ID: 1078729435

View in Genome Browser
Species Human (GRCh38)
Location 11:13962449-13962471
Sequence CAGAGGGTCCGGAGTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078729427_1078729435 -2 Left 1078729427 11:13962428-13962450 CCTCCTCTGAGCGCCGTCCTCCA No data
Right 1078729435 11:13962449-13962471 CAGAGGGTCCGGAGTGTAGCTGG No data
1078729428_1078729435 -5 Left 1078729428 11:13962431-13962453 CCTCTGAGCGCCGTCCTCCAGAG No data
Right 1078729435 11:13962449-13962471 CAGAGGGTCCGGAGTGTAGCTGG No data
1078729426_1078729435 -1 Left 1078729426 11:13962427-13962449 CCCTCCTCTGAGCGCCGTCCTCC No data
Right 1078729435 11:13962449-13962471 CAGAGGGTCCGGAGTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078729435 Original CRISPR CAGAGGGTCCGGAGTGTAGC TGG Intergenic
No off target data available for this crispr