ID: 1078718385

View in Genome Browser
Species Human (GRCh38)
Location 11:13860932-13860954
Sequence TCTGGGGATGCCTAGTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078718385_1078718399 17 Left 1078718385 11:13860932-13860954 CCCATGCACTAGGCATCCCCAGA No data
Right 1078718399 11:13860972-13860994 GCACTGCACCTTAAGGATGAGGG No data
1078718385_1078718390 -6 Left 1078718385 11:13860932-13860954 CCCATGCACTAGGCATCCCCAGA No data
Right 1078718390 11:13860949-13860971 CCCAGACCCAAGCCTGGCCATGG No data
1078718385_1078718392 -5 Left 1078718385 11:13860932-13860954 CCCATGCACTAGGCATCCCCAGA No data
Right 1078718392 11:13860950-13860972 CCAGACCCAAGCCTGGCCATGGG No data
1078718385_1078718400 22 Left 1078718385 11:13860932-13860954 CCCATGCACTAGGCATCCCCAGA No data
Right 1078718400 11:13860977-13860999 GCACCTTAAGGATGAGGGAGAGG No data
1078718385_1078718396 10 Left 1078718385 11:13860932-13860954 CCCATGCACTAGGCATCCCCAGA No data
Right 1078718396 11:13860965-13860987 GCCATGGGCACTGCACCTTAAGG No data
1078718385_1078718398 16 Left 1078718385 11:13860932-13860954 CCCATGCACTAGGCATCCCCAGA No data
Right 1078718398 11:13860971-13860993 GGCACTGCACCTTAAGGATGAGG No data
1078718385_1078718402 30 Left 1078718385 11:13860932-13860954 CCCATGCACTAGGCATCCCCAGA No data
Right 1078718402 11:13860985-13861007 AGGATGAGGGAGAGGATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078718385 Original CRISPR TCTGGGGATGCCTAGTGCAT GGG (reversed) Intergenic
No off target data available for this crispr