ID: 1078671460

View in Genome Browser
Species Human (GRCh38)
Location 11:13369456-13369478
Sequence AGGCTTTAACAGATGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078671460_1078671465 28 Left 1078671460 11:13369456-13369478 CCATGCTGCATCTGTTAAAGCCT 0: 1
1: 0
2: 0
3: 5
4: 169
Right 1078671465 11:13369507-13369529 TCATTATAAAACAGTGAGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 262
1078671460_1078671464 24 Left 1078671460 11:13369456-13369478 CCATGCTGCATCTGTTAAAGCCT 0: 1
1: 0
2: 0
3: 5
4: 169
Right 1078671464 11:13369503-13369525 GTCATCATTATAAAACAGTGAGG 0: 1
1: 0
2: 1
3: 14
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078671460 Original CRISPR AGGCTTTAACAGATGCAGCA TGG (reversed) Intronic
908963327 1:69728413-69728435 AGGCCATAAAATATGCAGCAAGG + Intronic
910148946 1:84117965-84117987 AAGCATGAACAGCTGCAGCAAGG - Intronic
912755554 1:112321867-112321889 AGGGTTTATAAGATGCAGGAAGG - Intergenic
912854107 1:113152130-113152152 AGGCTTTAATAGATTCAGAGTGG + Intergenic
913070095 1:115290691-115290713 AGGCTTTAAGAGATAGAGAAGGG - Intronic
918394264 1:184097724-184097746 AGGCTTTAAAGGGTGCACCAGGG + Intergenic
918878328 1:190080830-190080852 TGATTCTAACAGATGCAGCAGGG + Intergenic
920896878 1:210060038-210060060 ATGCTGAAACAGATGTAGCAAGG - Intronic
922458612 1:225797545-225797567 AGGCTTTAAAAGAATCAGTACGG - Intergenic
922704635 1:227782740-227782762 AAGCTCTAACAGATGGAACAAGG + Intergenic
923165298 1:231355841-231355863 AGTGTTTAACAGATGTAGTAAGG - Intergenic
923732271 1:236563642-236563664 ATGCGTTAACAGATGAAGAAGGG - Intronic
1065243178 10:23728939-23728961 AGGGGTGAATAGATGCAGCACGG - Intronic
1066063522 10:31745187-31745209 AGGCTTGAAGAGAAGGAGCAAGG - Intergenic
1068316385 10:55348826-55348848 AGGACTTCAAAGATGCAGCATGG - Intronic
1072607711 10:96998460-96998482 AGGCATGAAGAGATACAGCAGGG - Exonic
1073614693 10:104981870-104981892 AAACTTTAACAGATACAGCTGGG + Intronic
1075228229 10:120648966-120648988 GGGCTTTAGCAGATTCAGGAAGG - Intergenic
1077636246 11:3843102-3843124 AGGCTTTATCAGATTCAGGCTGG + Intergenic
1078671460 11:13369456-13369478 AGGCTTTAACAGATGCAGCATGG - Intronic
1084509027 11:69591445-69591467 AGGCTTTAACATATGAATCCTGG - Intergenic
1084770019 11:71336609-71336631 AGGCTTGCCCAGAGGCAGCACGG + Intergenic
1085653713 11:78292856-78292878 ATCCTTTAACAAATGCTGCAAGG + Intronic
1085918009 11:80914639-80914661 AGACTTTAAAAGATTCAGGATGG - Intergenic
1086363515 11:86084518-86084540 AGGAATAAACAGATCCAGCAGGG - Intergenic
1088983276 11:114883169-114883191 AGGCTTAAACTGAAGCAGGAGGG + Intergenic
1089407659 11:118211829-118211851 TGGGATTAGCAGATGCAGCATGG - Intronic
1099822731 12:87733797-87733819 AGGGTTTAAATGATGCTGCAAGG + Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100667529 12:96771156-96771178 AGGCCTTAACAGATGGAACTGGG + Intronic
1112431821 13:99356801-99356823 AGGCTTTCAAATATGCAGCATGG + Intronic
1117716495 14:58586932-58586954 AGGCTATAACATCTTCAGCATGG - Intergenic
1118119405 14:62821786-62821808 AGGCTTTAAGAGATGCTTGAGGG - Intronic
1120655255 14:87181510-87181532 AAGCTTTGAAAGATGGAGCACGG - Intergenic
1124417878 15:29489192-29489214 AGGCAGTAGCAGAAGCAGCATGG + Intronic
1125175535 15:36817935-36817957 AGGCTTTACAAGATGCTTCAAGG - Intergenic
1125688512 15:41578229-41578251 AGGCTTTTGCTGCTGCAGCAAGG + Exonic
1126174962 15:45727709-45727731 AGGATTGAATAGATGGAGCATGG + Intergenic
1127468797 15:59271593-59271615 GGGCTTTAAAAAATGCAGAATGG - Intronic
1127543528 15:59967149-59967171 AGGCTGAAACAGAAACAGCAGGG - Intergenic
1127613798 15:60663079-60663101 AGGCTTCAGCAGATGCCACAGGG - Intronic
1127710756 15:61595419-61595441 AGGCTCTAACCAATGCAGTATGG - Intergenic
1128250228 15:66158707-66158729 AGGCTTCAACAGTCCCAGCATGG + Intronic
1129530160 15:76259011-76259033 AGGCTTTTGCTGCTGCAGCAAGG - Intronic
1130080336 15:80727384-80727406 ATTCTTTAACAGAAGCACCATGG - Intronic
1133319695 16:4905281-4905303 AGGCTTGTTCAGATGGAGCACGG - Intronic
1133612067 16:7442593-7442615 AGGCCTAAACAGATGAGGCAGGG + Intronic
1138425238 16:56927688-56927710 AGGCATTAAAGGAGGCAGCAAGG - Intergenic
1141891049 16:86926688-86926710 TGGCTTTAGCAGATGCCACAGGG + Intergenic
1146540048 17:33686130-33686152 AGTTCTTAACAGCTGCAGCAGGG + Intronic
1150457609 17:65320129-65320151 AGGCTTCAACATATGAAGTATGG + Intergenic
1153365217 18:4248143-4248165 AGGCTTTTGGAGAGGCAGCAAGG - Intronic
1153951338 18:10060212-10060234 TGGCTTTAACAGAGACAGCGAGG - Intergenic
1156949094 18:42871526-42871548 TGGCTTAAACAGATTCAGTATGG - Intronic
1159734119 18:72073181-72073203 AGGGTTTTAAAGATACAGCACGG + Intergenic
1161600258 19:5177908-5177930 TGCCTTTAAAAGATGAAGCAAGG + Intronic
1162369146 19:10268636-10268658 AGGCTTCAAGAGCTGCAGCCAGG - Intergenic
1164280309 19:23763052-23763074 AGGCTGTAACAGAGTCACCAGGG - Exonic
927580001 2:24234682-24234704 AGACCTTAACAGATGCCTCATGG + Intronic
931044881 2:58340663-58340685 AGTCTTAAGCAGCTGCAGCATGG + Intergenic
931865312 2:66404063-66404085 AGGGTTTAATAGGTGAAGCATGG + Intergenic
931958959 2:67460459-67460481 GAGCTTTAAAATATGCAGCAGGG - Intergenic
932547912 2:72734758-72734780 AGGCTTTACAAGCTGAAGCATGG + Intronic
932742311 2:74301114-74301136 TGGCTTTAATATATGCTGCAAGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937061600 2:118984062-118984084 AGCCATTAAGAGATGCAGCCAGG + Intronic
937159764 2:119749049-119749071 AGGGATGAACAGGTGCAGCACGG - Intergenic
939152867 2:138493851-138493873 AGTATTTAACAAATGAAGCATGG + Intergenic
941063888 2:160879047-160879069 AAGCTTTAACAGATGCCCAAAGG - Intergenic
943579684 2:189670985-189671007 AGCCTTTAACACCTGCAGCTTGG + Intergenic
944723309 2:202445627-202445649 AGGCAATAACAAATGCTGCAAGG - Intronic
946166786 2:217869367-217869389 AGGCCTCAATAGATCCAGCAAGG + Intronic
946246441 2:218390518-218390540 AGGCTCTAACAACTGCAGCCAGG + Intronic
946311061 2:218882933-218882955 AGGGTTTTCCAGAGGCAGCAGGG - Intronic
1175461430 20:59154557-59154579 AGTCATTAAGAGAAGCAGCAAGG - Intergenic
1175468711 20:59210469-59210491 AGGCTGTGTCAGCTGCAGCAGGG + Intronic
1180708403 22:17823404-17823426 AGGCTTTGGCAGATGCTGCTGGG - Intronic
1182006263 22:26962173-26962195 AGGCTGTAATAGATGCTGCCAGG + Intergenic
1184385507 22:44172142-44172164 TGGCCTGGACAGATGCAGCAAGG + Intronic
949560525 3:5197704-5197726 AGGCTTTAACAGATGTGCTAGGG + Intronic
951547092 3:23837642-23837664 ACGCTTTATAAAATGCAGCAAGG - Intronic
954718271 3:52538051-52538073 AGGCTTTAACATGTGGAGAATGG + Intronic
955795851 3:62636362-62636384 AGTCTTTAACAGCTGCAGTCTGG - Intronic
956271281 3:67449911-67449933 AAGCTTTAAAATATTCAGCATGG - Intronic
959526718 3:107385507-107385529 AGGATTTAAGAAATTCAGCAAGG - Intergenic
960194846 3:114753093-114753115 AGGATTTTACAAATGCATCAAGG + Intronic
961905836 3:130262149-130262171 AGGTTTAACCAGATGCAGAAGGG - Intergenic
961917268 3:130390324-130390346 AGGTTTTTACAGATACAGCCTGG + Intronic
970779270 4:19716255-19716277 AACCTTTCACAGATGGAGCAGGG - Intergenic
971055694 4:22910406-22910428 AGGCTATAACAGATGACCCAGGG + Intergenic
971620150 4:28845388-28845410 AGGACTCAACAGATGCAGAATGG - Intergenic
971656206 4:29348511-29348533 AGCATTTAAAAGATGAAGCAAGG - Intergenic
972313004 4:37898909-37898931 AGCCTTTAAAAGGTGCACCAAGG + Intronic
974476392 4:62387379-62387401 AGGCTTCAAAAGCTGCAGCTTGG + Intergenic
976839022 4:89409118-89409140 AGACTTTAAAAAATGCAGGAAGG - Intergenic
978613568 4:110571365-110571387 AGTCTTAAGCAGCTGCAGCACGG + Intergenic
979037307 4:115738374-115738396 AAGCTTTAAAAGATGTAGTAAGG - Intergenic
983902758 4:173153869-173153891 ATGCTTTAACAGGTGCTGTATGG - Intergenic
985651429 5:1109535-1109557 AGGCTCCACCAGAAGCAGCAGGG + Intronic
992062938 5:73074806-73074828 AGGCATTAACAGATTCTGTAAGG - Exonic
992584857 5:78227943-78227965 AAGCTGTAACATATACAGCAAGG + Intronic
992668668 5:79036849-79036871 GGGCTTCAACAGATGCATTATGG - Intronic
992895926 5:81245174-81245196 AGGCTTTGACAGCTGGGGCAGGG + Intronic
994087982 5:95781076-95781098 AGGTTGGAACAGATCCAGCAGGG + Intronic
994671052 5:102762159-102762181 TGACTTTACCAGATTCAGCAGGG - Intronic
996159508 5:120145357-120145379 AGGCTTTCACAGGTGCACAAAGG - Intergenic
997425443 5:133799691-133799713 AGGCGTTACCAGCTGCAGCCTGG - Intergenic
999268428 5:150282160-150282182 AGACTCTAAAAGATGCTGCAGGG + Intronic
999738481 5:154531046-154531068 AGGGTTTAACAAATGCATCCAGG + Intergenic
1000345099 5:160307775-160307797 GGGCTTCTGCAGATGCAGCAGGG + Intronic
1001266445 5:170277935-170277957 AGGCTTTAAGAGCAGCAGCGGGG + Intronic
1001794001 5:174486612-174486634 AGGATTGAATAGATGAAGCATGG + Intergenic
1002780023 6:358642-358664 AGGCTTTAAGAAGTGCAGCGAGG + Intergenic
1003616090 6:7656739-7656761 AGGCTTGCACAGCTCCAGCAGGG - Intergenic
1003659084 6:8043708-8043730 TAGCTTTTACAAATGCAGCATGG + Intronic
1004017762 6:11747782-11747804 AGGCTTTCACAGAGACAGAAAGG + Intronic
1005483594 6:26277874-26277896 GGACTTCAACATATGCAGCAGGG + Intergenic
1007455302 6:41972522-41972544 AGGCTTTAAGAGGTGAAGCCTGG - Intronic
1007492061 6:42230830-42230852 GGGCTTAATCAGACGCAGCATGG + Intronic
1007643779 6:43364860-43364882 AGGCTGAAACAGATTCAGAAAGG - Intronic
1008766623 6:54924870-54924892 AGGCTTTAAAAAAGGTAGCAAGG - Intronic
1012227445 6:96720266-96720288 TGGCTTTTACAGAGGCAGCTGGG + Intergenic
1012832846 6:104227627-104227649 AGGCTTAAAGAGAGGCAGGAAGG - Intergenic
1016487470 6:144557641-144557663 AGGTGTTTACAGATGCATCAGGG + Intronic
1016728551 6:147402794-147402816 AGGCCATAACAAATGCTGCAAGG - Intergenic
1018276004 6:162132376-162132398 AGGCCATACCAGAGGCAGCAAGG + Intronic
1022152840 7:27626805-27626827 AGACTTTAAAAAATGCATCATGG - Intronic
1022743806 7:33149164-33149186 AGGCTTTCATTGATGGAGCAGGG + Intronic
1023023423 7:36030820-36030842 AGTCTTTAAAAGATGCAAGACGG - Intergenic
1024941112 7:54764295-54764317 AGGCTTTGACAAATGCATAATGG - Intergenic
1025802433 7:64798932-64798954 AGGCTGTAACCAAAGCAGCATGG - Intronic
1029678530 7:102090980-102091002 AGACTTGAACACATGCAGCCTGG + Intronic
1030628476 7:111869883-111869905 AGGCATTACCAGAAACAGCAGGG - Intronic
1030757186 7:113301320-113301342 AGGGTTGAACAGATGAAGCACGG - Intergenic
1033455769 7:141502095-141502117 AGGGGATAACAGATGAAGCAAGG - Intergenic
1033781440 7:144674627-144674649 ATGCTTTAACATATGCAGAAAGG - Intronic
1033889888 7:145998914-145998936 AGTGTTTAACATATGCAGAATGG - Intergenic
1034175837 7:149099124-149099146 TGGCTGTACCAGATGCAGCTAGG + Intergenic
1034508708 7:151518087-151518109 CAGCTTTAACAGCTGCAGCCAGG - Intronic
1035161198 7:156951021-156951043 AGGCCTTAACAGATGAGGTAGGG - Intronic
1038342178 8:26695676-26695698 AGCCTCTGACAGCTGCAGCAGGG - Intergenic
1039741578 8:40387846-40387868 CAGCTTTAACAGGGGCAGCAAGG + Intergenic
1040816217 8:51511092-51511114 AGGCTTTTACAGGGGCAGGATGG + Intronic
1042964666 8:74337644-74337666 AGCTTTCAGCAGATGCAGCAAGG + Intronic
1043258818 8:78171400-78171422 AGGGCTTTACAGATACAGCACGG - Intergenic
1044852401 8:96441919-96441941 AGGCTTAAGCAGGAGCAGCATGG + Intergenic
1045407552 8:101881710-101881732 AGGCTTTAACAAATAAAACAAGG + Intronic
1045769643 8:105720902-105720924 CTACTTTTACAGATGCAGCAAGG - Intronic
1046553384 8:115745330-115745352 ATGCTTAGAAAGATGCAGCATGG - Intronic
1048034779 8:130667302-130667324 AGGGTTTAACACAAGCAGAACGG - Intergenic
1048812588 8:138302422-138302444 TGGCATTAACAGCTGCTGCATGG - Intronic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1052981901 9:34456375-34456397 AGGCAATAACAGAAGCACCAAGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1056856703 9:90136738-90136760 AGGCTTTAACTGGTGCAATATGG - Intergenic
1057317223 9:93977388-93977410 TGGCTTTAACAAATGCAACGAGG + Intergenic
1057867935 9:98696192-98696214 AGGATTTAAAAGATGAAGAAAGG + Intronic
1058042896 9:100323740-100323762 ATGCTTTAATAGAGACAGCAAGG + Intronic
1059047056 9:110880199-110880221 TTGCTTTGACAGATGCATCAGGG - Intronic
1059340404 9:113594652-113594674 AGGCTTTCACAGAGGGAGCTGGG + Intronic
1060292952 9:122320860-122320882 AGGCTTTAAGGGCTGCAGCATGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188041060 X:25370013-25370035 AGTCTTAAGCAGCTGCAGCAAGG - Intergenic
1189223640 X:39394706-39394728 AGGCTTTACCAGATGCCAAAGGG + Intergenic
1189644390 X:43110935-43110957 AAGCTATCAGAGATGCAGCAGGG + Intergenic
1189698175 X:43687389-43687411 GGGCTTTAACAAAGACAGCAAGG - Intronic
1190322844 X:49188591-49188613 AGGCTTTAAGCGAGGCAGAATGG - Exonic
1193736203 X:85159752-85159774 GGGCATTCACAGAGGCAGCATGG - Intergenic
1196055455 X:111350369-111350391 AGGCTTTTACAAATGCAAAATGG - Intronic
1197592514 X:128425894-128425916 AGGCTTTAACAGTGGAGGCAGGG - Intergenic
1202193392 Y:22269402-22269424 AGCCTTAAAAAGATGCAGAATGG - Intergenic