-89799244 CGAGCTTCTGCAGCTGAGCCAGG + Intronic
1131142923 15:89992308-89992330 GGTGCTGCTGCTGCATAGCCAGG + Intergenic
1131227624 15:90638544-90638566 GGGGCTGCTGCAGGAGGGGCTGG - Exonic
1131411736 15:92213206-92213228 GGCGCTGCTGCAGGGGGTCCAGG - Intergenic
1131590320 15:93741164-93741186 GGAGCTCCAGCGGGAGAGGCAGG - Intergenic
1132312365 15:100866502-100866524 GGAGCTTTGGCAGGAGTGCCTGG + Intergenic
1132547407 16:539715-539737 GGAGCTGCTGCAGGCCAGGCTGG - Intronic
1132606131 16:794485-794507 GGAGCCCCTGCCGGACAGCCTGG + Intronic
1132622844 16:875873-875895 CCAGCTGCTGGAGGAGGGCCGGG - Intronic
1132826060 16:1906254-1906276 AGAGCCCCGGCAGGAGAGCCTGG - Intergenic
1132870478 16:2113595-2113617 GGAGCTGGGGCAAGAGCGCCGGG - Intronic
1132897510 16:2236058-2236080 GGAGCAGCAGCAGGAGATGCTGG + Exonic
1133042820 16:3069459-3069481 AGAGCTGCGGCAGGAACGCCAGG - Exonic
1133044861 16:3082101-3082123 AGAGCTGCGGCAGGAATGCCAGG - Intronic
1134101136 16:11452408-11452430 GGGGCTGCTGGAGGAAAGGCAGG + Intronic
1134522062 16:14923330-14923352 GGAGCTGGGGCAGGAGCCCCGGG + Intronic
1134606975 16:15579012-15579034 GGAGTTGCTGCAGCTGAGGCTGG + Intronic
1134709731 16:16321981-16322003 GGAGCTGGGGCAGGAGCCCCGGG + Intergenic
1134716944 16:16362011-16362033 GGAGCTGGGGCAGGAGCCCCGGG + Intergenic
1134949872 16:18346664-18346686 GGAGCTGGGGCAGGAGCCCCGGG - Intergenic
1134957807 16:18390148-18390170 GGAGCTGGGGCAGGAGCCCCGGG - Intergenic
1135597757 16:23756325-23756347 GTGGCTGCTGGAAGAGAGCCAGG + Intronic
1135880188 16:26248092-26248114 GGAGCAGCAGCAAGAGAGCTAGG - Intergenic
1136025325 16:27464818-27464840 GATGCTGCTCCAGGAGGGCCTGG + Exonic
1136236142 16:28914671-28914693 GGAGCTGATTCAGGAGATCCAGG - Exonic
1136318087 16:29465811-29465833 TGAGCTGCTGGAGGAGCACCTGG + Intronic
1136371631 16:29840381-29840403 GGAGGTGGTGGAGGAGCGCCAGG + Exonic
1136394490 16:29985720-29985742 GGAGCAGCTCCAGCAGTGCCAGG + Exonic
1136395539 16:29990816-29990838 GAAGCTGCTGCCGAAGGGCCTGG - Intronic
1136432662 16:30205160-30205182 TGAGCTGCTGGAGGAGCACCTGG + Intronic
1136518845 16:30783898-30783920 GGAGCTGGTGCAGGGCCGCCCGG - Exonic
1136645280 16:31608625-31608647 GGAGTTCCTGCAGGGAAGCCTGG - Intergenic
1137578752 16:49621014-49621036 GGGGCTGCTGAAGGAGAGAGAGG - Intronic
1137692659 16:50440424-50440446 GGAGATGATGCTGGAGAGGCAGG + Intergenic
1138415696 16:56870223-56870245 GGACCTGCTCCAGGTGAGGCCGG + Exonic
1138494073 16:57396579-57396601 GGCGCTGCTGCAGGGGGTCCAGG + Intergenic
1138575157 16:57903038-57903060 AGAGCTGCCCCAGGAGATCCAGG + Intronic
1139393688 16:66622741-66622763 GGAGCTGCCCCATGAGAGGCAGG - Intronic
1139505883 16:67397916-67397938 GGGGCTGCAGCAGGAGAGAGAGG - Intronic
1139630306 16:68227705-68227727 GGTGCTGCTGCTGGTGAGACTGG + Exonic
1139662130 16:68428451-68428473 GGAGCAGCAGCAGAAGGGCCTGG + Intronic
1139923401 16:70473166-70473188 GGAGCAGCTGCAGCCGTGCCTGG + Exonic
1139923614 16:70474131-70474153 GCAGCTGGGGCAGGAGACCCTGG + Exonic
1140067852 16:71625993-71626015 GGTGCTGCTGCTGGAAACCCGGG - Intergenic
1141428817 16:83960524-83960546 GGGGCTGCTGGAGGAGGGCGGGG - Intronic
1141430591 16:83968702-83968724 GGAGCCGCCGCAGCAGGGCCGGG + Exonic
1141481206 16:84308137-84308159 GGTGGTGCGGCAGGAAAGCCTGG - Intronic
1141896060 16:86959396-86959418 GGAGCTGCTGACAGAGCGCCTGG + Intergenic
1141946936 16:87317148-87317170 GGCGCTGCTGCCGGGGGGCCGGG - Exonic
1142216824 16:88834130-88834152 GGAGGGCCTGCACGAGAGCCAGG + Intronic
1142296972 16:89230501-89230523 GCAGCTGCCCCAGGAGTGCCGGG - Exonic
1142346047 16:89554527-89554549 GAAGGTGCTGCAGGACAACCTGG + Exonic
1142597455 17:1036455-1036477 GAAGGTGCTGGAGGAGAGCAGGG + Intronic
1142597469 17:1036500-1036522 GAAGGTGCTGGAGGAGAGCAGGG + Intronic
1142626726 17:1197058-1197080 GGAGGCACTGCAGGGGAGCCGGG - Intronic
1142695155 17:1629213-1629235 GGGGCGGCCGCGGGAGAGCCCGG - Intergenic
1142760052 17:2036783-2036805 GCGGCTGGGGCAGGAGAGCCAGG - Intronic
1142849011 17:2695400-2695422 GGAGCTGGTGCTGCGGAGCCCGG - Exonic
1142967466 17:3590479-3590501 GCAGCTGCTGCAGGAGGAACTGG + Intronic
1143166425 17:4899366-4899388 GCAGCAGCTCCAGGAGAACCTGG + Exonic
1143369259 17:6428308-6428330 CGAGCTGCTGCAGGTGGGGCTGG - Exonic
1143371850 17:6445170-6445192 GGAGCAGCTGGAGGACAGCAAGG + Exonic
1143456185 17:7069572-7069594 GCAGATGCTGCAGGAGGGCCTGG + Intergenic
1143505498 17:7362471-7362493 GGAGCTGCTGATGGAAAGCCTGG + Intergenic
1143600125 17:7939707-7939729 GGCGCTGCAGGAGGAGAGCCAGG + Exonic
1143768938 17:9155634-9155656 AAAGCTGCTCCAGGAGCGCCAGG - Intronic
1143857069 17:9859889-9859911 GGATCAGATGCAGGGGAGCCTGG + Intronic
1144072863 17:11690034-11690056 GGAGCTGCAGCAGGTGCGCTAGG - Exonic
1144739371 17:17572665-17572687 GAAGCTGCTGCGTGAGGGCCAGG + Intronic
1144865535 17:18333059-18333081 GCAGCTGCAGCAGCAGAGCCTGG + Intronic
