ID: 1078670869

View in Genome Browser
Species Human (GRCh38)
Location 11:13364018-13364040
Sequence CCTGCCCAGCATTACCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078670864_1078670869 2 Left 1078670864 11:13363993-13364015 CCTGTGTTGTCGGTTCAGGCCTG 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1078670869 11:13364018-13364040 CCTGCCCAGCATTACCTCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 201
1078670861_1078670869 27 Left 1078670861 11:13363968-13363990 CCTCTGGAGTACTGAAATAGCTT 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1078670869 11:13364018-13364040 CCTGCCCAGCATTACCTCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078670869 Original CRISPR CCTGCCCAGCATTACCTCCA GGG Intronic
900405141 1:2489708-2489730 GCTTCCCAGCATTTTCTCCAGGG + Intronic
900939947 1:5792236-5792258 CCTGCTCATCCTAACCTCCATGG + Intergenic
902246233 1:15122622-15122644 CCTGCCCAGCCCCACCTGCAGGG - Intergenic
903236408 1:21953285-21953307 CCTGACCAGGATGACCTCGAAGG - Intergenic
903603005 1:24556018-24556040 CCTCCCCAGGATCACCTGCACGG + Intergenic
904348584 1:29890327-29890349 CCTGCCCTGCATCACCAGCACGG + Intergenic
905483176 1:38275476-38275498 CCTCCCCACCAGTTCCTCCAGGG - Intergenic
907425029 1:54374169-54374191 CCTGCCCAGCCTGCCTTCCAAGG - Intronic
908288945 1:62641632-62641654 CCAGCCCAGCAGTACCTGCTTGG + Intronic
909190514 1:72543159-72543181 CCTGCCCAAGATTTCCTCCGTGG + Intergenic
912345704 1:108961657-108961679 CCAGCCCAGCCTGACCACCATGG + Intronic
912624004 1:111192944-111192966 TCTGCCCAGCAATTCCTACACGG + Intronic
916629281 1:166594261-166594283 TCTGACCAGAATTAGCTCCATGG - Intergenic
918918283 1:190672251-190672273 CCTGTCGAGCATTTCTTCCAAGG - Intergenic
919679653 1:200421684-200421706 CCAGGCCAGAGTTACCTCCAAGG + Intergenic
919716159 1:200779073-200779095 CCTCCCCAGCGTTAACTCCATGG - Intronic
920179012 1:204121178-204121200 CCTGACCAGCATGACCAACATGG - Intronic
921073717 1:211683446-211683468 CTTGCACAGAATAACCTCCAGGG - Intergenic
922423597 1:225475129-225475151 GCTGCCGAGCATGACCGCCAGGG + Intergenic
1066282515 10:33931522-33931544 TCTGCCCAGGATTCCCTTCAAGG - Intergenic
1067063942 10:43093275-43093297 CCTGCCCAGCATGTGGTCCAGGG + Intronic
1067282628 10:44883839-44883861 CCTGCCAGGCATTGCCTCCTTGG + Intergenic
1068423417 10:56823921-56823943 CCTGCCCAGCTTTGCCACCTTGG + Intergenic
1069946064 10:71986647-71986669 CCTTTCCAGCATTACTTACAGGG - Intronic
1070785233 10:79158726-79158748 CCTTCCCAGCCCCACCTCCAGGG - Intronic
1074555897 10:114489663-114489685 CCTGCTCAGCAGAACCTTCACGG - Intronic
1076098854 10:127757567-127757589 ACTGCCCAGCCTTACCTGCTGGG + Intergenic
1076854473 10:133109086-133109108 CCTGCCCCTCATATCCTCCATGG + Intronic
1077219090 11:1407481-1407503 CCTGCCCTGCATGACCTTCAAGG + Intronic
1077790220 11:5431165-5431187 CCTGCCCCGTATTATCTGCATGG - Intronic
1078670869 11:13364018-13364040 CCTGCCCAGCATTACCTCCAGGG + Intronic
1078846439 11:15122993-15123015 CCTACCCAGCACTCCCTCCCTGG + Intronic
1079611301 11:22435848-22435870 CCAGCACACCACTACCTCCAGGG + Intergenic
1083783435 11:64930231-64930253 CCTGCCCACCCTCACCTGCACGG - Intronic
1084442022 11:69180014-69180036 CGTGGCCAGCATCACCTCCAGGG + Intergenic
1085198764 11:74688768-74688790 CCTGCCCTCCTTTACCACCATGG - Intergenic
1089833277 11:121347909-121347931 CCTGCCCGGCTATCCCTCCAGGG + Intergenic
1091760218 12:3082354-3082376 CCTGCCCAACCTCTCCTCCATGG - Intronic
1091960612 12:4691027-4691049 ACTGCTCTGCATCACCTCCAAGG - Exonic
1094686235 12:32718700-32718722 CCTTCCCATCAATACATCCATGG - Exonic
1094690080 12:32760242-32760264 TCTGCCCATCCTTACCTGCAAGG + Intergenic
1094828668 12:34289906-34289928 CCTACCCAGCAGTCCCTGCATGG - Intergenic
1094830974 12:34300127-34300149 CCTTCCCAGCAGCACCTGCATGG + Intergenic
1094831309 12:34301558-34301580 CCTTCCCAGCAGCACCTACAGGG + Intergenic
1094831688 12:34303224-34303246 CCTTCCCAGCAGTCCCTGCACGG + Intergenic
1094833660 12:34312262-34312284 CCTTCCCAGCAGTCCCTGCACGG - Intergenic
1095563311 12:43590914-43590936 CCTTCCAAGCCTTTCCTCCATGG + Intergenic
1095775439 12:46004594-46004616 CCTGCCCAGCAGTACTTGCTTGG + Intergenic
1098469786 12:70830052-70830074 CCTACTCTGCATTCCCTCCAAGG + Intronic
1103434973 12:120918072-120918094 CATGCCCAGCCTTATCTTCAAGG - Intergenic
1103721414 12:122977489-122977511 CTTGCCCAGCATTTCCTGCTGGG - Intronic
1109487546 13:63047124-63047146 TCTGCCCAGCAGTATCACCAAGG - Intergenic
1112039613 13:95533786-95533808 CATGCTCAGCAGTACCTTCAAGG + Intronic
1113643900 13:111978723-111978745 GCTGCCAAGAATTCCCTCCAAGG - Intergenic
1116265145 14:42678794-42678816 TATGCTCATCATTACCTCCAGGG - Intergenic
1116991180 14:51278413-51278435 CCAGGCAAGCATTAACTCCAAGG + Intergenic
1118668642 14:68098886-68098908 CCTCCCCAGCAACACCGCCATGG - Intronic
1121645398 14:95514826-95514848 CCTGCCCAGTCTTGCCTCCCGGG + Intergenic
1122115959 14:99527399-99527421 CCTGCCCCGCATTACCCTCCGGG - Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122805940 14:104257007-104257029 CCTTCCAAGCATTACAGCCAGGG - Intergenic
1123496656 15:20833668-20833690 TCTGCACAGCATTACCTCAAGGG + Intergenic
1123553891 15:21407260-21407282 TCTGCACAGCATTACCTCAAGGG + Intergenic
1123590135 15:21844625-21844647 TCTGCACAGCATTACCTCAAGGG + Intergenic
1124141972 15:27085172-27085194 CCTCTCCAGCACTTCCTCCAGGG - Intronic
1125756457 15:42068849-42068871 CCTGTCCAACATGACCTACAAGG - Exonic
1129078311 15:73017018-73017040 CCATCCCAGCATTACCACTAGGG - Intergenic
1202962237 15_KI270727v1_random:134456-134478 TCTGCACAGCATTACCTCAAGGG + Intergenic
1132886739 16:2185511-2185533 TCTGCCCACCATTGTCTCCAGGG + Intronic
1134007513 16:10828023-10828045 CCTCCCCAGCCCTGCCTCCATGG - Intergenic
1135589778 16:23696563-23696585 CCTGCCCAGAGTTAGTTCCAGGG + Intronic
1136516593 16:30772273-30772295 GCTGCCCTACATTACTTCCAGGG - Intronic
1137761684 16:50945981-50946003 CCTGGCCACAATTACCTGCAAGG - Intergenic
1139711638 16:68780758-68780780 CATGCCCACAGTTACCTCCAGGG + Intronic
1141897985 16:86970850-86970872 CCTGGCCAGCACTAGCCCCAGGG - Intergenic
1142259761 16:89037220-89037242 CCTGCCCAGCACTCACTGCAGGG - Intergenic
1142717029 17:1752814-1752836 CCTGCCCAGCCTGACCTCGGGGG - Intronic
1143407999 17:6690778-6690800 CCTGCCCATCTTTGCCTCCATGG - Exonic
1144444343 17:15313352-15313374 CCTGCCCAAAATTGCATCCAGGG + Intronic
1144763725 17:17721920-17721942 CCTGCCCATCATTACATGCCAGG - Intronic
1144785034 17:17826797-17826819 CCTGCCCAGGATTTCCCTCATGG - Intronic
1145355269 17:22139934-22139956 TCTGCCCAGCAATAGCACCAAGG + Intergenic
1145902044 17:28495795-28495817 CCTGCCCATCCTAGCCTCCATGG + Exonic
1148956087 17:51354848-51354870 CCTTCCCTGAATTTCCTCCATGG + Intergenic
1149227377 17:54489822-54489844 TTTGCCCAGCATTAGCTACAGGG - Intergenic
1150050033 17:61952964-61952986 CCTTGCCCGCATCACCTCCATGG + Exonic
1150960311 17:69905214-69905236 CCAGACCAGCATCACATCCATGG + Intergenic
1151358648 17:73575145-73575167 CCTGCCCAGGATCACCCCAAGGG - Intronic
1152468659 17:80478716-80478738 CCTGCCTGGCTTTTCCTCCAGGG + Intergenic
1153162025 18:2217109-2217131 CCTACCCACTATTACCTCCTTGG - Intergenic
1153568406 18:6444048-6444070 CCTCCTCAGCAACACCTCCAGGG - Intergenic
1154454566 18:14509352-14509374 TCTGCACAGCATTACCTCAAGGG + Intronic
1156978409 18:43254439-43254461 CATGACCAGCAAAACCTCCATGG - Intergenic
1157169768 18:45392140-45392162 CCTGTGCTGCATTACCTCCTTGG + Intronic
1157571453 18:48715045-48715067 CTTGCCCTGCATTCCCTCCAGGG + Intronic
1159668465 18:71193704-71193726 CCTGCCTATCAATACCTGCAAGG - Intergenic
1160824343 19:1072633-1072655 CCTGCCTGGCTTTATCTCCAGGG - Intronic
1161464769 19:4422804-4422826 CGGGCCCAGCATGGCCTCCAAGG - Intronic
1161666161 19:5578303-5578325 CCCGCCCAGCGTTTCCCCCACGG - Intergenic
1162087291 19:8256469-8256491 ACTGCCCTTGATTACCTCCAGGG + Intronic
1162964817 19:14150816-14150838 CCTGCCCAGGGTTCCCTCCCTGG + Exonic
1165229467 19:34377860-34377882 CCTGTTCATCATTGCCTCCAAGG + Exonic
1166335619 19:42105044-42105066 CCAGCCCAGTAACACCTCCATGG + Intronic
1167571625 19:50292456-50292478 CCTCCCCAGCTTCACATCCAGGG - Intronic
1167571640 19:50292501-50292523 CCTCCCCAGCTTCACATCCAGGG - Intronic
1167571655 19:50292546-50292568 CCTCCCCAGCTTCACATCCAGGG - Intronic
1168591042 19:57634309-57634331 CCAGCTCAGCCTCACCTCCAAGG - Intronic
1202636212 1_KI270706v1_random:46862-46884 TCTGCACAGCATTAGCTCAAGGG + Intergenic
925918198 2:8622441-8622463 CTTCCCCTGCATTGCCTCCAAGG + Intergenic
927730630 2:25468337-25468359 CCAGCCCAGGATCAACTCCAGGG + Intronic
928320360 2:30278430-30278452 CTTGACCAGCATTTCCTCCAGGG + Intronic
932083007 2:68732417-68732439 CCGGCCCAGCAGCATCTCCACGG - Intronic
932775497 2:74525860-74525882 CCTTCCCAGCATTTCCTGCCAGG + Intronic
933379583 2:81525899-81525921 CCTGACCAGCAGAACCTACAGGG - Intergenic
937083912 2:119158359-119158381 CCGCCCCACCATTACCTCCCCGG - Exonic
942998006 2:182288535-182288557 TCTACCCAGAATTACCTTCATGG + Intronic
947675523 2:231975833-231975855 CCAGAAAAGCATTACCTCCAGGG - Intronic
947751973 2:232537705-232537727 TCTGCCCAGCCCTGCCTCCATGG + Intergenic
947964497 2:234267904-234267926 CCTGCCCTCCATTATCTCGAAGG + Intergenic
1168820941 20:773510-773532 CCTGCTCAGCTTGACCCCCATGG - Intergenic
1170159786 20:13299324-13299346 CCTGCCCTGGATTATCTGCAAGG + Exonic
1170197174 20:13701323-13701345 CATGCCCACCATTTCATCCATGG - Intergenic
1171170945 20:23015020-23015042 ACTGCCCAGCATTCACTCCCAGG + Intergenic
1171882347 20:30627801-30627823 TCTGCACAGCATTAGCTCAACGG + Intergenic
1173152826 20:40582405-40582427 CCTGCTCAGTTTTACTTCCATGG + Intergenic
1174501026 20:50984435-50984457 CCTGCTCAGAATTCCCTCCCAGG - Intergenic
1174592412 20:51656923-51656945 CCTGCCCAGGTTTACCTCATCGG + Exonic
1175846490 20:62062004-62062026 CCTTCCCAGCCTTCCCTCCGTGG - Intronic
1175996165 20:62813186-62813208 CCAGCCCAGCAGGACCTGCAGGG + Exonic
1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG + Exonic
1176023730 20:62975386-62975408 CCTGCCCAGCACTCCCTGCCGGG - Intergenic
1176819602 21:13643956-13643978 TCTGCACAGCATTACCTCAAGGG - Intergenic
1181582335 22:23835180-23835202 CCTTCCCAGCCCTGCCTCCAAGG + Intronic
1182481789 22:30614004-30614026 CGTCTCCAGCATTACCTCCTTGG + Intronic
1183303344 22:37069331-37069353 CCACCCCAGCATGGCCTCCACGG - Exonic
1183826714 22:40394094-40394116 CCTGCTCTGCATTCCCTCCTTGG + Intronic
1184114023 22:42411689-42411711 CCTGCCCATCATGGCCTCCCTGG - Exonic
1185284350 22:49993766-49993788 CCTCCCCAGCCCCACCTCCACGG + Intergenic
950178758 3:10896089-10896111 CCTGCCCAGCCTTCACTGCAGGG - Intronic
952005035 3:28833947-28833969 CATGCCCAACTTTACCTGCAAGG + Intergenic
952083714 3:29792941-29792963 CCTGGCCAGCTTTTCCTTCAAGG - Intronic
952747580 3:36795594-36795616 CCTGCCCAGAAGCCCCTCCAGGG + Intergenic
952902448 3:38119224-38119246 CCTGGCCAGAATTATCTCCCAGG + Intronic
952918469 3:38267421-38267443 TCTCCCCAGCATCACATCCATGG + Intronic
953092672 3:39745022-39745044 CCCATCCAGCATTACCACCATGG + Intergenic
954361055 3:50123065-50123087 CCTGCCCAGCCTGTCCTGCAGGG + Intergenic
954375062 3:50189730-50189752 CCTGCCTAAGATTATCTCCAGGG - Intergenic
954861598 3:53695173-53695195 CCTCCCCAGCACCTCCTCCACGG - Intronic
956983449 3:74667970-74667992 CCTGCCCATCCTTATCTACACGG - Intergenic
957915492 3:86682875-86682897 CCTGCTCAGCAGTCCCTCCCAGG - Intergenic
960101800 3:113750113-113750135 CCTCCCCAGCATTACGTAAAAGG - Intronic
960782561 3:121335814-121335836 ACTGCCCAGCTTGACTTCCAGGG - Intronic
961466180 3:127083004-127083026 CCTGCCCAGCACTGCATGCATGG + Intergenic
963139749 3:141937634-141937656 ACTGCCCTGCAGCACCTCCATGG + Intergenic
963840419 3:150099191-150099213 CCTACCCTGAAATACCTCCAAGG + Intergenic
965227555 3:166008892-166008914 ACTGCCCAGCTTTTCATCCAGGG + Intergenic
966757927 3:183388737-183388759 CCACCCCAGCATTGCCTCCTGGG - Intronic
967458813 3:189721671-189721693 CATGCCCAGACTTACCTCCCTGG + Intronic
968471708 4:785649-785671 CCTGCCCAGCACCTCCTCCGTGG - Exonic
973394580 4:49582203-49582225 TCTGCACAGCATTAGCTCAAGGG - Intergenic
974544505 4:63283236-63283258 CCTGCCCATCATTAGGTTCATGG + Intergenic
976654787 4:87477317-87477339 CCTGCCCACCATTATCTAGAGGG - Intronic
977519974 4:98069896-98069918 CCTGCCCATCCTTACTTCCAGGG - Intronic
977810899 4:101354747-101354769 CCTTCCCTCCATTACATCCAGGG - Intergenic
977978092 4:103290515-103290537 CCTGCCTAGCTGTACTTCCAAGG + Intergenic
978891387 4:113832182-113832204 CCTGCCCTGCATGTCCACCATGG - Intergenic
979579459 4:122339347-122339369 TCTGAGTAGCATTACCTCCAGGG - Exonic
980937055 4:139235631-139235653 CCTGGTCAGCTTTACCTCAAGGG + Intergenic
984228232 4:177062257-177062279 CCTACCTAGCATTGGCTCCAAGG - Intergenic
984770994 4:183436260-183436282 CCTGCCTACCTGTACCTCCAAGG + Intergenic
1202763526 4_GL000008v2_random:132729-132751 TCTGCACAGCATTAGCTCAAGGG + Intergenic
985653087 5:1116038-1116060 CCTGCCCAGGAGTCCCACCAGGG + Intergenic
986672512 5:10155296-10155318 CTTGCCCAGCATGGCCTCCATGG - Intergenic
992089050 5:73301763-73301785 CATCACCAGCATTCCCTCCAAGG + Intergenic
993865042 5:93184255-93184277 CCTGCCCAGCATATTCTTCAAGG + Intergenic
994829748 5:104764644-104764666 CTTGCCCATCACTACCTCAACGG + Intergenic
996549330 5:124713075-124713097 CCTTCCCAGCATGACGTCCAAGG + Intronic
998433672 5:142088612-142088634 CCTGCCCAGCATGTCTGCCAAGG + Intergenic
998643024 5:144033470-144033492 CCTGCCCAGCATTCCATCTTGGG + Intergenic
1001560014 5:172662933-172662955 CATGCCCAGCCTAACCCCCATGG - Intronic
1004678702 6:17870800-17870822 TCAGACCAGCATTACCACCATGG + Intronic
1005897489 6:30190546-30190568 CCTGACCAGCAATAACTCCGGGG - Intronic
1005972129 6:30769680-30769702 ACTCCCCAGCCTCACCTCCACGG + Intergenic
1006078301 6:31548376-31548398 CCTGCCCACCAGGACCGCCATGG + Exonic
1006451259 6:34107047-34107069 TCTGCCCAGCACGGCCTCCATGG + Intronic
1006796610 6:36736091-36736113 CCTGCACAGCATAACCTAGAGGG + Intergenic
1006808764 6:36806372-36806394 CCTGCCCAGCCTCAGCTCCATGG + Intronic
1007331421 6:41112833-41112855 ACTGCCCAGCATTTCCACCCTGG - Intergenic
1008042765 6:46819331-46819353 CCTGCACAGTATTCCCTCTAGGG + Intronic
1012438155 6:99236845-99236867 CATGACCACCATTACTTCCATGG - Intergenic
1015985054 6:138876189-138876211 CCAGCCCAGCATCACTTCCCTGG + Intronic
1017824898 6:158074293-158074315 CATGGCCAGCATTTCCTCCATGG - Intronic
1019643240 7:2115764-2115786 CCTGCCGCGCATGACCTGCATGG + Intronic
1020791770 7:12636114-12636136 CCTGCACAGCCTGTCCTCCAAGG - Exonic
1022510426 7:30931882-30931904 CATGCCCAGGAATGCCTCCATGG + Intergenic
1024558434 7:50623402-50623424 CCTTCCCAGCGTTAGCTCCTGGG - Intronic
1026505470 7:70979226-70979248 CCTGCCCAGCCTGACATCCAAGG - Intergenic
1027171659 7:75877205-75877227 TGTGCCCAGCAGTACCTTCAAGG - Intronic
1027761040 7:82279028-82279050 CCATCCCAGCATTTCATCCAAGG + Intronic
1029111603 7:98215546-98215568 CCTGCCCTGCATCACTTCCTCGG - Exonic
1029565435 7:101334012-101334034 CCGGCCCTGCATTAGATCCATGG + Intergenic
1030564668 7:111138406-111138428 CCTGCCCCAAATTAACTCCAGGG + Intronic
1034487361 7:151374290-151374312 CCTGCCCAGAGCTCCCTCCATGG + Intronic
1036001876 8:4614336-4614358 CACTCCCACCATTACCTCCATGG + Intronic
1036632303 8:10524365-10524387 CCTGCCCAGTCTTACCTCCTCGG - Intergenic
1036691432 8:10947160-10947182 CCTTGCCAGCATTACCACCATGG - Intronic
1037208145 8:16350381-16350403 CCAGCCCAGTGTTGCCTCCAAGG - Intronic
1039542952 8:38386561-38386583 CCTGCCCACCCCTACCTCCTCGG - Exonic
1041607552 8:59800736-59800758 ACTGCTCAGCATTACCTTGAAGG - Intergenic
1041830071 8:62143906-62143928 CCTGACCAGCCTTCCCTCCGAGG + Intergenic
1048468864 8:134689436-134689458 CCTGCCCTGCATCAACACCATGG + Intronic
1048895499 8:138988967-138988989 ATATCCCAGCATTACCTCCATGG + Intergenic
1049246520 8:141565717-141565739 CCTGCCCAGCCTGTCATCCAAGG - Intergenic
1060941501 9:127545485-127545507 CCTGCCCACCATGGCCTCCCTGG - Intronic
1062391515 9:136335815-136335837 CCTGCCCAGTATCACCTCAGGGG + Intronic
1062516649 9:136940212-136940234 CCTGTCCTCCATGACCTCCAGGG - Intronic
1062622186 9:137428134-137428156 CCTGCCCGGCCTCACCTCCCAGG - Exonic
1203527758 Un_GL000213v1:105614-105636 TCTGCACAGCATTACCTCAAGGG + Intergenic
1186261780 X:7787866-7787888 CCTGCACAGCATTTCCTGCTTGG - Intergenic
1193888797 X:87017376-87017398 CCTGCCCACCAGTCCCTCCCAGG + Intergenic
1197706859 X:129640272-129640294 AATGCCAAGCATTCCCTCCAGGG - Intergenic
1199538450 X:148930487-148930509 CTGTCCCAGCATTACCTCCCTGG + Intronic
1199853058 X:151738973-151738995 CCTGTCCACCAAGACCTCCAAGG + Intronic