ID: 1078682221

View in Genome Browser
Species Human (GRCh38)
Location 11:13487503-13487525
Sequence GCAGCTGGTGGGCCGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078682221_1078682226 -7 Left 1078682221 11:13487503-13487525 CCAACTTGCGGCCCACCAGCTGC No data
Right 1078682226 11:13487519-13487541 CAGCTGCATACAACTCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078682221 Original CRISPR GCAGCTGGTGGGCCGCAAGT TGG (reversed) Intergenic
No off target data available for this crispr