1145064990 17:19756015-19756037 GGTGCTCCAGCAGGAGGGCCAGG - Intergenic
1145197678 17:20908813-20908835 CGAGCAGCAGCAGGAGGGCCTGG - Intergenic
1145202276 17:20957003-20957025 GGAGGCGCTGATGGAGAGCCTGG + Intergenic
1145796353 17:27657580-27657602 GGAGCTGATGGAGTAGAACCTGG + Intergenic
1145804853 17:27719323-27719345 GGCGCTGCTGCAGGGGGTCCAGG - Intergenic
1145810788 17:27762862-27762884 GGAGCTGATGGAGTAGAACCTGG + Exonic
1146311267 17:31770196-31770218 GGTGCTGCTGCAGGGGGTCCAGG - Intergenic
1146461227 17:33047380-33047402 GGTGCTGCTGCACTACAGCCTGG - Intronic
1147170811 17:38617675-38617697 GGAGTGGCAGCAGGAGAGGCTGG + Intergenic
1147563135 17:41521131-41521153 GGGGCTGCTGGAGGAGAGTCAGG - Exonic
1147577231 17:41609843-41609865 GGAACTGCGCCAGGAGAGCAGGG + Exonic
1147791451 17:43016441-43016463 GCAGCTGCTGCAGGCCAACCGGG - Exonic
1148204902 17:45774134-45774156 GGAGCTGATGCATGAGAGTGGGG + Intergenic
1148438448 17:47699468-47699490 GAAGCAGCTGCAGGAGACCCGGG + Exonic
1148601235 17:48895658-48895680 AGAGCTGCTGCTTGAGAGACGGG - Exonic
1148650448 17:49246572-49246594 GGAGCTGAGGCAGGAGAGGATGG - Intergenic
1148892962 17:50820921-50820943 GGGGCAGTTGGAGGAGAGCCTGG + Intergenic
1148922112 17:51046789-51046811 GGAGCTGCTGCAGGATGGAGTGG - Intronic
1150069742 17:62140462-62140484 GGAGCTGCTGGAGGTGCTCCAGG - Intergenic
1150291885 17:63987136-63987158 GGGGCTGCTGGAGGAGAGAGGGG - Intergenic
1150735623 17:67734771-67734793 AGAGCTGCTGCAGTCCAGCCTGG + Intronic
1151352036 17:73537504-73537526 AGAGCTGCTGATGGAGAGGCAGG + Intronic
1151404389 17:73877299-73877321 GGAGCTGCTGGTGGAGAGGGAGG + Intergenic
1151439773 17:74120635-74120657 GGAGCCCCAGCAGGAGAGCAGGG + Intergenic
1151531782 17:74711170-74711192 GGAAGTTCTGCAGGAGAGGCTGG + Intronic
1151661668 17:75522227-75522249 GGAGCTGCTGCAGCGGCGGCAGG + Exonic
1151814463 17:76464614-76464636 GGAGCTGCTGCTGGAGGGAGAGG + Intronic
1152023423 17:77793766-77793788 GGGGCTCCTGCAAAAGAGCCTGG + Intergenic
1152039363 17:77892992-77893014 GGAGCGGCTGCGGGAGAGCCTGG - Intergenic
1152120423 17:78415000-78415022 GAAGCTGCTGCTGCAGGGCCTGG - Exonic
1152191224 17:78889110-78889132 TGAGCAGCTGCAGTAGAGCTGGG + Intronic
1152344511 17:79742995-79743017 GGAGCTGAAGCAGGAGACCCGGG - Intergenic
1152449299 17:80366191-80366213 GGAACTGCTGCAGGATGGCACGG + Intronic
1152550086 17:81025171-81025193 GGAGGTGCTGGAGGAGAGGCTGG - Intergenic
1153650129 18:7231981-7232003 GGAGCTGGTGGAGGGGGGCCTGG + Exonic
1153710484 18:7794008-7794030 GGGGCAGTTGGAGGAGAGCCTGG + Intronic
1153953351 18:10075732-10075754 GGAGAGGCGGCAGGAGAGCCTGG - Intergenic
1154392412 18:13950875-13950897 GAAGCTGAGGCAGGAGAACCCGG - Intergenic
1156268573 18:35510505-35510527 GGAGCTGCTGCAGAATAAGCAGG - Intergenic
1156688197 18:39675247-39675269 GGAGCCGCAGCAGGAGATACAGG + Intergenic
1157942293 18:51942525-51942547 TGAGCTTCTGAAGGAGGGCCTGG + Intergenic
1158579204 18:58666946-58666968 GCAGTTGCTCCAGGAGAGCTGGG - Intergenic
1158648902 18:59269400-59269422 GGAGCGGCTGAAGGAGAGGAGGG + Exonic
1160006278 18:75071452-75071474 GGAAATGCTGCACGGGAGCCTGG + Intergenic
1160505638 18:79425397-79425419 GGAGCAGCTTCAGGAGGGCGAGG - Intronic
1160560366 18:79752156-79752178 GGAGCCGCTGCAGGTGCACCTGG - Intronic
1160726840 19:621114-621136 GGAGCCGCTGCGGAAGCGCCTGG - Exonic
1160789548 19:917251-917273 CGAGCGGCTGCCGGAGAGGCGGG + Intergenic
1160909255 19:1467321-1467343 GGAACTGCTGCGGGAGTGCCTGG + Exonic
1160914401 19:1489932-1489954 GGGGCTTCAGCAGGGGAGCCGGG - Intronic
1160967647 19:1753665-1753687 GGAGCTGAGCCTGGAGAGCCTGG + Exonic
1161208397 19:3054031-3054053 GGAGCTGCTGCTGCAGGGCGGGG + Exonic
1161314890 19:3613190-3613212 GGACCTGATCCAGCAGAGCCTGG - Exonic
1161316285 19:3619079-3619101 GGACCTGCTGGAGGATATCCAGG - Exonic
1161428577 19:4217683-4217705 GGCGCGGCTGGAGCAGAGCCGGG + Exonic
1161431173 19:4233260-4233282 GAAGCTGCTGCTGGAGCCCCAGG - Exonic
1161579977 19:5075354-5075376 GCAGCTGCTGCCGGGAAGCCGGG + Intronic
1162236751 19:9315627-9315649 GGCGCTGCTGCAGGGGTTCCAGG + Intergenic
1162469298 19:10862856-10862878 GGAGCAATTGGAGGAGAGCCTGG + Intronic
1162534036 19:11252820-11252842 GGAGCTGCTGCTGCAGCCCCGGG - Exonic
1162808166 19:13149824-13149846 CGAGCTCCTGCAGGAAAGCGCGG - Exonic
1162966841 19:14160174-14160196 GGAGCAGCTGCTGGACATCCTGG - Exonic
1163325410 19:16600168-16600190 GGACCTGTGGCAGGAGGGCCCGG - Intronic
1163471563 19:17500358-17500380 GGAGCTGCTGCGGGATGCCCAGG + Exonic
1163721661 19:18900798-18900820 GGAGCTGGTGCAGGGGTGGCAGG - Intronic
1163830339 19:19544504-19544526 GGAGCAGCTGCAGGTGGGGCCGG + Exonic
1165230524 19:34383701-34383723 GGAGCTGGGGCAGGTGAGGCAGG + Intronic
1165326856 19:35118967-35118989 GGAGCAGCTGCTGGGGAGCCAGG + Intronic
1165605722 19:37102090-37102112 GGAGGTGCTGGAGCTGAGCCTGG + Intronic
1165716276 19:38047820-38047842 AGAGCAGCTGCAGGAGTGCCAGG + Intronic
