ID: 1078715798

View in Genome Browser
Species Human (GRCh38)
Location 11:13838023-13838045
Sequence CAGAATTTCTGCAATCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078715798_1078715802 -10 Left 1078715798 11:13838023-13838045 CCTTGCTGATTGCAGAAATTCTG No data
Right 1078715802 11:13838036-13838058 AGAAATTCTGGCCTATCATGGGG No data
1078715798_1078715803 -9 Left 1078715798 11:13838023-13838045 CCTTGCTGATTGCAGAAATTCTG No data
Right 1078715803 11:13838037-13838059 GAAATTCTGGCCTATCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078715798 Original CRISPR CAGAATTTCTGCAATCAGCA AGG (reversed) Intergenic
No off target data available for this crispr