ID: 1078713981

View in Genome Browser
Species Human (GRCh38)
Location 11:13822001-13822023
Sequence CAGGGGAATCAGGCAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078713981_1078713990 12 Left 1078713981 11:13822001-13822023 CCTTCTTCTGCCTGATTCCCCTG No data
Right 1078713990 11:13822036-13822058 AACACTATGTTGAATAGGAGTGG 0: 8383
1: 5167
2: 3784
3: 3774
4: 4310
1078713981_1078713988 7 Left 1078713981 11:13822001-13822023 CCTTCTTCTGCCTGATTCCCCTG No data
Right 1078713988 11:13822031-13822053 CTTCCAACACTATGTTGAATAGG 0: 8499
1: 5117
2: 3568
3: 2773
4: 2158
1078713981_1078713992 22 Left 1078713981 11:13822001-13822023 CCTTCTTCTGCCTGATTCCCCTG No data
Right 1078713992 11:13822046-13822068 TGAATAGGAGTGGTGAGAGAGGG 0: 10185
1: 5655
2: 3179
3: 2674
4: 3101
1078713981_1078713991 21 Left 1078713981 11:13822001-13822023 CCTTCTTCTGCCTGATTCCCCTG No data
Right 1078713991 11:13822045-13822067 TTGAATAGGAGTGGTGAGAGAGG 0: 10545
1: 6573
2: 4267
3: 3542
4: 3345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078713981 Original CRISPR CAGGGGAATCAGGCAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr