ID: 1078690774

View in Genome Browser
Species Human (GRCh38)
Location 11:13578687-13578709
Sequence TGTGACACGTGGTCACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078690774_1078690780 16 Left 1078690774 11:13578687-13578709 CCTGGCAGTGACCACGTGTCACA No data
Right 1078690780 11:13578726-13578748 ACTTGGGTGAGGGAGAGTGCAGG No data
1078690774_1078690777 0 Left 1078690774 11:13578687-13578709 CCTGGCAGTGACCACGTGTCACA No data
Right 1078690777 11:13578710-13578732 GAGAGAGAATCTGTGCACTTGGG 0: 35
1: 86
2: 137
3: 239
4: 558
1078690774_1078690783 25 Left 1078690774 11:13578687-13578709 CCTGGCAGTGACCACGTGTCACA No data
Right 1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG No data
1078690774_1078690781 17 Left 1078690774 11:13578687-13578709 CCTGGCAGTGACCACGTGTCACA No data
Right 1078690781 11:13578727-13578749 CTTGGGTGAGGGAGAGTGCAGGG No data
1078690774_1078690778 5 Left 1078690774 11:13578687-13578709 CCTGGCAGTGACCACGTGTCACA No data
Right 1078690778 11:13578715-13578737 AGAATCTGTGCACTTGGGTGAGG No data
1078690774_1078690782 24 Left 1078690774 11:13578687-13578709 CCTGGCAGTGACCACGTGTCACA No data
Right 1078690782 11:13578734-13578756 GAGGGAGAGTGCAGGGATTGCGG No data
1078690774_1078690776 -1 Left 1078690774 11:13578687-13578709 CCTGGCAGTGACCACGTGTCACA No data
Right 1078690776 11:13578709-13578731 AGAGAGAGAATCTGTGCACTTGG No data
1078690774_1078690779 6 Left 1078690774 11:13578687-13578709 CCTGGCAGTGACCACGTGTCACA No data
Right 1078690779 11:13578716-13578738 GAATCTGTGCACTTGGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078690774 Original CRISPR TGTGACACGTGGTCACTGCC AGG (reversed) Intergenic
No off target data available for this crispr