ID: 1078689595

View in Genome Browser
Species Human (GRCh38)
Location 11:13565739-13565761
Sequence GCTTCCTACTCTTCTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078689595_1078689598 15 Left 1078689595 11:13565739-13565761 CCAGTTCCAGAAGAGTAGGAAGC No data
Right 1078689598 11:13565777-13565799 TGAACCTTCTGTTAATCTAGAGG No data
1078689595_1078689600 21 Left 1078689595 11:13565739-13565761 CCAGTTCCAGAAGAGTAGGAAGC No data
Right 1078689600 11:13565783-13565805 TTCTGTTAATCTAGAGGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078689595 Original CRISPR GCTTCCTACTCTTCTGGAAC TGG (reversed) Intergenic
No off target data available for this crispr