ID: 1078690783

View in Genome Browser
Species Human (GRCh38)
Location 11:13578735-13578757
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078690774_1078690783 25 Left 1078690774 11:13578687-13578709 CCTGGCAGTGACCACGTGTCACA No data
Right 1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG No data
1078690775_1078690783 14 Left 1078690775 11:13578698-13578720 CCACGTGTCACAGAGAGAGAATC No data
Right 1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078690783 Original CRISPR AGGGAGAGTGCAGGGATTGC GGG Intergenic
No off target data available for this crispr