ID: 1078729246

View in Genome Browser
Species Human (GRCh38)
Location 11:13961123-13961145
Sequence GATCCATGTCTGAGTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078729246_1078729253 13 Left 1078729246 11:13961123-13961145 CCCTCAGCACTCAGACATGGATC No data
Right 1078729253 11:13961159-13961181 AAAAAGGAGGGCCGATCAGCTGG No data
1078729246_1078729256 29 Left 1078729246 11:13961123-13961145 CCCTCAGCACTCAGACATGGATC No data
Right 1078729256 11:13961175-13961197 CAGCTGGATCAGGTGCTGCTAGG No data
1078729246_1078729248 -3 Left 1078729246 11:13961123-13961145 CCCTCAGCACTCAGACATGGATC No data
Right 1078729248 11:13961143-13961165 ATCTGAGCCTCACCTCAAAAAGG No data
1078729246_1078729254 19 Left 1078729246 11:13961123-13961145 CCCTCAGCACTCAGACATGGATC No data
Right 1078729254 11:13961165-13961187 GAGGGCCGATCAGCTGGATCAGG No data
1078729246_1078729250 1 Left 1078729246 11:13961123-13961145 CCCTCAGCACTCAGACATGGATC No data
Right 1078729250 11:13961147-13961169 GAGCCTCACCTCAAAAAGGAGGG No data
1078729246_1078729249 0 Left 1078729246 11:13961123-13961145 CCCTCAGCACTCAGACATGGATC No data
Right 1078729249 11:13961146-13961168 TGAGCCTCACCTCAAAAAGGAGG No data
1078729246_1078729257 30 Left 1078729246 11:13961123-13961145 CCCTCAGCACTCAGACATGGATC No data
Right 1078729257 11:13961176-13961198 AGCTGGATCAGGTGCTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078729246 Original CRISPR GATCCATGTCTGAGTGCTGA GGG (reversed) Intergenic
No off target data available for this crispr