1165794000 19:38508015-38508037 GGAGTAGTTGCAGGAGAGCAGGG - Intronic
1165830234 19:38727058-38727080 GGAGCAGATGCAGGAGTTCCGGG + Exonic
1165992797 19:39825900-39825922 GGAGCTGATGGATGTGAGCCTGG - Exonic
1166100033 19:40566224-40566246 GGAGCCGCTCCTGCAGAGCCGGG + Exonic
1166253716 19:41587698-41587720 GGAGGAGCTGCAGGTGAGGCAGG - Intronic
1166410306 19:42552297-42552319 GGAGGAGCTGCAGGTGAGGCAGG + Intronic
1166685428 19:44793608-44793630 GGAGCTGGGGCAGGTGAGCAGGG + Exonic
1167261665 19:48462426-48462448 CCAGCTGCTGCAGGTGCGCCCGG + Exonic
1167377033 19:49117887-49117909 GGAGCTGCTGAAGGCGGCCCAGG + Exonic
1167379104 19:49128405-49128427 GGAGCAGCTGCTGGAGAGGGAGG + Exonic
1168152017 19:54454465-54454487 GCAGCTGCTGAGGGGGAGCCTGG - Exonic
924968578 2:101297-101319 GTATCTGCTGCCGTAGAGCCTGG - Intergenic
925039418 2:719681-719703 GGAGCTGCTCCAGGTGAGAGAGG - Intergenic
925607095 2:5670631-5670653 GGAACTGATGCAGGAAAACCAGG + Intergenic
925960814 2:9013565-9013587 GCTGCTGCTGCAAGGGAGCCTGG + Intergenic
926716978 2:15932468-15932490 GGAGCCCCTGCAGGAGGGCTGGG + Intergenic
927045711 2:19276118-19276140 GGAGCTGCAGCAGAGGAGCTAGG - Intergenic
927146705 2:20170970-20170992 GGAGCTGCTGTAGGGAAGTCTGG - Intergenic
927711091 2:25326776-25326798 CCAGCTCCTGCAGGAGTGCCAGG + Intronic
929313320 2:40450746-40450768 AGAGCGGCTTCAGGAGAGCCAGG + Intronic
929969897 2:46565038-46565060 GGAGCAGCTGCAGGAGAAGGTGG + Intronic
930067305 2:47337471-47337493 GAAGCTGAAGCAGGTGAGCCTGG + Intergenic
930872787 2:56184750-56184772 GGAGCTGCTGCAGTGGAGCAAGG + Exonic
931768040 2:65474248-65474270 GGACCTGCCACAGGAGAGGCAGG - Intergenic
932073608 2:68643966-68643988 TGAGTTTCTTCAGGAGAGCCAGG + Intronic
932817698 2:74874895-74874917 GCAGCTGCAGCAGGAGGCCCTGG - Intronic
933552396 2:83792385-83792407 GGAGCTTCTGGAGGAACGCCTGG + Intergenic
934087318 2:88520682-88520704 TGCTCTGCTGCAGCAGAGCCAGG - Intergenic
934585145 2:95485778-95485800 GGAGCTGCTCCAGGTGAGGAGGG + Intergenic
934587581 2:95516730-95516752 GGAGCTGCTCCAGGTGAGGAGGG + Intergenic
934594317 2:95590955-95590977 GGAGCTGCTCCAGGTGAGGAGGG - Intergenic
934771978 2:96912972-96912994 GGAGCTGCGGCAGGAGCTCGAGG + Intronic
934788459 2:97034679-97034701 GGAGCTGCTCCAGGTGAGGAGGG + Intergenic
935249936 2:101252638-101252660 GGTCCCGCGGCAGGAGAGCCCGG - Intronic
935417859 2:102837657-102837679 GGAGCTGCTGCAGGATCACTTGG + Intronic
935684476 2:105671366-105671388 GGAGCTGATGAAGCACAGCCTGG - Intergenic
935757092 2:106284730-106284752 GGAGGTGCTAACGGAGAGCCTGG + Intergenic
935794885 2:106631497-106631519 GAAGCCCCTGCAGGAAAGCCTGG - Intergenic
935854044 2:107255959-107255981 GAAGCTGGTGCAGGTGGGCCGGG + Intergenic
936078121 2:109414769-109414791 GGAAATGCTGCTGGAGAGACAGG - Intronic
936112465 2:109676257-109676279 GGAGGTGCTAACGGAGAGCCCGG - Intergenic
936125501 2:109786223-109786245 GGCGCTGCTGCACAACAGCCTGG - Intergenic
936198776 2:110390916-110390938 GCAACTGCTGCAGGGGAGGCTGG + Intergenic
936219192 2:110585245-110585267 GGCGCTGCTGCACAACAGCCTGG + Intergenic
936462175 2:112722020-112722042 CGAGCTGCTGCTGGAGCGCCTGG + Exonic
936572142 2:113626206-113626228 CGAGTTGCTCCAGGTGAGCCTGG - Intergenic
937062251 2:118989425-118989447 GGAGCTGCCGCTGCAGACCCAGG - Intronic
937217902 2:120324222-120324244 GGACCTGCTGGAGGGAAGCCTGG + Intergenic
937259902 2:120578597-120578619 TGAGATGCTGCTGCAGAGCCAGG - Intergenic
937856504 2:126675465-126675487 GTAGGAGCTGCAGGAGAGGCTGG - Intronic
938026481 2:127953484-127953506 GGAGCTGTTGGAGCAGAGCAGGG - Intronic
938150009 2:128874532-128874554 GGAGCTGGTGCGGGAGAGCTGGG - Intergenic
938180731 2:129179510-129179532 GGAGCTGTTGCAGCCCAGCCAGG - Intergenic
938224817 2:129606597-129606619 GGAACCGCTGCAGGGTAGCCTGG - Intergenic
938297646 2:130188361-130188383 GGAGCTGCTGCAGGGTGGCGGGG + Intronic
939649710 2:144745674-144745696 GGGGCAGTTGGAGGAGAGCCGGG + Intergenic
940000865 2:148965119-148965141 GGGGATGCTGGAGGAGAACCAGG + Intronic
940478095 2:154192090-154192112 GGGGCGGTTGGAGGAGAGCCTGG - Intronic
941548870 2:166889405-166889427 AGGGCTGCTGCAGTGGAGCCAGG + Intronic
941786443 2:169504853-169504875 GGCACTGCTGTAGGAGCGCCCGG - Exonic
942186105 2:173426522-173426544 GGAGCTGGGGCAGGACAGACAGG - Intergenic
943750792 2:191507496-191507518 GGGGGTGCTGCAGGAGACCAGGG - Intergenic
944097840 2:195989782-195989804 GGAGCAGGAGCAGGAGAGACTGG - Intronic
944216630 2:197263075-197263097 GGGGCTGTGGCAGGAGAGCTGGG - Intronic
944876134 2:203965392-203965414 GGAGCTTCTGGAGGAACGCCTGG + Intergenic
946415915 2:219539595-219539617 AGAGGAGCTGCTGGAGAGCCTGG - Exonic
946767385 2:223053136-223053158 GAACATGCTGCAGGAGAGCGTGG + Exonic
947115846 2:226769388-226769410 GAAGCTGCTGCAAGACTGCCCGG + Intronic
947119082 2:226798396-226798418 TGTGCAGCTGTAGGAGAGCCTGG + Exonic
947848186 2:233262547-233262569 GGAGCAGCAGCAGCAGAGCCTGG - Intronic
947946660 2:234109458-234109480 GGAGCAGCTGGAGGAGGTCCCGG - Intergenic
948217076 2:236239832-236239854 GGATCTGCTGCAGGGCAGTCAGG + Intronic
948250337 2:236523087-236523109 GGAGCAGCAAAAGGAGAGCCAGG + Intergenic
948261159 2:236605417-236605439 GGATCCGCTGCTGGAGACCCAGG - Intergenic
948364786 2:237447850-237447872 GGAGTGGCTGCCGGAGAGCATGG - Intergenic
948438501 2:237969751-237969773 GGGGCTGAAGCAGGAGAGCTTGG + Intronic
948569245 2:238907110-238907132 GGGGCTGCTGCAGGCTGGCCTGG + Intronic
948614485 2:239189943-239189965 GCAGCTGCAGCAGGAGCTCCTGG - Exonic
949069340 2:242013979-242014001 GGGGCAGCTGCAGGGCAGCCAGG - Intergenic
1168757363 20:326437-326459 GGAGCTGCTGGAAGTGCGCCTGG + Exonic
1168768140 20:396201-396223 GAAGCTGGTGCTGGAGAACCTGG + Exonic
1168966149 20:1899306-1899328 TGAGATGCTGCAGGATAACCAGG + Intronic
1168990255 20:2088937-2088959 GGAGGGGCTGCAGGAGAGAGGGG + Intergenic
1169020371 20:2326458-2326480 GGAAAGGCTCCAGGAGAGCCTGG - Intronic
1169091787 20:2865357-2865379 GGAGGTGTTGCAGGAGAGGCAGG - Intronic
1169146455 20:3255675-3255697 TGAGCATCTGCAGAAGAGCCAGG + Intronic
1170459251 20:16561248-16561270 GGAGCTGCTGCACTCCAGCCTGG + Intronic
1170700496 20:18699098-18699120 GGAGTTGCAGCAGGAGAGGAAGG + Intronic
1171365147 20:24618008-24618030 GGAGATGCTGAGAGAGAGCCCGG + Intronic
1171456469 20:25275408-25275430 GGAGAGGCTGCAGGAGAACGTGG + Intronic
1171467854 20:25343699-25343721 GAAGCTGAAGCAGGAGAACCTGG + Intronic
1172273486 20:33667458-33667480 GGAGCTGCTGTTCGAGACCCTGG + Exonic
1172449330 20:35010634-35010656 GGGACTGCTGCAGCAGGGCCAGG - Intronic
1172629526 20:36368551-36368573 GGAGCTGGGTCGGGAGAGCCAGG - Intronic
1173576655 20:44116345-44116367 CCGGCTGCTGCAGGAGATCCTGG - Exonic
1173798198 20:45877428-45877450 AGATCTCCTGCAGGATAGCCCGG - Exonic
1174157786 20:48528032-48528054 GGAGGAGCCGCAGGAGAGCAGGG - Intergenic
1174230375 20:49041169-49041191 GGAGCAGCTGGAGGAGGGCCAGG + Intergenic
1174658595 20:52191835-52191857 GGAGCCGCTGCTGCAAAGCCAGG - Exonic
1175514786 20:59562149-59562171 GTAGCTGCTGCTGGAGATGCTGG - Intergenic
1175800427 20:61798197-61798219 GGAGGTGCTGCCACAGAGCCCGG - Intronic
1175922901 20:62458422-62458444 GGAGTTGCCACAGCAGAGCCTGG + Intergenic
1175944093 20:62550787-62550809 TGCGCTGCTGCAGGAGGGCTGGG + Exonic
1175970619 20:62684993-62685015 TGAGGTGCTGCAGGAGCCCCTGG - Intronic
1176107436 20:63395963-63395985 GGAGGGGCTGCAGGAGGTCCTGG + Intergenic
1177157437 21:17513282-17513304 GGCGCTGCTGCAGGGGCGGCGGG + Intronic
1179538927 21:42071568-42071590 GGAGGTGGGGCAGGAGTGCCGGG + Intronic
1179603795 21:42499097-42499119 GGTGCTGCTGCAGGAGATGCCGG - Intronic
1179630764 21:42677076-42677098 TGAGCTCCTGCAGGAGAGAAGGG - Intronic
1179820995 21:43936776-43936798 GGAGCTGACACGGGAGAGCCAGG - Intronic
1179910094 21:44442936-44442958 GGAGCCTCTGCAGGGGTGCCAGG - Exonic
1180057335 21:45365639-45365661 GGAGCTTCTCCAGGAGAGGCTGG + Intergenic
1180218932 21:46345735-46345757 GGAGCTGAGGGAGGAGAGCGGGG - Intronic
1180224772 21:46385888-46385910 GGAGGTGCTGCAGCAGAGGCGGG + Exonic
1180852803 22:19029876-19029898 GCGGCGGCTGCAGGAGGGCCTGG + Intergenic
1180984958 22:19898715-19898737 AGAGGAGCTGCAGGAGGGCCTGG - Intronic
1181021851 22:20107689-20107711 GGAGATGCTGAAGGTGCGCCCGG + Intronic
1181052104 22:20242802-20242824 CCAGCTGCTCCAGGAGGGCCAGG + Exonic
1181104628 22:20566625-20566647 GCAGCTGCTGGGGCAGAGCCTGG - Exonic
1181451682 22:23026846-23026868 GGAGCAGTCGGAGGAGAGCCGGG - Intergenic
1181644990 22:24226233-24226255 GGACCTGCTGGGGGAGACCCTGG - Exonic
1182232134 22:28846383-28846405 GGATCTGCCTCAGGAAAGCCAGG + Intergenic
1182242373 22:28926242-28926264 GGAGGTGCTGCTGCAGAGCATGG + Intronic
1182509045 22:30806067-30806089 TGAGTTACTGCAGGAAAGCCTGG - Intronic
1182511383 22:30822662-30822684 GGAGCTGCAGAAGGAGCGCACGG - Intronic
1182619521 22:31611240-31611262 GCAGCTGCTGCTGGAGGGGCTGG + Exonic
1183053050 22:35280536-35280558 GAGGCTGCTGCAGGAGTGCGGGG - Intronic
1183072136 22:35403473-35403495 GGAGGTGCTCCAGGACATCCAGG + Exonic
1183371665 22:37435997-37436019 GTCCCTGCTGCAGGAGAACCAGG + Intergenic
1183543128 22:38441310-38441332 GGAGGTGCTGGGGAAGAGCCAGG + Intronic
1183604927 22:38862746-38862768 GGAGGTCCTGGAGGAGAGCCAGG - Exonic
1183931480 22:41238279-41238301 GGAGCTGCTGCTGGACGGCGGGG - Exonic
1183945759 22:41324909-41324931 GCTGCTGCAGCAGGAGTGCCAGG - Intronic
1185068294 22:48642870-48642892 GGAACAGCTGTGGGAGAGCCAGG + Intronic
1185278435 22:49959929-49959951 ACAGCAGCTGCTGGAGAGCCCGG + Intergenic
1185329752 22:50246920-50246942 GTGGCTGCTGCAGCAGAGGCTGG + Exonic
1185428050 22:50784674-50784696 CGAGTTGCTCCAGGTGAGCCTGG + Intergenic
1203273703 22_KI270734v1_random:73951-73973 GGAGCTGCTGCAGCAGCTGCAGG - Intergenic
949878299 3:8641480-8641502 GAAACTGATTCAGGAGAGCCTGG + Intronic
950269261 3:11600689-11600711 GGAGCTGAGGCAGTAGAGGCGGG + Intronic
950426744 3:12928438-12928460 GAAGCTGCAGCTGGACAGCCAGG + Intronic
950455231 3:13088778-13088800 GGCCCTGGGGCAGGAGAGCCTGG - Intergenic
950574615 3:13824592-13824614 GGCCCTGCTGCAGAGGAGCCAGG - Intronic
951794781 3:26526096-26526118 GTAGCTGCTACTGGAGAGCAAGG - Intergenic
953422531 3:42765667-42765689 AGAGAAGCTGCAGGAGAGACAGG + Intronic
953568576 3:44053762-44053784 AGAGCTTCTCCAGGAGTGCCAGG + Intergenic
953603515 3:44390961-44390983 AGAGCTGCTGCAGGAGTGGGTGG - Intronic
953876326 3:46668780-46668802 CCAGCTGCTGCAGGAGCCCCTGG - Intergenic
954211799 3:49101858-49101880 GGAGCTGCTCCATCAGAGACAGG + Exonic
955101840 3:55857937-55857959 GGAGCAGGTGAAGGAGAGGCTGG - Intronic
955318062 3:57955148-57955170 GGTGCTGCTGCAGTCCAGCCTGG + Intergenic
955640747 3:61081278-61081300 GGAGGGGCAGCAGGAGAGGCAGG - Intronic
956420184 3:69079882-69079904 GGAGCTGGGGCAGTACAGCCTGG + Intronic
956552633 3:70478919-70478941 GGGGGTGCTGCAGGAGACCAGGG - Intergenic
956604048 3:71053656-71053678 GCTGCTGCTGGAGGAGAACCTGG + Exonic
956777526 3:72577820-72577842 GGAGCTGGGGCTGGAGAGCTGGG - Intergenic
958892233 3:99795057-99795079 GGGGGTCCTCCAGGAGAGCCAGG + Exonic
958894806 3:99817801-99817823 GGAGCGGCTGCCGGAGAGGCGGG + Intergenic
959007836 3:101040505-101040527 GGAGCTGGTGCAGGGGAGCAGGG - Intergenic
959689888 3:109187488-109187510 AGAGCTTCAGCAGGAGAGCCTGG - Intergenic
959917591 3:111835438-111835460 GGAGCTGCTGCTGGGGAAGCAGG - Intronic
960765807 3:121128546-121128568 GGAGTTGATGCAAGAGAGCCAGG + Intronic
961509394 3:127391770-127391792 ACAGCTCCTGCAGCAGAGCCTGG - Intergenic
961820035 3:129571300-129571322 AGAGCTGGTGCAGGAGAGCCAGG + Exonic
962235905 3:133706835-133706857 GGAGCTGCTGCAGGTGAGCAGGG - Intergenic
963107275 3:141658097-141658119 AGAGCTGCTGCAGAAGCTCCAGG - Intergenic
963788952 3:149563793-149563815 GGAGCTGCTGCACTGCAGCCTGG - Intronic
967603103 3:191413027-191413049 GGGGCTGGGGCAGAAGAGCCTGG - Intergenic
968075299 3:195812849-195812871 GGAGCTGCTCCTGGAGACCTGGG + Intergenic
968441299 4:625806-625828 GGAGCTGGTGCAGGATATGCAGG + Exonic
968448333 4:663579-663601 GGAGCCGCTGGTGGAGAGCTGGG + Intronic
968495285 4:911976-911998 GGAGGAGCTGCAGGAGAGGGCGG + Intronic
969203322 4:5622853-5622875 GGAGGAGCTGCAGGAGCGTCTGG - Exonic
969211351 4:5689924-5689946 GAAGCTGGTGCAGGAGGGCTGGG - Intronic
969271379 4:6105628-6105650 GCGGCTGCAGCAGGAGATCCTGG - Exonic
969467561 4:7366621-7366643 GGAGCAGCTGCATGGGAGGCTGG - Intronic
969512604 4:7628008-7628030 GCAGCTGCTGCAGGCAGGCCCGG - Intronic
970234428 4:13944424-13944446 GGGGCAGTTGGAGGAGAGCCCGG + Intergenic
971144674 4:23963765-23963787 GGATCTACTGCAGGACAACCAGG - Intergenic
971400158 4:26268744-26268766 GGGGCAGCTGCAGCAGAGGCGGG + Intronic
973735793 4:53870469-53870491 GGATCTGCTGCAGAAGACACTGG + Intronic
974669719 4:65014214-65014236 GGGGCAGCTGGAGGAAAGCCTGG - Intergenic
975983497 4:80183919-80183941 CCAGCTGCTGCAGCAGAGACCGG + Intronic
976616065 4:87078515-87078537 GGAGCATCTGCAAGAGAACCTGG + Intronic
977756934 4:100682729-100682751 GGGGCAGCTGGAGGAGAGCCAGG + Intronic
978369820 4:108018773-108018795 GGTGGCGCTGCAGGAAAGCCTGG + Intronic
979727787 4:123985072-123985094 GCAGCTGCTGCAGGGAAGCAGGG + Intergenic
979993830 4:127407665-127407687 GGGGGTGCTGCAGGAGACCAGGG - Intergenic
980289302 4:130824975-130824997 GGAGCAGGAGGAGGAGAGCCAGG - Intergenic
981128282 4:141132103-141132125 GGAGAGGCTGCCGGAGAGCTTGG - Intronic
981264215 4:142762176-142762198 GGAGTTGCAGAATGAGAGCCAGG - Intronic
982134311 4:152258902-152258924 GAAGCTGCAGCAGGAGAGGGTGG - Intergenic
982315099 4:154023933-154023955 GGGGCAGTTGGAGGAGAGCCCGG + Intergenic
985472418 5:54065-54087 GGCGCTGCGGGAGGAGAGCGCGG + Intergenic
986463672 5:7998729-7998751 GGAGATGATGGAGGAGAGGCAGG + Intergenic
988181244 5:27796935-27796957 GGGGCTGAGGCTGGAGAGCCTGG - Intergenic
989204516 5:38797783-38797805 GGGGCAGTTGGAGGAGAGCCCGG - Intergenic
989597979 5:43174761-43174783 AGATCTGCTCCAGGACAGCCAGG + Exonic
991010198 5:61874305-61874327 GGAGCTGCAACACCAGAGCCAGG + Intergenic
992093640 5:73340558-73340580 GGGGCGGTTGGAGGAGAGCCTGG + Intergenic
992151578 5:73909699-73909721 GGAGCTGCTGCTGCGGAGCCGGG + Exonic
993287290 5:86015974-86015996 GGTGATGCTGCCTGAGAGCCAGG + Intergenic
995066698 5:107870627-107870649 GGAGCTGCTGCACTCCAGCCTGG - Intronic
995533821 5:113116087-113116109 GGAGCTGCCGCAGGTGACCCAGG - Intronic
995617042 5:113976455-113976477 GGAGCTGTTAGAGCAGAGCCAGG + Intergenic
997452189 5:133992673-133992695 GAAGCTGCTGCAGTGGAGCGCGG - Intronic
998349030 5:141489011-141489033 GGAGCTGGAGGAGGAGAGGCGGG - Intronic
998470838 5:142382588-142382610 GTTGCTCCTCCAGGAGAGCCAGG - Intergenic
998713118 5:144849153-144849175 GGCGCTGCTGCAGGGGGTCCAGG + Intergenic
998887318 5:146707530-146707552 GGAGCAGCTGCAGAAGGCCCGGG + Intronic
999327390 5:150651559-150651581 TGAGCTGCTGCAGGAGGCCAAGG + Exonic
999500168 5:152138970-152138992 GGGGCAGCTGCATGTGAGCCAGG + Intergenic
1000926615 5:167202257-167202279 GGAGATGCAGCAGGAGATGCTGG - Intergenic
1001004176 5:168035451-168035473 AGAGCTGCTGCAATACAGCCTGG + Intronic
1001094852 5:168768138-168768160 GGCCATGCTGCAGGAGAGCACGG + Intronic
1002104655 5:176874174-176874196 GGAGCTGGGGCAGGAGTGCTGGG - Intronic
1002175366 5:177398392-177398414 GGAGCTACAGAAGGAGAGACTGG - Exonic
1002294741 5:178224080-178224102 GGAGCTGATCCTGGAGAGGCAGG - Intronic
1002349703 5:178575503-178575525 GGAGCTCCTGCAGAAGATCATGG + Intronic
1002468009 5:179417426-179417448 TGAGCAGGTGCAGGAGAGGCTGG - Intergenic
1002571655 5:180143086-180143108 TGAACTGCTGCAGGAGCCCCAGG - Intronic
1002720712 5:181260000-181260022 GGAGGTGGTGCAGGAGTACCAGG - Exonic
1003195651 6:3911859-3911881 AGAGCAGCGGCAGGAGAGCTAGG + Intergenic
1003363425 6:5450443-5450465 GGAGCTGGAGCAGGAGACCAAGG - Intronic
1003464948 6:6370083-6370105 GCAGCTGCTACAGGAGGGCTGGG + Intergenic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1004267230 6:14159265-14159287 GGGGGTGCTGCAGGAGACCAGGG + Intergenic
1004333919 6:14746745-14746767 GGAGCAGCTCCAGGAAAGCCCGG + Intergenic
1004532075 6:16462963-16462985 GGTGCTGCTGCAGGGGGTCCAGG - Intronic
1005963880 6:30712822-30712844 GGCCCATCTGCAGGAGAGCCAGG - Exonic
1006113609 6:31763468-31763490 GGAGCTGCTACAGCATGGCCAGG + Exonic
1006447411 6:34087565-34087587 GGTGATGCTGCAGAGGAGCCCGG + Intronic
1006743614 6:36326165-36326187 GGAGCTGGAGCAGGGGAGGCAGG - Intronic
1007263797 6:40582416-40582438 GGATTGTCTGCAGGAGAGCCGGG - Intronic
1007356264 6:41319873-41319895 GGAACCTCTGCAGGAGACCCAGG - Intergenic
1008507623 6:52246395-52246417 GCAGCTGGGGCAGCAGAGCCAGG + Intergenic
1009385223 6:63079090-63079112 GGTGCTGCTGCAGGAGGTCTGGG + Intergenic
1009596747 6:65745892-65745914 GGAGCTTCTGCAGCAGAGCATGG + Intergenic
1010083141 6:71886861-71886883 GCAGCAGCAGCAGCAGAGCCGGG - Intronic
1010255004 6:73747717-73747739 GGAAATGCTGCAGAGGAGCCAGG - Intronic
1010428258 6:75749493-75749515 GGAGCTGCTCGAGGAGGCCCGGG - Intronic
1010518779 6:76807377-76807399 GGAGCTGCTGCACTCCAGCCTGG + Intergenic
1011473524 6:87731086-87731108 GCAGCTTCTGATGGAGAGCCTGG - Intergenic
1012330472 6:97979166-97979188 GGGGCTGTTGGAGGAGAGCCGGG + Intergenic
1012865821 6:104616700-104616722 AGAGCTGCTGCTGGAGAGATTGG - Intergenic
1013531248 6:111020756-111020778 GAGGCTGATGCAGGAGAACCCGG + Intronic
1013806492 6:114001911-114001933 GGAGCATCTGCAGGTCAGCCAGG - Intronic
1014367566 6:120563301-120563323 GGAGATCCTGCAGGGAAGCCGGG + Intergenic
1014554663 6:122831149-122831171 GGAGATGCTGCAGGAGAGGCTGG + Intergenic
1016568788 6:145489978-145490000 AGATCTGCTCCAGGACAGCCAGG - Intergenic
1016630342 6:146222444-146222466 AGATCTGCTGCTGGAGACCCAGG + Intronic
1017421243 6:154275120-154275142 GGAGCTGGCGTAGGAGAGGCAGG - Intronic
1018388925 6:163328544-163328566 GGAGCTGGTGCAGCAAGGCCAGG + Intergenic
1018650714 6:165989130-165989152 AGAGCTGCTGCAGGAGCAGCCGG + Intergenic
1018676091 6:166223380-166223402 GGAGAGCGTGCAGGAGAGCCAGG - Intergenic
1018726427 6:166616410-166616432 AGAGCTGCTGCTGGTGAGCAGGG - Intronic
1018750126 6:166797141-166797163 AGAGATGCGGCAGCAGAGCCTGG - Intronic
1018817689 6:167347382-167347404 GGAACTGCTGCGGGAGGGGCCGG + Intronic
1019319696 7:410027-410049 GGAGCTCCTGCAGGAAACCGTGG - Intergenic
1019333612 7:472273-472295 GGAGCTGTTGCAAGTGAGCTGGG - Intergenic
1019434065 7:1012745-1012767 GGTGCTGCGCCCGGAGAGCCAGG + Intronic
1019537384 7:1536358-1536380 GGGGCTGCTGGAGGGGAGCTTGG + Intronic
1019670995 7:2278255-2278277 GGACCTGCTGCACGATGGCCTGG + Exonic
1019716488 7:2541726-2541748 GCAGCTCCTCCAGGTGAGCCAGG + Exonic
1019800499 7:3084760-3084782 GGGGTGGCTGCAGGAGAGTCCGG + Intergenic
1019936168 7:4259562-4259584 GGAACTGCTCCAGTAGGGCCGGG + Intronic
1020012940 7:4816315-4816337 GCAGCTGCCGCAGGAGGTCCAGG + Exonic
1020096266 7:5371149-5371171 AGAGCCGCTGCGGGAGGGCCCGG - Exonic
1020378206 7:7511754-7511776 AGGACTGCTGTAGGAGAGCCGGG + Intronic
1020452655 7:8337513-8337535 TGAACTGCTGCAGGAGAGACTGG - Intergenic
1020457207 7:8387583-8387605 GGAGCTGCTGCAGAGAAGCAGGG - Intergenic
1021097093 7:16547243-16547265 GGAGCTGCTGCAATGGGGCCAGG + Intronic
1021109668 7:16679140-16679162 GGGGGTGCTGCAGGAGACCAGGG + Intronic
1021275669 7:18647934-18647956 ATAAATGCTGCAGGAGAGCCTGG - Exonic
1022121695 7:27314617-27314639 GGAGCTGCAGGAGGGGACCCAGG + Intergenic
1022793752 7:33715076-33715098 GGAGCTGCTGGAGGAGAAGCAGG - Intergenic
1023834042 7:44058185-44058207 GCAGCTGGAGCAGGAGCGCCGGG + Exonic
1023993196 7:45142675-45142697 AGAGCAGCAGCAGGGGAGCCTGG + Intergenic
1024497021 7:50060255-50060277 GGACCTGCTGCAGTGGAGCATGG + Intronic
1024982994 7:55173103-55173125 GAGGCTGCTGCAGGAGAGGGAGG + Exonic
1025790828 7:64685472-64685494 AGTGCTGCTGCAGGAGGTCCAGG - Intronic
1025798122 7:64758784-64758806 GGCGCTGCTGCAGGGGGTCCAGG + Intergenic
1027358576 7:77384680-77384702 GGAGCTTCAGCAGGAGTGGCAGG - Intronic
1027791775 7:82644185-82644207 GGCGCTGCTGCAGGGGGTCCAGG - Intergenic
1028285453 7:88991500-88991522 GGAGCTGCTGGGGCAAAGCCAGG - Intronic
1028671996 7:93411626-93411648 GGCTCTGCTGCAGGGAAGCCAGG + Intergenic
1028871301 7:95773388-95773410 GGAGCGGGGGAAGGAGAGCCAGG - Intronic
1028931297 7:96415587-96415609 TGGGCTGCTGCAGGAGGGCTTGG + Intergenic
1029479099 7:100802261-100802283 GAGGCTGCTGCAGGAGAGGGAGG - Intergenic
1029482185 7:100819883-100819905 GGAGGGGCTGCAGGAGACCAGGG + Exonic
1029513269 7:101010113-101010135 GGATTTGCTGCAGGAGAGGAGGG + Intronic
1029814084 7:103075603-103075625 GGAGCTCAGGCAGGAAAGCCAGG - Intronic
1029895223 7:103976605-103976627 GAAGCTGCTTTAGGAGAGTCAGG + Intronic
1031513897 7:122679339-122679361 GGGGGTGCTGCAGGAGAGTAGGG - Intronic
1031998286 7:128247215-128247237 GCAGCTGTGGCAGGAGAGCATGG - Intronic
1032094656 7:128932039-128932061 GGTGCTGCTCCAGGAGAGAAAGG + Intergenic
1032265212 7:130365851-130365873 GGAGCAGGTGCAGGAGCTCCTGG + Intronic
1032898030 7:136273950-136273972 GGTGGTGCTGCAGGAGAGAAGGG + Intergenic
1033228837 7:139581301-139581323 GGAGCTGCTGTCGGTGAGTCGGG + Intronic
1033229429 7:139584746-139584768 GGAAAAGCTGCAGGTGAGCCTGG - Intronic
1033333959 7:140436637-140436659 GGAGTTGCTGCATAAAAGCCAGG - Intergenic
1033604570 7:142916743-142916765 TGTGCTGCTGCAGTAGAGTCTGG - Intronic
1033887319 7:145964284-145964306 AGAGATGCTGCCTGAGAGCCAGG - Intergenic
1034458948 7:151187485-151187507 CGACCTGCTGCTGGAGAGCCGGG - Intronic
1034524388 7:151647818-151647840 GGGTTGGCTGCAGGAGAGCCTGG + Intronic
1034830516 7:154304274-154304296 TGAGCTGCTTCTGGAGGGCCAGG + Intronic
1035038720 7:155912028-155912050 GGTGCTGGTGCAGGAGGGCATGG - Intergenic
1035109704 7:156470925-156470947 GGAGCAGGAGCAGGAGAGCGGGG - Intergenic
1035173341 7:157033109-157033131 AGAGCTGGGGCAGCAGAGCCAGG + Intergenic
1035385684 7:158471242-158471264 GGAGCTGGCTCAGGAGAGGCTGG - Intronic
1035688837 8:1546874-1546896 GGAGGTGGTCCAGGAGAGGCAGG + Intronic
1035905573 8:3506226-3506248 GGAGAGGGTGCAGGTGAGCCAGG + Intronic
1035977645 8:4330746-4330768 GGAGATGCCGCAGGAAAGACAGG - Intronic
1036752623 8:11452955-11452977 AGATCTGCTGCAGGAAAGCTGGG + Intronic
1037696538 8:21228759-21228781 GGAGTGGCTGCAGGAGGGCTGGG + Intergenic
1037817239 8:22118728-22118750 GGGGCTGCGGCAGGAGAGCCTGG - Intronic
1038406491 8:27326120-27326142 GGAGTGGCTGCAGGAGAGTCAGG - Intronic
1038430217 8:27493992-27494014 GGCGCTGCTGCAGGGGGTCCAGG + Intronic
1038900831 8:31841918-31841940 GAAGCTTCTGCAGGAGAACATGG - Intronic
1039289396 8:36077579-36077601 GCAGCTGGCTCAGGAGAGCCTGG - Intergenic
1039468561 8:37799961-37799983 GCTTCTGCTGAAGGAGAGCCTGG - Intronic
1039829148 8:41199177-41199199 GGAGCTGCTGGAGTAGAAACAGG + Intergenic
1040140032 8:43898917-43898939 GGAGGTGCTGCAGGAGACTAGGG - Intergenic
1041210442 8:55545248-55545270 GGGGGTGCTGCAGGAGACCAGGG - Intergenic
1041211636 8:55557941-55557963 GCAGCTGATTCAGGAGAGCCAGG - Intergenic
1041312342 8:56529710-56529732 GGGGCAGTTGGAGGAGAGCCTGG + Intergenic
1041340957 8:56844958-56844980 GAAGCTGCTGAGGAAGAGCCAGG + Intergenic
1042575798 8:70217365-70217387 GCAGCTGCTGCAGGAGAGCCAGG - Intronic
1042855135 8:73259489-73259511 GGAGATGCTGCTGCAGAGACAGG + Exonic
1042920177 8:73912452-73912474 GGCGCTGCTGCAGGGGCTCCAGG - Intergenic
1044004798 8:86927320-86927342 GGCGCTGCTGCAGGGGGTCCAGG + Intronic
1044409290 8:91867142-91867164 GGGGCTGCTGCAATGGAGCCAGG + Intergenic
1044937815 8:97309885-97309907 GGAGATGCTGGAGGACAGCTGGG - Intergenic
1046370426 8:113298682-113298704 GAAGCTGATGGAGGAGAGCTTGG + Intronic
1046910517 8:119621325-119621347 GGAGGTGCTCCAGGAGATCCTGG - Intronic
1047177544 8:122555778-122555800 GGACCTGCTGGAGGAGATCAAGG + Intergenic
1048205454 8:132411896-132411918 GGAGCTGCTGCTGGTGCCCCAGG + Intronic
1048284498 8:133131185-133131207 GGAGCTGGTGCTGAGGAGCCTGG - Intronic
1048375344 8:133818179-133818201 GTGGCTGCTGCAGGGGAACCTGG - Intergenic
1049040668 8:140110255-140110277 GGAGCTGCTGCAGGGGGTGCAGG - Intronic
1049040787 8:140110689-140110711 GGAGCTGCTGCAGGGGGTGCAGG - Intronic
1049040860 8:140110908-140110930 GGAGCTGCTGCAGGGGGTGCAGG - Intronic
1049040877 8:140110959-140110981 GGAGCTGCTGCAGGGGCTGCAGG - Intronic
1049069719 8:140347116-140347138 GGGGCTCCTGGAGGAGAGGCTGG - Intronic
1049168709 8:141144036-141144058 GGAGCTGCTGCTGCAGACGCTGG + Intronic
1049199614 8:141333613-141333635 GGAGGGGCTGGAGGAAAGCCTGG + Intergenic
1049202469 8:141347065-141347087 GGAGCTGCTGCAGAGGCACCAGG - Intergenic
