ID: 1078677726

View in Genome Browser
Species Human (GRCh38)
Location 11:13440039-13440061
Sequence CAGAGGAATCTTGAAGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078677726 Original CRISPR CAGAGGAATCTTGAAGATGA TGG (reversed) Intronic
903857771 1:26346716-26346738 CAGAGGAATAAGAAAGATGAGGG + Intronic
908032613 1:60017333-60017355 CAGAGGATTTTAGAAGATGAAGG - Intronic
908095159 1:60729939-60729961 TGGAGAGATCTTGAAGATGATGG - Intergenic
909897327 1:81089055-81089077 GAGATGAATCATGAAGAGGAGGG - Intergenic
910352802 1:86318848-86318870 CCAAGGAGTCTTGAAGAGGAGGG + Intergenic
910888531 1:91992447-91992469 CAGAGAAATATGGAAGCTGAGGG + Intronic
911808146 1:102237376-102237398 TAGGGGAGTCTTGAAGAAGAAGG + Intergenic
912549403 1:110475240-110475262 GAGCAGAATCTTGAAGAAGATGG + Intergenic
912872474 1:113322019-113322041 CAGAGGAGTCTTCCAGATCAAGG + Intergenic
912937302 1:114014623-114014645 CAGAGCAATCATGATGATGGTGG - Intergenic
912977900 1:114346391-114346413 GAGAGGAATCTGGAAGAAGGAGG - Intergenic
914926374 1:151892075-151892097 CAGAGGGCTTTTTAAGATGAGGG + Intronic
915119149 1:153617670-153617692 CAGAGGAACCTTTAGGCTGAGGG - Intergenic
915547889 1:156612711-156612733 CAGAGGAGTCTTGCTGATAATGG + Intergenic
918741894 1:188142404-188142426 CTGAGGACTCTTGAAGAGGAAGG + Intergenic
918797404 1:188919237-188919259 AGGAGGAATCCTGAGGATGATGG + Intergenic
919043342 1:192420846-192420868 CTGAGGCATCTGGAAGATGGAGG + Intergenic
921308602 1:213821135-213821157 CAGAGTAAGATAGAAGATGAAGG - Intergenic
922039933 1:221886871-221886893 CAGAGCAATCCTTAAGATGCAGG - Intergenic
922446901 1:225705504-225705526 CAAAGAAATCTTGAAGCTTAAGG - Intergenic
923719682 1:236456251-236456273 CAGAGGAATCAGGGAGATGGAGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063192032 10:3704550-3704572 CAGAGGTACCTTGAGGAAGAAGG + Intergenic
1065263954 10:23955848-23955870 CACAGAAATCTGAAAGATGAAGG + Intronic
1065486579 10:26241633-26241655 CAGAGGAAACTTGGAGAAAAAGG - Intronic
1066253316 10:33654865-33654887 CAAAGAATGCTTGAAGATGAGGG - Intergenic
1069432800 10:68352471-68352493 CAGAGAACTCTTGAAGTTGGAGG + Intronic
1070258155 10:74827584-74827606 CAGAGCAAACTTAAATATGAAGG + Intronic
1070285860 10:75083261-75083283 AAGAGGATGCTTGAAGAAGAGGG - Intergenic
1071156528 10:82695894-82695916 CAGAGGAAGCTTGCAGGTAAAGG - Intronic
1071355850 10:84793457-84793479 CAAACCAATCTTGAAAATGAAGG - Intergenic
1072000139 10:91186861-91186883 CAGTGTAATCTTCAAGGTGAGGG + Intronic
1073677398 10:105663646-105663668 CAGAGAAATCCTGAAGTGGAGGG - Intergenic
1076262746 10:129080794-129080816 GAAAGAAATCTTGAAGATGCTGG + Intergenic
1076832853 10:133005508-133005530 CAGAGGAAATTAGAAGATAAAGG + Intergenic
1077571121 11:3339308-3339330 CAGAGGAAACTTTAATAAGAAGG + Intronic
1078677726 11:13440039-13440061 CAGAGGAATCTTGAAGATGATGG - Intronic
1078752731 11:14180324-14180346 CGGAGGCATGATGAAGATGAAGG - Intronic
1083088986 11:60180390-60180412 CAGTGGAGTCTGGGAGATGAGGG - Intronic
1083190708 11:61050075-61050097 CAGAGGAAACTGGAAGGGGAAGG - Intergenic
1084341561 11:68506716-68506738 GAGAGGAATGGGGAAGATGATGG - Intronic
1085897621 11:80658831-80658853 CAAAGGCATCATGAAGATAATGG - Intergenic
1086370162 11:86148405-86148427 GAGCTGAGTCTTGAAGATGAGGG + Intergenic
1086592950 11:88537530-88537552 CAGAGGAAAATTCTAGATGAAGG + Intronic
1088720192 11:112585419-112585441 GAGAGGATTCCTGGAGATGAGGG + Intergenic
1090879473 11:130820986-130821008 AAGAGGAATCTGGGAGATGGAGG - Intergenic
1090891547 11:130927582-130927604 AGGAGGAAAGTTGAAGATGATGG - Intergenic
1091111616 11:132974232-132974254 GAGAGGTAGCTGGAAGATGAAGG - Intronic
1091935678 12:4432746-4432768 GCGAGGTATGTTGAAGATGAAGG + Intronic
1094230849 12:28101539-28101561 CAGAAGCATCCTGAAGAAGAGGG + Intergenic
1094234496 12:28148106-28148128 GAGAAGAATCTTGAAGACTAAGG + Intronic
1095201001 12:39384115-39384137 CAGAGGACTCTTGAATAGGTGGG + Intronic
1095993059 12:48051648-48051670 CAGAGGAGGGCTGAAGATGAAGG + Intronic
1097083057 12:56447433-56447455 CAGAGAAGTCTGGAAGATGAGGG + Intronic
1097903337 12:64895306-64895328 AAGAGGAATCTAGAATTTGAGGG + Intergenic
1102739068 12:115190074-115190096 AAGAGGAATGGGGAAGATGAAGG - Intergenic
1102954191 12:117048814-117048836 CTGAGGAATGTTTAGGATGAAGG + Intronic
1103546189 12:121703253-121703275 CAGAGGCAACTTGAGGCTGAAGG + Intergenic
1103929812 12:124444083-124444105 CAGAGGAATGTTGAACACGTGGG - Intronic
1106514053 13:30437844-30437866 CACAGGAATCAAGAGGATGATGG - Intergenic
1106835718 13:33633180-33633202 AAGAGGAATTTAGAAGGTGAGGG - Intergenic
1106952031 13:34894848-34894870 CAGAGGGATTTTGAAGTTGCTGG + Intergenic
1108676952 13:52745367-52745389 TAGAGGAACCTGGAAGATGTTGG + Intergenic
1109517896 13:63468187-63468209 CAAAGCAATCTTGAAAAAGAAGG + Intergenic
1110512501 13:76367591-76367613 CAAAGCAATCTTGAGGAAGAAGG + Intergenic
1110564285 13:76942206-76942228 CAGAGAAATCCTGCAGTTGAGGG + Intergenic
1111582195 13:90236740-90236762 CACAGGGATGATGAAGATGATGG + Intergenic
1113363742 13:109656371-109656393 AAGAGGAATTTTGAGGATGTGGG - Intergenic
1116741621 14:48762514-48762536 CAGAGGGATTTTGAAAGTGAAGG + Intergenic
1117216720 14:53559211-53559233 CAGATGGATCTTAAAGATGCAGG + Intergenic
1117388447 14:55240080-55240102 CTGAGGAATCTCCAAGTTGAAGG - Intergenic
1117988422 14:61410932-61410954 CAGATGATTTTTGAAAATGAGGG + Intronic
1118730426 14:68662140-68662162 AAGAAGAGTGTTGAAGATGAGGG - Intronic
1119904263 14:78287134-78287156 TAAAGTCATCTTGAAGATGAAGG + Intronic
1120737172 14:88066110-88066132 GTGAGGAGTTTTGAAGATGAAGG - Intergenic
1120886732 14:89457638-89457660 CAGAGGAATCCTCTACATGAAGG + Intronic
1122025981 14:98876532-98876554 CAGAACAATCTTGAAAAAGAAGG + Intergenic
1124991682 15:34680527-34680549 CTGAGGAATATTGAAGAAGGTGG + Intergenic
1125481353 15:40083150-40083172 CAGAGGAATCATGGAAATTATGG + Intergenic
1137474186 16:48792570-48792592 CAGAGGAATCATGAAGTTTTGGG - Intergenic
1139637925 16:68270069-68270091 CAGAGAAATCCTAAAGCTGAGGG - Intronic
1140115042 16:72034565-72034587 CAGAGGTTTTTTGAAAATGAAGG - Intergenic
1140968700 16:79992389-79992411 CAGAGGGAACTTGCAGATTATGG - Intergenic
1142790338 17:2259225-2259247 CAGAGAAGTCTTGGAGATTAAGG + Intronic
1143279301 17:5739660-5739682 CAGAGGAATGTTGAAAATAAAGG + Intergenic
1143500460 17:7335792-7335814 CACAGGAACCATGAATATGACGG + Intergenic
1143836146 17:9694513-9694535 CAGAGCAATCTATAATATGATGG + Intronic
1144690175 17:17256590-17256612 AAAAGGAATTTTCAAGATGAGGG - Intronic
1147191369 17:38739954-38739976 CAGAGGCATCTTGAACACGCTGG - Intronic
1148166429 17:45487084-45487106 CAAAGGGCTCTTGAACATGACGG + Intronic
1148676220 17:49446680-49446702 CAAAGGATTCTTGCTGATGAAGG + Intronic
1149193688 17:54093934-54093956 CAGAGGAATCTTGGAGGAGTAGG - Intergenic
1150397599 17:64833484-64833506 CAAAGGGCTCTTGAACATGACGG + Intergenic
1150549934 17:66200728-66200750 CACAGGAAACTTCAATATGAGGG + Intergenic
1151447852 17:74178814-74178836 CAGAAGAATCTTCCAAATGAGGG + Intergenic
1153757207 18:8296301-8296323 CAGAGGGATCTTAACGATGGAGG - Intronic
1154004902 18:10518871-10518893 CACAGGAATCTGGAAAATAAGGG + Intergenic
1156330364 18:36115755-36115777 CAGCGGGACCTTGAAGATCATGG + Intronic
1158222585 18:55165449-55165471 CAGAGGAATCTTCTAGATAGTGG + Intergenic
1158242229 18:55389906-55389928 CTGAGGACTTTTGGAGATGAGGG + Intronic
1160084909 18:75767662-75767684 CAGAAGATTCTTGAGGATGTTGG - Intergenic
1162327537 19:10007771-10007793 CCGAGGAGTCTGGAAAATGAGGG - Intronic
1162791685 19:13066321-13066343 CACAGGAACCTGGCAGATGAAGG - Intronic
925031444 2:653090-653112 CACAGGAAGCTTGAAGAGCATGG - Intergenic
925119621 2:1407827-1407849 CAGTGTAATCTTGAAGATGTGGG - Intronic
925665882 2:6255689-6255711 AAGAGGAGTTTGGAAGATGAAGG + Intergenic
926494735 2:13572056-13572078 CAGAGGAATATTTGAGATGCAGG - Intergenic
927433708 2:23048786-23048808 GAGAAGAATCTTCAAGATGGAGG - Intergenic
928401853 2:30984745-30984767 CAGAGGCTTCTTGAAGGAGATGG - Intronic
928675377 2:33645988-33646010 CACAGGAAGCTTGAAGTTGGGGG + Intergenic
928712474 2:34022771-34022793 CAGAGGAAACTTCAAGAGGCTGG + Intergenic
929421983 2:41800596-41800618 CAAAGGTATCTTGAACTTGATGG + Intergenic
929821737 2:45279739-45279761 CAGAGAGACCTTGAAAATGAAGG + Intergenic
930182100 2:48370482-48370504 CAGAGAAATCCTGAAGGAGAAGG - Intronic
930327480 2:49938403-49938425 CAGAGGAATCATGTTGATCAAGG - Intronic
930614020 2:53574666-53574688 CACTGGAATCGTGAAGATGGGGG - Intronic
930946617 2:57084132-57084154 GAGAGGCAACTGGAAGATGATGG - Intergenic
931999430 2:67870781-67870803 CAGAGGAATGGTGATGAGGATGG - Intergenic
932385268 2:71326563-71326585 CAGAGGAAGAATGAAGAGGAAGG - Intronic
934539454 2:95161896-95161918 AAAAGGAATATTGAAGGTGATGG - Intronic
935236346 2:101141543-101141565 GAGGGGAATCTCTAAGATGATGG - Intronic
938838529 2:135134745-135134767 CAGAAGCATGTTGAATATGAGGG + Intronic
939075679 2:137599982-137600004 CAAAGGAAACTGGAAGCTGAGGG - Intronic
941864174 2:170316767-170316789 CAGAGGACTGTTCAAGATGGAGG - Intronic
942236799 2:173917921-173917943 CACAGGAATATTGAAGATGAGGG - Intronic
943444349 2:187965529-187965551 AAGATAAATCTTCAAGATGATGG + Intergenic
944219998 2:197293606-197293628 GAGAGGAATTTTGGGGATGAGGG + Intronic
944515211 2:200506122-200506144 TTGAGGAGTCTTGAACATGAGGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
947378545 2:229522700-229522722 CCGAGGTAACTTGAAGATGCTGG - Intronic
947544067 2:230998578-230998600 GAAAGGAATGTTGGAGATGAAGG + Intronic
947777826 2:232728435-232728457 AAGAGGAATCTTGAAGAAGTAGG + Intronic
948750202 2:240127755-240127777 CAGAGGGACTTTGAAAATGACGG - Intronic
1170400606 20:15979120-15979142 GAGAGGAAACTGTAAGATGAGGG + Intronic
1173879797 20:46403685-46403707 CTGAAGCATCCTGAAGATGAAGG + Intronic
1178686116 21:34711986-34712008 CACATGAAACTTGAAGAAGAGGG + Intronic
1180911273 22:19452491-19452513 CAGAGGAAACTAGAAGATAGTGG - Intronic
1183524199 22:38314173-38314195 CAGAGGAAGCAGGAACATGAGGG + Intronic
1184087910 22:42276549-42276571 CCCAGGAATCTTGACGCTGAAGG - Intronic
949194807 3:1291960-1291982 CAAAGGAATGTTGAGGCTGAAGG + Intronic
949300900 3:2582694-2582716 GAGAGTGATCTTGAAGATGCAGG + Intronic
950815224 3:15694225-15694247 TAGAGGAATCTTAAAGTGGAAGG + Intronic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
952461945 3:33536719-33536741 GAGAGAAATGATGAAGATGATGG + Intronic
953049207 3:39325411-39325433 CAGAGAAATCTTTATGATTAAGG - Intergenic
953457134 3:43052362-43052384 CAGAGGAATAGAGAAGGTGAAGG - Intronic
953970340 3:47342350-47342372 CACAGGAATGTTGATGGTGAGGG + Intronic
955023529 3:55144671-55144693 CAGAGGACTGGAGAAGATGATGG + Intergenic
955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG + Intergenic
958736664 3:98017003-98017025 AACAGGAAGCTTGAAGATAAGGG + Intronic
958857887 3:99408717-99408739 CAGAGGAATTTGGTACATGAGGG + Intergenic
958966325 3:100562859-100562881 CAGAGGAAGCTTCCAGAAGAAGG + Intronic
958983565 3:100753903-100753925 CAGTGGCATGGTGAAGATGATGG + Intronic
960097769 3:113704179-113704201 CAAAAGTATCTTGAAGTTGATGG - Intergenic
960216658 3:115047345-115047367 CAGAGGAATCAGGAAGAAAAAGG + Intronic
961001252 3:123375526-123375548 CAGAGCAATCTGGAGAATGAGGG + Intronic
961934547 3:130569477-130569499 CAGAGGCATTCTGAAAATGAAGG + Intronic
962482427 3:135809282-135809304 CAGAGGCATCTGGAAGCTGTGGG + Intergenic
963497900 3:146091893-146091915 CAGGAGAATCTTGTAAATGAAGG + Exonic
964451065 3:156813899-156813921 GCGTGGAATCTTGAAGATAAGGG - Intergenic
964551392 3:157888724-157888746 CAGAGCAAACTTGATAATGAGGG - Intergenic
966555185 3:181251167-181251189 CAGAGGAATGGTGAGAATGAGGG - Intergenic
966604684 3:181810420-181810442 CAGACAAATCCTGAATATGAGGG - Intergenic
967273919 3:187754632-187754654 CAGAGAAATTTTGAATATGGGGG - Intergenic
967498731 3:190172387-190172409 AATAGGAATTTTGAAAATGAGGG + Intergenic
967516716 3:190378255-190378277 GAGAAGATCCTTGAAGATGAAGG + Intronic
969289241 4:6228080-6228102 CACAGAAATCATGAAGATGCTGG + Intergenic
971723828 4:30282552-30282574 CAGAGACATGATGAAGATGAAGG - Intergenic
972417987 4:38861502-38861524 CAGAAGAATAATGAAGAGGATGG - Intergenic
972985168 4:44754597-44754619 CAGAGGAGTCTTTGAGGTGAGGG - Intergenic
973087379 4:46082529-46082551 GAGATCAATTTTGAAGATGAAGG + Intronic
973692760 4:53455349-53455371 ATGAGGAAGCTTGAAGAGGAAGG - Intronic
973812297 4:54583356-54583378 AAGGGGAATCTTGAATTTGAGGG + Intergenic
973936493 4:55851878-55851900 CAGAGGTCTCTTCAAGGTGATGG - Intergenic
977294453 4:95195078-95195100 CAGTGGCATTTTGAAGATAATGG - Intronic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
977748103 4:100575889-100575911 CAGTGGAAAGTTAAAGATGAGGG + Intronic
980185258 4:129453234-129453256 CAGTGGACACTTGAATATGAAGG - Intergenic
982580153 4:157167230-157167252 CAGAGAAATCTTTAAAATCAAGG - Intronic
983086796 4:163455727-163455749 CAGAGGAAAGTTGAATAGGAAGG - Intergenic
984781812 4:183533320-183533342 CACAGGCAATTTGAAGATGAGGG - Intergenic
985231007 4:187817491-187817513 AAGATGAATATTTAAGATGATGG - Intergenic
985826227 5:2193518-2193540 CATTGGAATCTAGAAGATGAGGG - Intergenic
985952053 5:3229775-3229797 CAGAGAAATTTTGAAAATCAGGG + Intergenic
987485096 5:18516317-18516339 CAGTGGTTTCTTAAAGATGAGGG - Intergenic
988976771 5:36523858-36523880 CAAGGGAAACATGAAGATGAAGG - Intergenic
990111175 5:52327275-52327297 CATAATAAACTTGAAGATGAGGG + Intergenic
990156554 5:52884539-52884561 AAGAGGAACCTTTATGATGAAGG + Intronic
990620669 5:57555461-57555483 GAGATGCATCTTGAAGATGAAGG - Intergenic
992939291 5:81747701-81747723 CTGAGGTATCTTGAACATTAAGG - Intronic
994716089 5:103323226-103323248 CAGAGGAATGTCTGAGATGAGGG + Intergenic
995314550 5:110753257-110753279 GAGAGGTAACTGGAAGATGAGGG + Intronic
995710426 5:115029901-115029923 CAGAGGTAGCTGGAAGCTGAAGG - Intergenic
997276078 5:132592240-132592262 CAGAAGAGTCTTGAACTTGATGG - Intronic
998890454 5:146740290-146740312 GAAAAGAATCTTGGAGATGATGG + Intronic
999223300 5:149999593-149999615 CTGAGGAATCCAGCAGATGATGG + Intronic
999627170 5:153533080-153533102 AAGAGGAATGTTGAATATGGGGG - Intronic
999995250 5:157086303-157086325 CAAGGGAATCTTCAAGATCAAGG + Exonic
1000282720 5:159795956-159795978 CAGAGGGATATTTAACATGAAGG + Intergenic
1003094581 6:3132283-3132305 CAGAGAAAGCTTCAAGAAGAGGG - Intronic
1004470743 6:15926897-15926919 CAGAGCAATACTCAAGATGAAGG + Intergenic
1004863069 6:19825707-19825729 AAGAGGCATCTTGGTGATGAAGG - Intergenic
1006152673 6:31997749-31997771 CAAAGGAACCCTGAAGGTGAGGG + Exonic
1006158981 6:32030486-32030508 CAAAGGAACCCTGAAGGTGAGGG + Exonic
1006295804 6:33169520-33169542 CCAGGGAATCTTGAAGATCAGGG + Intronic
1006756866 6:36423687-36423709 CAGTGGTATCATAAAGATGAAGG + Intronic
1006820505 6:36890095-36890117 AGGAGGAAACTTGAAGGTGATGG - Intronic
1007017467 6:38483128-38483150 CAGAGAAATGATGAAGAGGATGG - Intronic
1007549135 6:42715778-42715800 CAGGGGAATCTTTAAGATCCAGG - Intronic
1008178787 6:48302019-48302041 CAGAGGCATATAGAAGAGGAAGG + Intergenic
1008934783 6:56978489-56978511 CAAAACAATCTTGAAGAAGAAGG - Intronic
1009394839 6:63187575-63187597 CAGTGGAAAGGTGAAGATGAAGG - Intergenic
1009721896 6:67482503-67482525 AAGAGGAATCTATAAGATTAGGG + Intergenic
1010289303 6:74116680-74116702 CAGAAGGATCCTGAAGCTGAGGG - Intergenic
1010773639 6:79861086-79861108 CAGAGGAATCTGGAAAATCGAGG - Intergenic
1010871096 6:81041125-81041147 CAAAGCAATCTTGAATATGAAGG + Intergenic
1011092583 6:83622224-83622246 CAGAGCAATCCAGAACATGATGG - Intronic
1011938452 6:92812313-92812335 CAGAGGAAACTTGTTGCTGAAGG + Intergenic
1012400744 6:98841457-98841479 CAGAGGTGTCTTTAAGATAAAGG - Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1017539843 6:155389713-155389735 CAGAGGATTCTGGAAGAGAATGG + Intergenic
1019447824 7:1080556-1080578 CAGAGGAGTCTGGAACAGGACGG + Intronic
1021470981 7:21002375-21002397 CAGAGGAAGCTTCAAAATGGCGG + Intergenic
1021996359 7:26181530-26181552 CCGAGGATTCTTGATGGTGATGG - Intronic
1022454860 7:30549701-30549723 CAGAGGAATCATCAAGAACAGGG - Intronic
1027785260 7:82572574-82572596 CAGGAGAATATTGGAGATGAAGG + Intergenic
1027823752 7:83084013-83084035 CAGAGGAAAGATGAAGATGAAGG + Intronic
1028094992 7:86749202-86749224 CAGAGGAAAGCTGAAGATCAGGG - Intronic
1028257459 7:88617302-88617324 CAGAGTCATCTGGAAGATGGAGG + Intergenic
1033664297 7:143426047-143426069 CAGAAAAATCATGAAGTTGATGG - Intergenic
1036076840 8:5511991-5512013 CAGAGGAGTCATGATGATGGAGG + Intergenic
1036112481 8:5919138-5919160 GGGAGGAAACTTGAAGGTGATGG - Intergenic
1037355110 8:18010612-18010634 AAAAGGATTCTTGAAGATCATGG + Exonic
1037588139 8:20292149-20292171 CTGAGGAATCTTCCAGAGGAAGG + Intronic
1037651271 8:20840844-20840866 CTGAGGAATGTTGAGCATGAAGG + Intergenic
1037981925 8:23260483-23260505 CAGGAAAATCTTGAAGATGAAGG - Intronic
1038681731 8:29674845-29674867 CAGTGGAGTGTTGAAGGTGAAGG + Intergenic
1038687269 8:29729876-29729898 CTTGGGAATCTTTAAGATGAAGG - Intergenic
1038779003 8:30555261-30555283 CAGAGCATTCCTGAAGAAGAGGG + Intronic
1038854759 8:31319484-31319506 CAAAGGAGACTGGAAGATGAGGG - Intergenic
1040837316 8:51746178-51746200 GAAAGAATTCTTGAAGATGAGGG - Intronic
1041738049 8:61132314-61132336 CAGGGGAATCCTGGAGATGAGGG + Intronic
1041866375 8:62579070-62579092 AAGAGGAATGTTTAAGGTGATGG + Intronic
1042220674 8:66470644-66470666 CAGGAGAATCCTGGAGATGAGGG + Intronic
1042266308 8:66912020-66912042 CAGAGGAATCATGACAGTGATGG - Intronic
1043609211 8:82041463-82041485 CAGAAGAAGCTTGAAGCTGGAGG + Intergenic
1043969691 8:86515135-86515157 CAGAAGAATCTTGAAGCTGGAGG - Intronic
1044795406 8:95892081-95892103 AAAAGGAATCTTGAATATCATGG - Intergenic
1046285543 8:112088561-112088583 CAGAGGCACCATGAAGGTGAAGG - Intergenic
1046393206 8:113603848-113603870 CAGAGGACTCTGGGAGATCATGG - Intronic
1046666889 8:117014146-117014168 CACATGAATGCTGAAGATGAGGG + Intronic
1047047232 8:121067910-121067932 TAGAGGAATCTAGCAGAAGAAGG + Intergenic
1047058035 8:121189829-121189851 CAGAGAAATGCTGATGATGATGG - Intergenic
1047633681 8:126735865-126735887 AAGAGGAGTGTTGAAGATAAAGG - Intergenic
1047750768 8:127878803-127878825 CACAGGCATCTTGCAGATGAGGG + Intergenic
1047988779 8:130264047-130264069 CAGAGGATTCCTAAATATGATGG + Intronic
1050115489 9:2259103-2259125 CAGAGGATTCATGGAGATAACGG + Intergenic
1050397312 9:5213093-5213115 GAGAGGGATCTGGAAGATGTTGG + Intergenic
1050399648 9:5238632-5238654 AAGAGGAATTTGGAAGATGTTGG + Intergenic
1050596511 9:7209848-7209870 CAGGGGATCCTTGGAGATGAAGG - Intergenic
1050775831 9:9259131-9259153 AAGAGGACACTTGAAGATCAGGG + Intronic
1051352087 9:16206426-16206448 CAGAGAAATCTAGAAGCTAAAGG - Intronic
1051505653 9:17824878-17824900 CAGAGAAATCTCAGAGATGAAGG + Intergenic
1051979899 9:23001162-23001184 CAGAGAAATCATGCAGATCAAGG + Intergenic
1052077683 9:24163852-24163874 GGGAGGAATTTTAAAGATGATGG - Intergenic
1052270039 9:26618203-26618225 CAGAGGAAGAATGTAGATGAAGG - Intergenic
1052934182 9:34079376-34079398 CATAGGATTCTCAAAGATGATGG - Intergenic
1058449572 9:105083603-105083625 CACAGGAATCCAGAAGATGGAGG - Intergenic
1060120601 9:120986033-120986055 CAGAGGGATTTTAAAGAGGAAGG - Intronic
1060284904 9:122241881-122241903 CATGGAAATCTCGAAGATGATGG - Exonic
1061442324 9:130614261-130614283 AAGAAGAATCAAGAAGATGAGGG - Intronic
1186066212 X:5767761-5767783 CAGAGAAACATTGAAGATGTTGG - Intergenic
1186536299 X:10352375-10352397 CACAGGCTTCTTGAAAATGAGGG + Intergenic
1188026455 X:25215329-25215351 CAGGGGAATCTAGAAGACAATGG - Intergenic
1188347960 X:29091213-29091235 GAGAGGATTGTTGAAGATGCAGG - Intronic
1188596835 X:31911726-31911748 GATAAGAGTCTTGAAGATGAGGG + Intronic
1189440718 X:41033254-41033276 CAGAGGTTTATTGAAAATGAAGG + Intergenic
1190776997 X:53560702-53560724 GAGAGGAGTCTTCAAGGTGAAGG - Intronic
1192835607 X:74795565-74795587 CAGAGGAATTTTGAGAGTGATGG + Intronic
1193254954 X:79337267-79337289 CAGGGGAAGCTTGAAGCAGAGGG - Intergenic
1196381140 X:115091127-115091149 CTGAGGTCTCTTAAAGATGAGGG + Intergenic
1197730257 X:129803790-129803812 CATAGGAAGCTTGAGGAAGAAGG + Exonic
1200149588 X:153944700-153944722 CAGCGGAACCCTGAAGAGGAGGG - Intergenic
1201938265 Y:19431304-19431326 CAGATGATTCTGGAAGTTGAAGG - Intergenic