ID: 1078680292

View in Genome Browser
Species Human (GRCh38)
Location 11:13469446-13469468
Sequence GTGAAGAACCAGACCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078680292_1078680298 4 Left 1078680292 11:13469446-13469468 CCCTCAGTGGTCTGGTTCTTCAC No data
Right 1078680298 11:13469473-13469495 GAACCAAAGGCCCTTGGCCAAGG No data
1078680292_1078680297 -2 Left 1078680292 11:13469446-13469468 CCCTCAGTGGTCTGGTTCTTCAC No data
Right 1078680297 11:13469467-13469489 ACTTGGGAACCAAAGGCCCTTGG No data
1078680292_1078680296 -9 Left 1078680292 11:13469446-13469468 CCCTCAGTGGTCTGGTTCTTCAC No data
Right 1078680296 11:13469460-13469482 GTTCTTCACTTGGGAACCAAAGG No data
1078680292_1078680303 30 Left 1078680292 11:13469446-13469468 CCCTCAGTGGTCTGGTTCTTCAC No data
Right 1078680303 11:13469499-13469521 AGATCCTGAAGCCCTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078680292 Original CRISPR GTGAAGAACCAGACCACTGA GGG (reversed) Intergenic
No off target data available for this crispr