1049203278 8:141351989-141352011 GGGGCTGCGGCTGGAGGGCCAGG - Intergenic
1049206511 8:141366163-141366185 GGGTCTGCGGCTGGAGAGCCGGG - Intronic
1049238904 8:141526603-141526625 GGAGCTGCTGGAAGTGGGCCGGG - Intergenic
1049377160 8:142294745-142294767 GGAGCTGCTGCTGCAGGGACGGG + Intronic
1049431446 8:142567138-142567160 GGAGCAGCTGCTGGAGGGTCCGG - Intergenic
1049487862 8:142875797-142875819 GGCCCTGCGCCAGGAGAGCCTGG - Exonic
1049612505 8:143562062-143562084 CCAGCTGCTGCTGGAGGGCCTGG + Exonic
1049681831 8:143922353-143922375 GCAGCTGCTGCAGGAGACGCAGG - Exonic
1049682113 8:143923946-143923968 GGAGCGCGTGCAGAAGAGCCTGG - Exonic
1049683877 8:143931533-143931555 GGACCTGCTGCAGGATGCCCAGG - Exonic
1049745096 8:144259949-144259971 GGACTCGCTGCTGGAGAGCCTGG + Exonic
1049774877 8:144399617-144399639 GGAGAAGCTGCAGGAGCCCCCGG - Exonic
1051372659 9:16371579-16371601 GGAGCTAATGCACCAGAGCCAGG + Intergenic
1052057059 9:23918148-23918170 GGTGCTGCTGCAGGGGATCCAGG + Intergenic
1052192703 9:25677793-25677815 GGTGCAGCTGCAGCAGGGCCCGG + Exonic
1052805939 9:33013509-33013531 GAAGCTGCTCATGGAGAGCCAGG + Intronic
1053587047 9:39469965-39469987 AGAGCTCCTGCATGATAGCCTGG - Intergenic
1054579261 9:66895268-66895290 AGAGCTCCTGCATGATAGCCTGG + Intronic
1056189240 9:84168210-84168232 GGTTCTGCTTCAGGAGAGCTGGG + Intergenic
1056392044 9:86149572-86149594 GGCGCTGCTGCAGGGGGTCCAGG + Intergenic
1057559526 9:96116326-96116348 GGAGCTGGAGCAGGAGGCCCAGG + Exonic
1057613483 9:96567344-96567366 GGAGGTGCTGCAGCCGCGCCAGG + Intronic
1057806118 9:98221048-98221070 GGAGCAGGAGCGGGAGAGCCTGG - Exonic
1057851156 9:98567907-98567929 TGCACTGCTTCAGGAGAGCCTGG + Intronic
1061090424 9:128422901-128422923 AGAGATGCTGCAGGAGTGGCTGG + Exonic
1061499577 9:130994134-130994156 GGACATCCTGCTGGAGAGCCTGG - Intergenic
1061505762 9:131031070-131031092 GGAGCTACTGCCGGGGACCCAGG - Intronic
1061598273 9:131646910-131646932 GATGCTGCTGCCGGACAGCCTGG - Intronic
1061858423 9:133455631-133455653 GCAGCTGCTGCAGGAGGGGTGGG + Intronic
1061882277 9:133574353-133574375 GGAGCAGCTGAAGCAGGGCCTGG + Intronic
1061949984 9:133930771-133930793 GGAGGGGCAGCAGGAGAGGCCGG + Intronic
1061968982 9:134033650-134033672 GGAGCTGCTGCTGCTGAGCCTGG + Exonic
1062367227 9:136216665-136216687 GGAGATGCTGCAGGAGTGGCTGG - Exonic
1062376081 9:136262468-136262490 AGAAATGGTGCAGGAGAGCCTGG + Intergenic
1062405002 9:136391989-136392011 GGAGCGGCTGCAGGCGATCGCGG - Exonic
1062449271 9:136608711-136608733 GGGGCTTCTGCAGGAGGACCAGG - Intergenic
1062451358 9:136617068-136617090 GGACCTTCTGGAGGTGAGCCTGG - Intergenic
1062506830 9:136881851-136881873 GGGGCTGCTGCAGGGGACTCTGG + Intronic
1062516279 9:136938215-136938237 GGAGCAGCTGCCAGAGAGCTGGG - Intronic
1188006780 X:25021072-25021094 GAGGTTGCGGCAGGAGAGCCCGG - Intergenic
1188752993 X:33926437-33926459 GGAGGTGCTGCAGGAGACCAGGG - Intergenic
1188934238 X:36153779-36153801 GGTGCTGCTTCAGCAGACCCAGG - Intergenic
1191220623 X:57984735-57984757 GGAGCAGCTGCTGAAGAACCAGG - Intergenic
1192189645 X:68983125-68983147 GGAGCTGGAGCAGGACAGCAGGG + Intergenic
1192619320 X:72661965-72661987 GGAGATGGGGCAGCAGAGCCAGG - Intronic
1192753922 X:74025331-74025353 GGGGGTGCTGCAGGAGACCAGGG + Intergenic
1192937825 X:75879822-75879844 GGAGCTCCTGCAGGCAGGCCTGG + Intergenic
1194688901 X:96957858-96957880 GGAGGTGCTGCAGGAGGACCTGG - Exonic
1195069120 X:101262571-101262593 TGATCTGCTGCAGGGGAGGCAGG + Exonic
1196441103 X:115720998-115721020 GGATTTGCAGCATGAGAGCCTGG + Intergenic
1196444630 X:115838985-115839007 GGATTTGCAGCATGAGAGCCTGG + Intergenic
1196717612 X:118825757-118825779 GGAGCTGCTGCAAGCGAGTCCGG - Exonic
1198312951 X:135438101-135438123 GGAGGTGCTGCAGCAGTGGCAGG + Intergenic
1198312961 X:135438173-135438195 GAGGATGCTGCAGGAAAGCCTGG + Intergenic
1198450981 X:136767159-136767181 GGAGCAGCTGGAGGACAGGCGGG - Intronic
1199197424 X:145047808-145047830 AGAGCTGCTGAAGGAGGGCTGGG + Intergenic
1199339679 X:146662075-146662097 GGGGGTGCTGCAGGAAAGCAGGG - Intergenic
1199537618 X:148920978-148921000 GGAGCCGCTGCAGCAAACCCTGG + Intronic
1199827858 X:151517071-151517093 GGAGCGGCTGCAGTGGAGCATGG - Intergenic
1200007411 X:153096714-153096736 GGGGCTGCAGGAGGATAGCCAGG + Intergenic
1200091634 X:153638748-153638770 GGATCTGCAGCAGGGGAGCCAGG + Intergenic
1200108109 X:153725470-153725492 GGAGCCGCTGCAGGAATACCCGG - Exonic
1200151126 X:153951988-153952010 GCAGCAGCTGCAGGAGGCCCAGG - Exonic
1200252965 X:154563624-154563646 GGAGCTCCTGCAGGAGCAGCTGG + Exonic
1200264802 X:154640791-154640813 GGAGCTCCTGCAGGAGCAGCTGG - Intergenic
1201345318 Y:12976967-12976989 GATGCTGCTGTTGGAGAGCCAGG - Intergenic
1201367899 Y:13228544-13228566 TGAGCTACTGCAGTATAGCCTGG - Intergenic
1201472710 Y:14351692-14351714 GGAGCTGCTGCAGGGGTTCCAGG + Intergenic
1201963343 Y:19706551-19706573 TGAGCTCCTCCAGGGGAGCCCGG + Exonic