ID: 1078720657

View in Genome Browser
Species Human (GRCh38)
Location 11:13880678-13880700
Sequence CAAGGTAATGAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078720657_1078720663 8 Left 1078720657 11:13880678-13880700 CCAGCTTCCCTCTCATTACCTTG No data
Right 1078720663 11:13880709-13880731 TTTTGCACTGCTTAGTCTCTGGG No data
1078720657_1078720662 7 Left 1078720657 11:13880678-13880700 CCAGCTTCCCTCTCATTACCTTG No data
Right 1078720662 11:13880708-13880730 CTTTTGCACTGCTTAGTCTCTGG No data
1078720657_1078720664 20 Left 1078720657 11:13880678-13880700 CCAGCTTCCCTCTCATTACCTTG No data
Right 1078720664 11:13880721-13880743 TAGTCTCTGGGTTGACCATTAGG No data
1078720657_1078720665 28 Left 1078720657 11:13880678-13880700 CCAGCTTCCCTCTCATTACCTTG No data
Right 1078720665 11:13880729-13880751 GGGTTGACCATTAGGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078720657 Original CRISPR CAAGGTAATGAGAGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr