ID: 1078730563

View in Genome Browser
Species Human (GRCh38)
Location 11:13970411-13970433
Sequence CTCAACCACAACTGTAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078730563_1078730570 20 Left 1078730563 11:13970411-13970433 CCCTCTCTACAGTTGTGGTTGAG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1078730570 11:13970454-13970476 TGGACTGGGTGAGAGAAACAGGG 0: 1
1: 0
2: 0
3: 33
4: 311
1078730563_1078730569 19 Left 1078730563 11:13970411-13970433 CCCTCTCTACAGTTGTGGTTGAG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1078730569 11:13970453-13970475 ATGGACTGGGTGAGAGAAACAGG 0: 1
1: 0
2: 0
3: 26
4: 263
1078730563_1078730566 5 Left 1078730563 11:13970411-13970433 CCCTCTCTACAGTTGTGGTTGAG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1078730566 11:13970439-13970461 TGCCAATATGTCTCATGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1078730563_1078730567 6 Left 1078730563 11:13970411-13970433 CCCTCTCTACAGTTGTGGTTGAG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1078730567 11:13970440-13970462 GCCAATATGTCTCATGGACTGGG 0: 1
1: 0
2: 1
3: 7
4: 113
1078730563_1078730565 0 Left 1078730563 11:13970411-13970433 CCCTCTCTACAGTTGTGGTTGAG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1078730565 11:13970434-13970456 ATATTTGCCAATATGTCTCATGG 0: 1
1: 0
2: 1
3: 19
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078730563 Original CRISPR CTCAACCACAACTGTAGAGA GGG (reversed) Intronic
908029769 1:59986982-59987004 CAGAAGCACAACTGTAGAGATGG - Intergenic
909556847 1:76963678-76963700 GTCTACCACAAATGTAGAGGTGG - Intronic
909832880 1:80215471-80215493 CTCCACCAAAACTGTAGTTAAGG - Intergenic
912488534 1:110048170-110048192 CTCAATCACAGCTGGAGAGTGGG - Intronic
913479725 1:119276316-119276338 CTCTACCACACCTGCAGAAATGG + Intergenic
914973171 1:152330195-152330217 CTCAAGTACAACTACAGAGATGG + Intergenic
915317672 1:155038500-155038522 CTCTACCACGACAGTGGAGATGG + Intronic
924533138 1:244910348-244910370 CTGAACAGCAACTATAGAGAAGG + Intergenic
1064462091 10:15544884-15544906 CTCAAGCAGCACTGTGGAGAGGG + Intronic
1064733220 10:18354631-18354653 CTCAATTACAACTATAGGGATGG + Intronic
1068817200 10:61330793-61330815 CTCAATCACGTCAGTAGAGAGGG - Intergenic
1069338683 10:67385267-67385289 GTCAACCACAAGTGTGCAGATGG - Intronic
1070653771 10:78256692-78256714 CTCAACAACGACATTAGAGAAGG + Intergenic
1072135400 10:92540696-92540718 CCAAACCACAACTGTGTAGAGGG + Intronic
1077716571 11:4587217-4587239 CTTAGCCACAGCTGTGGAGACGG + Exonic
1077717266 11:4594365-4594387 CTTAGCCACAGCTGTGGAGACGG + Exonic
1078730563 11:13970411-13970433 CTCAACCACAACTGTAGAGAGGG - Intronic
1081210453 11:40326937-40326959 TTCAAACACAGCTGTAGAAATGG + Intronic
1081307788 11:41534758-41534780 CTCAACCACAGGAGAAGAGATGG - Intergenic
1087919095 11:103845909-103845931 CTCAACTACCAGTGTAGGGAGGG + Intergenic
1089179039 11:116568174-116568196 CTCTGGCAAAACTGTAGAGACGG + Intergenic
1095140231 12:38653705-38653727 CTAAACCAAAACTGTAAATATGG - Exonic
1108956121 13:56159608-56159630 CTCAACCCCAAATTTATAGAAGG + Intergenic
1122042144 14:98996374-98996396 CCCAACAACAACTTTAGAGGTGG + Intergenic
1122858814 14:104572991-104573013 CTCAACCACCTCAGTAGAGAGGG - Intronic
1124043569 15:26126901-26126923 CTCAACTTGAACTGTAGAGCTGG + Intergenic
1124362007 15:29044559-29044581 CCCAGCCCCCACTGTAGAGATGG + Intronic
1127089273 15:55450646-55450668 CTCTACATCAACTCTAGAGAAGG + Intronic
1127360378 15:58240006-58240028 CTCAACCAAAACAATAGAGCTGG - Intronic
1129290454 15:74562960-74562982 CTAAACGACAACTCTAGAAAAGG - Intronic
1130162066 15:81411568-81411590 TTCAACAATAACTGTAGGGAGGG - Intergenic
1135387373 16:22055091-22055113 CTCAAAAACAAATGGAGAGAAGG - Intronic
1137614906 16:49840406-49840428 CACAACCACAACTTTACACATGG + Intronic
1140611419 16:76603453-76603475 CTAAACCTGAACTCTAGAGAAGG - Intronic
1141778510 16:86140917-86140939 CTCACTCATTACTGTAGAGAAGG + Intergenic
1143571214 17:7759921-7759943 CTCACCCACAACTGTTTGGATGG - Exonic
1144452145 17:15389974-15389996 CCCAACCAAAACTCTAGAAATGG + Intergenic
1146653863 17:34623652-34623674 CACCACCACAACTTTAGAGGTGG + Intronic
1157248541 18:46073497-46073519 GTCATCCACAACTGCAAAGATGG + Intergenic
1158333313 18:56386784-56386806 CTCAACCCCAGCTTTACAGAAGG - Intergenic
1160215788 18:76929031-76929053 CTGAAACACACCTGTGGAGAAGG + Intronic
1163820432 19:19493443-19493465 CTCAGCCCCAACTGTCGGGAGGG + Intronic
1167904949 19:52651511-52651533 CTCAACCATCTCTGTGGAGAGGG + Intronic
926469921 2:13241831-13241853 CTCTACCACAACTGAAGTAATGG + Intergenic
928063973 2:28144606-28144628 CTCAATAAAAACTTTAGAGAAGG - Intronic
933751689 2:85606502-85606524 TTCAGACACATCTGTAGAGAGGG + Intronic
936716389 2:115191760-115191782 CTCATCCAAAGCTGGAGAGAAGG - Intronic
937527808 2:122792308-122792330 TTCAACAACTACAGTAGAGAAGG - Intergenic
937538568 2:122921791-122921813 CTAAACCACAACTTGAGTGATGG + Intergenic
940154578 2:150641146-150641168 CTCAAACAAAACAGTTGAGAGGG - Intergenic
945423485 2:209668766-209668788 CTCAGCCACAACCCAAGAGAAGG - Intronic
947349910 2:229232538-229232560 CTCAACCACGTATGCAGAGAAGG + Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1172099925 20:32479201-32479223 GTCAACGACAACTGTGCAGAGGG + Intronic
1172787097 20:37475596-37475618 CTCAACCAGAGCTGCAGAGTTGG - Intergenic
1174185694 20:48704420-48704442 CTCACCCACAAGGGGAGAGAAGG - Intronic
1175697729 20:61115026-61115048 TTCAACATCGACTGTAGAGAAGG - Intergenic
1179803585 21:43823732-43823754 CTCAACCACATCTGGAGGGAAGG - Intergenic
1181108960 22:20590394-20590416 CTCAGCAACAACTGTGGGGATGG - Intergenic
953861645 3:46549359-46549381 CTCAAAAACACCTGTAAAGAAGG + Intronic
954893811 3:53958181-53958203 CTCGACCACACCGCTAGAGATGG - Intergenic
956240574 3:67125797-67125819 CTGAGCCACAACTGTAGAAATGG + Intergenic
959017443 3:101151352-101151374 CTCAGCCACAACTGTAATGGTGG + Intergenic
960436907 3:117637270-117637292 ATCAACCATAATTTTAGAGAGGG + Intergenic
961189366 3:124945049-124945071 CTCAAACACAGCAGTAGGGAAGG + Intronic
962212316 3:133489677-133489699 CACAACCAGAATTGCAGAGACGG + Intergenic
965710577 3:171552900-171552922 CTGAAACACAATGGTAGAGAGGG + Intergenic
968111323 3:196049605-196049627 CTCAACCCTAACTGTAGAAAAGG + Exonic
975534397 4:75434143-75434165 CTCATCCAGATCTCTAGAGAAGG - Intergenic
978245272 4:106564267-106564289 CTCAATCACATCTGTGGAGCTGG - Intergenic
981432494 4:144677561-144677583 CTCAGCCACAAGTGTGGAAAGGG + Intronic
982304611 4:153917348-153917370 TTCAACCACAAGGGTAGAGTAGG + Intergenic
984463568 4:180068731-180068753 GTGAACCACAACTGTATAGAGGG - Intergenic
984958604 4:185071618-185071640 CTGAGCCGCAGCTGTAGAGAGGG - Intergenic
990698398 5:58448367-58448389 CACAACCACAGCTGTAGACCGGG + Intergenic
993538878 5:89123220-89123242 CCCAACCACATCAGTAGAGCGGG - Intergenic
993775257 5:91986784-91986806 CTCAAACAAACCTGCAGAGAGGG - Intergenic
994921006 5:106043171-106043193 CTCACCCACTACTGTAGGGAGGG + Intergenic
996432427 5:123396615-123396637 CTCATGCACAACTGAAAAGATGG + Intronic
1008243518 6:49142796-49142818 TTTAACTACAACTGTAGTGAAGG - Intergenic
1011163766 6:84422409-84422431 CTCAACCACTGGTGCAGAGAAGG + Intergenic
1022477577 7:30721884-30721906 CCCAGCCCCAACTGCAGAGATGG - Intronic
1024228287 7:47345090-47345112 CACAACCACAACTGTTTGGAGGG - Intronic
1028368592 7:90064244-90064266 CTCAACTACAACCATAGAGGCGG - Intergenic
1031958669 7:127968926-127968948 CTCAAGCACAACTGTGGGGGCGG - Intronic
1038879119 8:31588104-31588126 CTCCACCACAAGTATAGATATGG - Intergenic
1039678970 8:39708204-39708226 TGCAACCAAAACTGTAGATAAGG + Intronic
1040349681 8:46551600-46551622 ATCAACCACAGCAGTAGTGATGG - Intergenic
1040519292 8:48161004-48161026 CTCTACCACAGCTGTATATATGG + Intergenic
1043941785 8:86204529-86204551 ACAAACCACCACTGTAGAGACGG - Intergenic
1044561302 8:93614939-93614961 CTCACCCCCAACTGCAGAAAAGG + Intergenic
1044769330 8:95613450-95613472 CTCAACCAGCACTGAAAAGAAGG - Intergenic
1046086890 8:109448332-109448354 CTCAAATACAACTGTGGACATGG - Exonic
1046974508 8:120258848-120258870 CTCAAAAACAGCTGGAGAGAGGG - Intronic
1047207912 8:122818255-122818277 CTCAACCCCAAATAAAGAGAAGG - Intronic
1047519166 8:125581228-125581250 CTCACCCATTACTGTAGGGAGGG + Intergenic
1048268844 8:133011928-133011950 ATCAACAACCACTGAAGAGAGGG - Exonic
1051410656 9:16786667-16786689 CTGAACCCCAACTGCAGAAAGGG + Intronic
1056710047 9:88984972-88984994 CTCAGTCAAAACAGTAGAGAGGG + Intergenic
1057997457 9:99831138-99831160 CTTAAACACAAATGTAGGGAAGG + Intronic
1059081136 9:111251610-111251632 CTGCAGCACAACTGTGGAGAAGG - Intergenic
1061287397 9:129631870-129631892 CACAACCACACCTGCAGGGAGGG - Intronic
1061872626 9:133528843-133528865 CTCCCCCACAACTGTTGGGAAGG + Intergenic
1186094100 X:6081285-6081307 CTCAAAAAAAATTGTAGAGACGG + Intronic
1190475774 X:50825949-50825971 CTTCACCAAAACTGTAGTGAGGG - Intergenic
1196604256 X:117638009-117638031 CTCAAGCACAGCTGTGGAGATGG - Intergenic