ID: 1078707411

View in Genome Browser
Species Human (GRCh38)
Location 11:13758543-13758565
Sequence CAGCTAGATCAGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078707411_1078707415 -3 Left 1078707411 11:13758543-13758565 CCATCTTCCCTCTGATCTAGCTG No data
Right 1078707415 11:13758563-13758585 CTGCGATCTCCTCTATTGGATGG No data
1078707411_1078707421 9 Left 1078707411 11:13758543-13758565 CCATCTTCCCTCTGATCTAGCTG No data
Right 1078707421 11:13758575-13758597 CTATTGGATGGGTTGTTTGGGGG No data
1078707411_1078707418 6 Left 1078707411 11:13758543-13758565 CCATCTTCCCTCTGATCTAGCTG No data
Right 1078707418 11:13758572-13758594 CCTCTATTGGATGGGTTGTTTGG No data
1078707411_1078707419 7 Left 1078707411 11:13758543-13758565 CCATCTTCCCTCTGATCTAGCTG No data
Right 1078707419 11:13758573-13758595 CTCTATTGGATGGGTTGTTTGGG No data
1078707411_1078707414 -7 Left 1078707411 11:13758543-13758565 CCATCTTCCCTCTGATCTAGCTG No data
Right 1078707414 11:13758559-13758581 CTAGCTGCGATCTCCTCTATTGG No data
1078707411_1078707420 8 Left 1078707411 11:13758543-13758565 CCATCTTCCCTCTGATCTAGCTG No data
Right 1078707420 11:13758574-13758596 TCTATTGGATGGGTTGTTTGGGG No data
1078707411_1078707416 -2 Left 1078707411 11:13758543-13758565 CCATCTTCCCTCTGATCTAGCTG No data
Right 1078707416 11:13758564-13758586 TGCGATCTCCTCTATTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078707411 Original CRISPR CAGCTAGATCAGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr