ID: 1078698449

View in Genome Browser
Species Human (GRCh38)
Location 11:13658472-13658494
Sequence CTGAGATCCCTGGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078698449_1078698454 -9 Left 1078698449 11:13658472-13658494 CCTGTTTTTCCCAGGGATCTCAG No data
Right 1078698454 11:13658486-13658508 GGATCTCAGGTGACATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078698449 Original CRISPR CTGAGATCCCTGGGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr