ID: 1078734755

View in Genome Browser
Species Human (GRCh38)
Location 11:14009782-14009804
Sequence CTGCATCTTCATGTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 692
Summary {0: 1, 1: 2, 2: 14, 3: 95, 4: 580}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078734749_1078734755 -1 Left 1078734749 11:14009760-14009782 CCCCATACATGGCACCTTCTTGC 0: 1
1: 9
2: 33
3: 91
4: 319
Right 1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG 0: 1
1: 2
2: 14
3: 95
4: 580
1078734751_1078734755 -3 Left 1078734751 11:14009762-14009784 CCATACATGGCACCTTCTTGCTG 0: 1
1: 3
2: 5
3: 44
4: 230
Right 1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG 0: 1
1: 2
2: 14
3: 95
4: 580
1078734748_1078734755 5 Left 1078734748 11:14009754-14009776 CCTGTTCCCCATACATGGCACCT 0: 1
1: 0
2: 21
3: 91
4: 250
Right 1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG 0: 1
1: 2
2: 14
3: 95
4: 580
1078734750_1078734755 -2 Left 1078734750 11:14009761-14009783 CCCATACATGGCACCTTCTTGCT 0: 1
1: 0
2: 1
3: 21
4: 168
Right 1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG 0: 1
1: 2
2: 14
3: 95
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078734755 Original CRISPR CTGCATCTTCATGTGGAGGA AGG Intronic
900530191 1:3149273-3149295 CTTCATCTTCTTCAGGAGGAAGG - Intronic
900909211 1:5582868-5582890 CTGCATCATCCTATGGTGGAAGG - Intergenic
901087167 1:6618010-6618032 CTGCAACTTGATGTAGATGAAGG + Intronic
902165188 1:14564433-14564455 CTGCATCTTCATCTTGAATATGG + Intergenic
902201681 1:14838151-14838173 CTGCACCCTCACGTGGAGGAAGG + Intronic
903015328 1:20357964-20357986 CTGCATCTGCATGTGGTGGGAGG - Intergenic
904396133 1:30223824-30223846 CTGCAGCTTCCTCTGCAGGAGGG - Intergenic
904464779 1:30701322-30701344 CTCCATCTTCAGGAGGAGGAAGG - Intergenic
905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG + Intergenic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
907067390 1:51499034-51499056 CTGCATCCTCATATGGTAGAAGG - Intronic
907269606 1:53283205-53283227 CTTCATCCTCACGTGGTGGAAGG - Intronic
907287222 1:53389677-53389699 CTGTGTCTTCATTTGGTGGAAGG + Intergenic
907359622 1:53903917-53903939 CTGCATTTTCATTTGGCGGCAGG + Intronic
907586576 1:55623239-55623261 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
907722456 1:56984482-56984504 CTGCTTCTGCATATGGAGGTGGG + Intergenic
908034498 1:60037471-60037493 CTGCATCATTCTGTGGTGGAAGG + Intronic
908179562 1:61590319-61590341 CTGAATCTTCCTCTGAAGGAAGG - Intergenic
908466969 1:64405876-64405898 ATGCATGTTCTTGTAGAGGATGG - Intergenic
908856306 1:68433560-68433582 CTGCATCTGAGTGTGGAGGCGGG + Intronic
909052419 1:70782637-70782659 CTGCATCCTCACATGGTGGAAGG - Intergenic
909831827 1:80201970-80201992 CTGCATCTTCATATGGCAGAAGG + Intergenic
910656094 1:89620146-89620168 CTGCATCTTCATATGGCAAAAGG + Intergenic
910705934 1:90129704-90129726 CTTCATCTCCATTTGAAGGAGGG - Intergenic
911228029 1:95328956-95328978 CTGCATCTTCACATGGCAGAAGG + Intergenic
911378422 1:97080394-97080416 ATGCAGCTTCATTTGGAGGGGGG - Intronic
911386140 1:97177938-97177960 CTGTATCTTCACATGGTGGAAGG + Intronic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
911558292 1:99373000-99373022 CTGTATCATCCTATGGAGGAAGG - Intergenic
912013642 1:105004882-105004904 CTGCATCTGCATCTGGACAAGGG + Intergenic
912695642 1:111840081-111840103 CTGCATCCTCACATGGTGGAAGG + Intronic
913069561 1:115286501-115286523 CTGCAGCTTCACGGGGAGGCTGG + Exonic
913435645 1:118844848-118844870 ATGCATCTACATGTGTAGGCTGG + Intergenic
915917465 1:159949691-159949713 CTGCCTCTTTATGTGCAAGATGG + Intergenic
916526779 1:165617838-165617860 CTGCATTCTTATGTGGTGGAAGG - Intergenic
916539223 1:165736097-165736119 CTGCATCCTCACATGGTGGAAGG - Intronic
916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG + Intronic
917285694 1:173419417-173419439 CTGCATCCTCACGTGGCAGAGGG - Intergenic
917347811 1:174046826-174046848 CTGCATCCTCACATGGCGGAAGG + Intergenic
920696673 1:208186106-208186128 CTGCATCATCATTTGTTGGAAGG + Intronic
920744211 1:208610765-208610787 CTGTGTCCTCATGTGGAAGAAGG + Intergenic
920744350 1:208612387-208612409 CTGTGTCTTCATGTGGTGAAAGG + Intergenic
920918363 1:210276941-210276963 CTGTGTCTTCATATGGTGGAAGG - Intergenic
921249749 1:213285850-213285872 CTGCATCCTCACATGGTGGAAGG - Intergenic
921840364 1:219821726-219821748 TTTCATCTCCATGTGGTGGAAGG - Intronic
922420032 1:225453369-225453391 CTAGATATTCATTTGGAGGAAGG + Intergenic
922462446 1:225823933-225823955 CTGCGGCTTTATGTGGAGTAAGG - Intronic
922811821 1:228420213-228420235 CTGCGTCCTCATGTGGTGCAAGG - Intergenic
923083800 1:230686118-230686140 CTGAGTCTTCATCTGGAGAATGG + Intronic
923390866 1:233513768-233513790 CTGTGTCTTCATGTGGAAGAAGG + Intergenic
923404834 1:233649641-233649663 TTGCATCCTCATGTGGTGGAAGG + Intronic
923757378 1:236804321-236804343 CTGTATCTTCACATGGTGGAAGG - Intronic
924726162 1:246673106-246673128 CTGCATCATCCCGTGGTGGAAGG - Intergenic
1063010296 10:2014993-2015015 CTGCATCTCCATTGGGAGGCAGG + Intergenic
1063579161 10:7290165-7290187 CTGCAATTTCAGGTGGAGGAAGG + Intronic
1064319718 10:14293297-14293319 TTGCATCATCCTGTGGTGGAAGG - Intronic
1064433656 10:15292102-15292124 CTGCATCCTCACGTGGTGGAAGG + Intronic
1064741579 10:18440124-18440146 CTGTGTCTTCATGTGGGAGAGGG + Intronic
1065146036 10:22769182-22769204 CTGCATCATAATGTGGCAGAGGG + Intergenic
1065433563 10:25684135-25684157 CTGCATCCTCACATGGTGGAAGG + Intergenic
1066339052 10:34511491-34511513 CTGCATCCTCACATGTAGGAAGG + Intronic
1069176554 10:65296549-65296571 TAGCATCTTCATATGGAGAATGG - Intergenic
1069527080 10:69181659-69181681 CTGCATCATCACATGGTGGAAGG + Intronic
1069587696 10:69619505-69619527 CTGCATCTTCACATGGTGGAAGG + Intergenic
1071687291 10:87773005-87773027 CTCCAGCTTCATCTGGAGGAGGG + Intronic
1071807903 10:89144295-89144317 GTGTATTTTCATGTGGAGGAAGG - Intergenic
1072171093 10:92862491-92862513 CTGCATCCTCACATGGTGGAAGG - Intronic
1072465427 10:95657914-95657936 CTGTATCCTCACGTGGTGGAAGG - Intergenic
1072589921 10:96819843-96819865 CTGCATCTTCACATGGTGGAAGG + Intergenic
1072756751 10:98026633-98026655 CTTCATCTTCAGCGGGAGGAGGG - Intronic
1072828142 10:98629212-98629234 CTCCAGCTTCATTTGGAGGGTGG - Intronic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1073765308 10:106675865-106675887 CTGTATCCTCACGTGGTGGAAGG - Intronic
1073983214 10:109178309-109178331 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1074244995 10:111680770-111680792 CTGCATCCTCATATGGCAGAAGG - Intergenic
1074431953 10:113401813-113401835 CTGCATCCTCAGGTGGTGAAAGG + Intergenic
1074619783 10:115106952-115106974 CTGCATCATCCTGTGGCAGAGGG + Intronic
1075359416 10:121816576-121816598 CTGTGTCCTCATGTGGTGGAAGG - Intronic
1075406947 10:122201368-122201390 CTGCATTCACATGGGGAGGACGG + Intronic
1075617538 10:123902614-123902636 CTGCATCCTCATATGCTGGAAGG + Intronic
1076090074 10:127677492-127677514 CTGCTTCCTCATGTGGCAGAAGG + Intergenic
1076118224 10:127916094-127916116 CTGGATGCTCCTGTGGAGGAGGG + Intronic
1076336394 10:129709630-129709652 CTGCATAATCATATGGAGGCTGG + Intronic
1076581173 10:131512956-131512978 CTGCATCTGTCTGTGAAGGATGG + Intergenic
1076779639 10:132717145-132717167 CTGCGTCCTCACGTGGTGGAGGG + Intronic
1077094089 11:792059-792081 CAGGATCTTCCTGTGGAGGAAGG + Exonic
1077161227 11:1113549-1113571 CTGCCCCTTCAGGTGGAGGCAGG + Intergenic
1077522897 11:3046729-3046751 CTCCACCTTCATGTGGGGGCAGG - Intronic
1077776409 11:5276752-5276774 ATCCATCTTCATGGGAAGGATGG - Intronic
1078087116 11:8240625-8240647 CTGCATCCTCACGTGGCAGAAGG + Intronic
1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG + Intronic
1078843645 11:15102220-15102242 CTACATCCTCATGTGGCAGAAGG + Intergenic
1078928531 11:15895447-15895469 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1079857416 11:25623468-25623490 CTTTGTCTTCATGTGGAAGAAGG + Intergenic
1080335333 11:31188976-31188998 CTGCATCCTCACATGGTGGAGGG - Intronic
1080767273 11:35308562-35308584 CTGCATCATTATATGGAGGAAGG + Intronic
1080783385 11:35451834-35451856 CTGTATCCTCATGTGGCAGAAGG - Intronic
1080926666 11:36764397-36764419 CTGCATCATCCCATGGAGGAAGG + Intergenic
1081384447 11:42454675-42454697 CTGCATTCTCATGTGGCAGAAGG - Intergenic
1081439137 11:43061251-43061273 CTGCATCCTCACATGGTGGAAGG + Intergenic
1081715193 11:45245103-45245125 CCCCAACTTCATGTGGAAGAGGG + Intronic
1081848258 11:46256757-46256779 CTGCGTCCTCATGTGGTGAAAGG - Intergenic
1083427991 11:62599164-62599186 CTGCAGCTCCTTGGGGAGGAAGG - Intronic
1083856748 11:65396786-65396808 CAGCTTCTCCCTGTGGAGGAAGG - Exonic
1084736858 11:71110977-71110999 CTGTGTCTTCACGTGGAGGAAGG - Intronic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1084961379 11:72718504-72718526 CTGCATTTTGAGGTGGAGGTGGG - Intronic
1085127685 11:74013021-74013043 CTGCATCTTCAGGCAGAGGGTGG + Exonic
1085253206 11:75157083-75157105 CTCCATCTTCATCTTGAGTAGGG - Intronic
1085871872 11:80359741-80359763 CTGCATCTTCACGTTGAGTAAGG + Intergenic
1086060841 11:82698467-82698489 CTGCACCTTCATATGGTAGAAGG - Intergenic
1086240066 11:84679522-84679544 ATGGATTTTCATGTGAAGGAGGG + Intronic
1086742602 11:90386289-90386311 CTGCATCTTTACATGGTGGAAGG - Intergenic
1086914278 11:92510908-92510930 GGGCATCCTCATGAGGAGGAGGG + Intronic
1087429643 11:98036412-98036434 CTGCATTCTCACATGGAGGAAGG - Intergenic
1088163027 11:106896666-106896688 CTGCATCCTCATGTGGCAGAAGG - Intronic
1088186390 11:107176339-107176361 CTGCATCCTCGTGTGGCTGAAGG + Intergenic
1088568794 11:111201134-111201156 ATGTATCTTCACATGGAGGAAGG + Intergenic
1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG + Exonic
1089283747 11:117392503-117392525 CTGTATCTTCTTCTGGAGGCTGG - Exonic
1091053152 11:132393079-132393101 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1092139250 12:6171589-6171611 CTGCCTCCTCCTGGGGAGGATGG + Intergenic
1092293348 12:7178737-7178759 CTGCATCTTCACATGGTGGAAGG - Intergenic
1092386501 12:8039611-8039633 CTACATCTTATTGTGGAGCAGGG - Intronic
1092571353 12:9726019-9726041 CTGCATTTTCATCTGTAAGAGGG - Intronic
1092945801 12:13452936-13452958 CTCCATCTTTATGTGGATGGGGG - Intergenic
1093932706 12:24970193-24970215 CTGCATGTGCATTAGGAGGATGG - Intergenic
1095152582 12:38812810-38812832 CTGCATCTTTATATTGAAGAAGG - Intronic
1095343147 12:41116550-41116572 CTGCATCTTCACATGGCAGAAGG - Intergenic
1095373356 12:41496418-41496440 CTACTTCTTCATGTGGAAAAGGG - Intronic
1095814304 12:46404754-46404776 CTGCATGTTCACGTGGCAGAAGG - Intergenic
1096741484 12:53696941-53696963 CTGGATCTTGAAATGGAGGAGGG - Intergenic
1096836909 12:54356997-54357019 CTGCCTCTTCAACTGGGGGAAGG - Intergenic
1097166709 12:57089902-57089924 CCGCATCTTCAAGTGGAGTGGGG - Intronic
1097377824 12:58859871-58859893 GTCCTTCTTCATGTGGGGGACGG + Intergenic
1097754623 12:63395982-63396004 CTGCATCCTCACATGGCGGAAGG + Intergenic
1098113011 12:67144057-67144079 CTGCATCCTCACCTGAAGGAAGG + Intergenic
1098182202 12:67859967-67859989 CTGTGTTTTCATGTGGCGGAAGG + Intergenic
1098182601 12:67863859-67863881 CTGCATCTTCATATGGCGGAGGG + Intergenic
1098491023 12:71078302-71078324 CTGCATCTTGATGTGCAAAATGG - Intronic
1098945604 12:76586054-76586076 TTGCAGCTGCATCTGGAGGAGGG + Intergenic
1099054375 12:77820382-77820404 CTGCATCTTCATATGTTAGAAGG + Intergenic
1099270003 12:80496977-80496999 CTGGATCTTAATGAGGAGGTTGG + Intronic
1099773116 12:87089440-87089462 CTGTATCTTCACATGGTGGAAGG + Intergenic
1099790941 12:87332651-87332673 CTTCATCTTCACATGGTGGAAGG - Intergenic
1099960342 12:89391169-89391191 CTGGATTTTCAAGTAGAGGAAGG + Intergenic
1100335377 12:93624157-93624179 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1100450310 12:94699608-94699630 TTGCTTCCTCATGTGGTGGAAGG + Intergenic
1100621791 12:96283536-96283558 CAGCTTCTTCATGTGTAGAATGG - Intronic
1101314681 12:103618293-103618315 CTGTATCTTCACTTGGTGGAAGG - Intronic
1103293173 12:119863886-119863908 CTGCATCTTCACCTGGCAGAAGG - Intronic
1104536387 12:129621708-129621730 CTACATCTTCCAGTGGAGGTAGG + Intronic
1104770881 12:131363596-131363618 CTGCATCTGCATGGGCAGGGAGG - Intergenic
1105697928 13:22908912-22908934 CTGCATCCTCACATGGAAGAAGG + Intergenic
1106110926 13:26776219-26776241 CTGCATCATCCTGTGGTGGGAGG - Intergenic
1106689653 13:32100834-32100856 CTGCATCTTCACATGGCAGAAGG + Intronic
1109207921 13:59501967-59501989 CTGGATCATCTTGTGGAGTAAGG - Intergenic
1109232998 13:59781912-59781934 CTGTGTCCTCATGTGGTGGAAGG - Intronic
1109658737 13:65430138-65430160 CTGCATCCTCACATGGTGGAAGG - Intergenic
1110046737 13:70841629-70841651 CTGCATTTTCAGGTGGGGGCAGG - Intergenic
1110186435 13:72680783-72680805 CTGCGTTTTCATGTGGCAGAAGG + Intergenic
1110405271 13:75144115-75144137 CAGCAGCTTGATGTGGAGTAGGG - Intergenic
1110947660 13:81443554-81443576 CTGCATTCTCATCTGGAGGCAGG + Intergenic
1111925295 13:94457375-94457397 CTGCATCCTCATATAGTGGAGGG - Intronic
1112025202 13:95405364-95405386 CTGTGTCTTCTGGTGGAGGAGGG + Intergenic
1112028916 13:95439287-95439309 CTGCATCCTCACATGGTGGAAGG + Intronic
1112034402 13:95483979-95484001 CTGTATCCTCATGTGGTGGAAGG - Intronic
1112263187 13:97897259-97897281 CTGCATCTTCTCTTGGTGGAGGG + Intergenic
1112600973 13:100855526-100855548 ATGCATCTGCATGTGGAACAGGG + Intergenic
1113395662 13:109945256-109945278 CTGCATCCTCACATGGTGGAAGG + Intergenic
1113631156 13:111885328-111885350 CTGCATCTTGGTGTGGTGGTGGG - Intergenic
1113803846 13:113102017-113102039 CTGCCTTTCCATGTGGATGATGG + Intergenic
1113970302 13:114183598-114183620 CTGCATCCTCATATGGTGAAAGG + Intergenic
1114258011 14:21018765-21018787 CTGCATCTTCATGAGGTGCTTGG + Exonic
1114828085 14:26105686-26105708 CTGGAAGTTCATGTGCAGGATGG + Intergenic
1114836596 14:26210361-26210383 CTGCATCTTTACATGGTGGAAGG - Intergenic
1114844191 14:26301192-26301214 CTGCATCTTCATGTGGTGGAAGG - Intergenic
1115389278 14:32836316-32836338 CTGCATCCTCATCTGGTGGAAGG + Exonic
1116049529 14:39786065-39786087 CTGCATCTTCATGTTGAATAGGG + Intergenic
1116265840 14:42688364-42688386 ATCCTTCTTCATGTGGAGGGAGG + Intergenic
1117899497 14:60517129-60517151 CTGCACCTTCACGTGGCAGAAGG - Intergenic
1118068285 14:62216422-62216444 CTGCGTCTTCACATGGTGGAAGG - Intergenic
1118546570 14:66896040-66896062 CTGCATCTTCACGTGGTAGAAGG + Intronic
1119320001 14:73724933-73724955 CTGCATCTTCCTCTGGGGAATGG + Intronic
1121733235 14:96201044-96201066 CTGCATTTTCATTTGGGGAAGGG + Intergenic
1121734288 14:96206948-96206970 ATGCATCCTCATATGGTGGAAGG + Intronic
1123752146 15:23364708-23364730 CAGCAGCTTCATCTGGAGGGAGG - Exonic
1125347593 15:38733715-38733737 CTGTGTCTTCATGTGGTAGATGG + Intergenic
1125490189 15:40141562-40141584 CTGCATCATTATATGGAGGAAGG - Intergenic
1125919036 15:43514028-43514050 CTGCATCTTAATCTGAAGAATGG - Intronic
1126178189 15:45758251-45758273 CTGCATCTTCATGTAGCAGAAGG + Intergenic
1126292968 15:47102015-47102037 CTGCATCTTCACGTGGCATAAGG - Intergenic
1126336516 15:47591152-47591174 CTGCATCCTCATGAGGTGGGAGG + Intronic
1126448848 15:48782659-48782681 CTTCATTTACATGTGGAGGTGGG - Intronic
1126812101 15:52417517-52417539 CTGTATCCTCATGTGGTTGACGG + Intronic
1128458521 15:67847941-67847963 CTGTATCCACATGTGGAGGTAGG + Intergenic
1128510760 15:68312763-68312785 CTGCATCTTCAGGGTGAGGCTGG - Exonic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1129922010 15:79327226-79327248 CTGCATCCTCACGTGGCAGAAGG - Intronic
1130276063 15:82476929-82476951 CTGCAGGTTCACCTGGAGGAAGG + Intergenic
1130468423 15:84204320-84204342 CTGCAGGTTCACCTGGAGGAAGG + Intergenic
1130485323 15:84395430-84395452 CTGCAGGTTCACCTGGAGGAAGG - Intergenic
1130495843 15:84469222-84469244 CTGCAGGTTCACCTGGAGGAAGG - Intergenic
1131403128 15:92142418-92142440 CTGTGTCTTCATGTGGTGGGAGG + Intronic
1131418314 15:92280248-92280270 CTGATTCTCCATGTGGAGGAAGG - Intergenic
1131526290 15:93155306-93155328 CTGCATCCTCATGTAGTAGAAGG - Intergenic
1131774373 15:95778418-95778440 CTGTATCCTCACTTGGAGGAAGG + Intergenic
1132355423 15:101168039-101168061 CTTCCTCTTCAGGAGGAGGAGGG + Intergenic
1133380010 16:5322017-5322039 CAGCTTCTTCATCTGTAGGATGG - Intergenic
1133466719 16:6034497-6034519 CTGCATCTTCATATGGTGGAAGG + Intronic
1134769017 16:16788440-16788462 CTGCATCATCCTGTGGCCGAAGG - Intergenic
1135568165 16:23528047-23528069 CTGCATCCTCACGTGGTGGAGGG - Intronic
1135591906 16:23711106-23711128 CTGCATCCCCATCTGGGGGAAGG - Intronic
1136957739 16:34804237-34804259 CTGCATCAGCAAGTGCAGGAGGG - Intergenic
1137419054 16:48315453-48315475 CTGCATCTTCACATGGCAGAAGG + Intronic
1137587251 16:49671055-49671077 CTGCAGCTGCATGTGAAGGAAGG - Intronic
1137661021 16:50206527-50206549 CTGGACCTTGATGTGGAGGTGGG + Intronic
1137725377 16:50653366-50653388 CCACATCTACATGTGGAGAAAGG + Intergenic
1137763168 16:50957039-50957061 CTGCATCATCCTGTGGCCGAAGG - Intergenic
1138208585 16:55143812-55143834 CTGCATCATCCTATGGTGGAAGG - Intergenic
1138341420 16:56291823-56291845 CTGCATCCTCAGGTGGCAGAAGG + Intronic
1138346241 16:56322053-56322075 CTGCGTCCTCACGTGGTGGAAGG + Intronic
1138745732 16:59361664-59361686 CTGCATCTTCATCTGTAAAATGG + Intergenic
1138753094 16:59447857-59447879 CTGCATCCTCATGTGGCAAATGG + Intergenic
1138810850 16:60148743-60148765 CTGCCTGTTCATGCGGATGATGG - Intergenic
1139212078 16:65088151-65088173 CTGTGTCTTCATGTGGCTGAAGG - Intronic
1140231911 16:73124320-73124342 CTGTGCCTTCATGTGGTGGAAGG + Intergenic
1140916623 16:79499627-79499649 CTGTGTCTTCATATGGGGGAAGG - Intergenic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143339567 17:6200137-6200159 CTGCATCTCCATGTTCAGGAGGG - Intergenic
1143370973 17:6439217-6439239 CTGCATCATAACGTGGTGGAAGG + Intergenic
1143919343 17:10318439-10318461 TTGCATCCTCATGTGGTAGAAGG - Intronic
1143991496 17:10967200-10967222 CTGCATCCGCATGTGGTGGAAGG - Intergenic
1144051509 17:11500976-11500998 CTGCAGTTTCATGTGTAAGAAGG - Intronic
1144253573 17:13443552-13443574 CTGCATCCTCACGTGGTGGAAGG - Intergenic
1144389297 17:14778814-14778836 CTGCAGCTTTCTGTGGAGGGAGG + Intergenic
1144435991 17:15241468-15241490 GTGCATGTTCATGAGGAGTATGG + Intronic
1144819092 17:18058948-18058970 CTACGTCTTCATGAGGTGGAAGG + Exonic
1144904191 17:18626614-18626636 CTGCATGTCCCTGTGGAGGGAGG - Intergenic
1145393120 17:22471322-22471344 CTGCATCATCCCGTGGTGGAAGG - Intergenic
1146592268 17:34137787-34137809 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1146656213 17:34636703-34636725 CTGCTTCCTCATCTGGAGGGAGG + Intronic
1146674226 17:34761714-34761736 CTGCATTTTCAAGGTGAGGAAGG - Intergenic
1146744116 17:35313404-35313426 CTGCTGCTTCATGTGAAGGGTGG + Intergenic
1146839992 17:36144874-36144896 CTGTGTCTTCATGTGGTGAAAGG + Intergenic
1147791887 17:43018883-43018905 CTGCTACTTCATTTGGAAGAAGG - Intronic
1149707466 17:58707880-58707902 CTGTGTCCTCATGGGGAGGAAGG + Intronic
1150151409 17:62811800-62811822 TTGCATCCTCATATGGTGGAAGG + Intergenic
1151130967 17:71895559-71895581 CGGCATCTGTGTGTGGAGGAGGG + Intergenic
1151297493 17:73196102-73196124 CTGTATCCTCACGTGGGGGAAGG + Intronic
1152061714 17:78081121-78081143 ATGCATCCTCATGTGGTGGAAGG + Intronic
1152100208 17:78297013-78297035 CTGTGTCCTCATGTGGCGGAAGG - Intergenic
1153668987 18:7392387-7392409 CTGTGTCTTCACGTGGTGGAAGG - Intergenic
1153967890 18:10198140-10198162 CTGTGTCTTCATGTGGTAGAAGG + Intergenic
1154392010 18:13945678-13945700 CTGCATCCTAATATGGTGGAAGG - Intergenic
1155694785 18:28672286-28672308 CTGCATCCTCATATGGCAGAAGG + Intergenic
1155749966 18:29410008-29410030 CTGTATCTTCGTGTGGAAGAAGG + Intergenic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1156069857 18:33193937-33193959 CTGCATCATCACATGGAGGAAGG + Intronic
1156105373 18:33653191-33653213 CTGCATCTTTGTGTTCAGGAGGG + Intronic
1157014064 18:43688337-43688359 CTATTTCTTCATGTGGTGGAAGG + Intergenic
1157137884 18:45075163-45075185 CTGTATCCTCATGTGGTGGAAGG + Intergenic
1157165842 18:45357668-45357690 CTGCAGCTTCAGGCAGAGGAGGG + Intronic
1157371553 18:47117469-47117491 CTGCATCATCCTGTGGTAGAAGG - Intronic
1158645840 18:59246311-59246333 CTGCATCCTCACATGGTGGAAGG + Intergenic
1159554109 18:69927169-69927191 CTGCGTCCTCATATGGTGGAAGG - Intronic
1159884248 18:73889136-73889158 GTGCATGTCCAAGTGGAGGATGG - Intergenic
1160099910 18:75910798-75910820 CTGTATTATCATGTGGGGGAGGG - Intergenic
1160365320 18:78319629-78319651 CTCCTTCTGCAGGTGGAGGATGG + Intergenic
1160463822 18:79059218-79059240 CTGCATCTCCATATGGCGGTTGG + Intergenic
1162895916 19:13764704-13764726 CTGCACCTTCATGGCGCGGATGG - Exonic
1164161345 19:22627390-22627412 ATGAATCCTCATGGGGAGGAAGG + Intergenic
1164946686 19:32300400-32300422 CTGTAACTTCACATGGAGGAAGG - Intergenic
1165619970 19:37237717-37237739 TTGCATCTTCGTGTGGCAGAAGG + Intronic
1166042995 19:40214321-40214343 CTCCTGCTTCTTGTGGAGGAGGG + Intronic
1167335194 19:48880938-48880960 GTGCCTCCTCATTTGGAGGAAGG - Intergenic
1167391785 19:49200206-49200228 CTGCAGCTTCCTCTGAAGGATGG + Intronic
1168474772 19:56667827-56667849 TTGTGTCTTCATTTGGAGGAAGG - Intronic
924986287 2:273081-273103 CTGCATCGTCCTGTGGTAGAAGG + Intronic
925098164 2:1224057-1224079 CTGTGTCTCCCTGTGGAGGAAGG + Intronic
925238993 2:2305733-2305755 GTGCATCTTCACGTGGTGGAAGG + Intronic
925712279 2:6752999-6753021 CTGTGTCTTCACGTGGTGGAAGG - Intergenic
925951074 2:8911737-8911759 CTGCTTCTACATGTGGCAGAAGG - Intronic
926288503 2:11509734-11509756 CTGCATCCTCACATGGTGGAAGG - Intergenic
926372503 2:12194128-12194150 CTGCATCATCTTATGGTGGAAGG - Intergenic
926866392 2:17363654-17363676 CTACATCCTCATGTGGTAGAAGG - Intergenic
926922636 2:17954232-17954254 CTGCATCTTAATATGGCAGAAGG - Intronic
926951857 2:18251887-18251909 CTGCATATCCATGTGGATTATGG - Intronic
926961867 2:18365819-18365841 CTGCATCCTCACATGGTGGAGGG - Intergenic
927173115 2:20387015-20387037 CTGCAGCATCATGTGGTGGAAGG - Intergenic
927257834 2:21055865-21055887 CTGCATCTTCACATGGAAGGAGG + Intergenic
927458041 2:23274478-23274500 CTGCATCCTCACATGGTGGAAGG - Intergenic
927932621 2:27054941-27054963 CTGAATCTGCAAGTGGAGCAGGG - Intronic
928652877 2:33420890-33420912 TTACATATTCATGTGCAGGAAGG - Intergenic
928653112 2:33422584-33422606 CTGCATCTTCACATGGTGGAAGG - Intergenic
928707688 2:33968092-33968114 TTGCATCTTCATATGGCAGAAGG + Intergenic
929158825 2:38811579-38811601 CTGCATCCTCGTGTGGCTGAAGG - Intronic
930689155 2:54341343-54341365 CTGCATCCTCACATGGTGGAAGG - Intronic
930978057 2:57488647-57488669 CTGTTTCCTCAAGTGGAGGAAGG - Intergenic
931140586 2:59453248-59453270 CTGCATCTTTACATGGTGGAAGG - Intergenic
931491049 2:62747908-62747930 GTGCATCCTCATGTGGCAGAAGG - Intronic
931762271 2:65428981-65429003 ATGCATTTTTATGTGGAGGGGGG + Intronic
931998207 2:67859099-67859121 CTGAATCACCATATGGAGGATGG + Intergenic
932061341 2:68501981-68502003 CTGCATCATAACGTGGTGGAAGG + Intronic
932359290 2:71091324-71091346 CTGCATCCTCATATGGTGGAAGG - Intergenic
932424308 2:71619509-71619531 CAGGATCTTCCTGTTGAGGAAGG + Intronic
932784741 2:74590268-74590290 CTGTATCCTCATATGGTGGAGGG + Intronic
932897613 2:75657298-75657320 CAAAATATTCATGTGGAGGAGGG - Exonic
933147267 2:78869363-78869385 CTGCCTTTTCATATGGTGGAAGG - Intergenic
933776749 2:85775721-85775743 GAGCATCTTCCTTTGGAGGAAGG - Intronic
934945820 2:98540644-98540666 CTGCACCATCCTGTGGTGGAAGG + Intronic
936045707 2:109186323-109186345 CAGCATTTTCATCTGCAGGATGG - Intronic
936287918 2:111195433-111195455 CTGCTTCCTCACGTGGTGGAAGG - Intergenic
936778221 2:115999625-115999647 CTGCATCTTAACATGGTGGAAGG + Intergenic
937153973 2:119705324-119705346 CTGCATTCTCATCTGGAGGCTGG + Intergenic
937359204 2:121217466-121217488 CTGCATCTGCCATTGGAGGATGG - Exonic
937462529 2:122101793-122101815 CTGCATCTTCACATGGTAGAGGG + Intergenic
938170240 2:129069576-129069598 CTGTTTCCTCATGTGGCGGATGG - Intergenic
938178882 2:129162081-129162103 CAGCATCCTCATCTGGAGAATGG - Intergenic
939269266 2:139916692-139916714 CTGTATCTTCACATGGTGGAAGG - Intergenic
940106664 2:150108849-150108871 CTGTATCTTCAGTTGAAGGATGG + Intergenic
940322589 2:152392562-152392584 CTGCATCCTCATCTGGCAGAAGG + Intronic
941197224 2:162467899-162467921 TTGCATCCTCAGGTGGTGGAAGG + Intronic
941392124 2:164927146-164927168 CTGCATCTTCACGAGGAGGAAGG - Intronic
941821018 2:169843316-169843338 CTGCATCTTCACATGGTGGAAGG + Intronic
941939177 2:171015145-171015167 ATAGATTTTCATGTGGAGGATGG - Intronic
942999493 2:182307426-182307448 CTGCATCATCACATGGTGGAAGG - Intronic
943451492 2:188047011-188047033 CTGCCTCCTTATGTGGTGGAAGG - Intergenic
946059079 2:216926412-216926434 CTGCTTTTTCATCTGGATGATGG - Intergenic
946900873 2:224370080-224370102 CTGTGTCGTCATGTGGTGGAGGG - Intergenic
947089544 2:226494892-226494914 CTGCATCTTCATTTCCAGCAGGG + Intergenic
947154807 2:227151790-227151812 CTGCATCCTCACATGGTGGAAGG - Intronic
947580627 2:231314859-231314881 CTGGATATTCATATGCAGGAGGG - Intronic
948898466 2:240941949-240941971 CTGCACCTTCACATGGTGGAAGG - Intronic
1168799387 20:634575-634597 CTGCAGCTTGAGGAGGAGGAAGG + Intergenic
1168967107 20:1905393-1905415 CTGCTTCCTCATCTGTAGGAGGG + Intronic
1169261535 20:4142320-4142342 CTGAATCACTATGTGGAGGAAGG + Intronic
1169301440 20:4445171-4445193 CTGCATCATCAGATGGTGGAAGG - Intergenic
1169587916 20:7107231-7107253 CTGTATCCTCATGTGATGGAAGG - Intergenic
1169769966 20:9189756-9189778 CTCCATCTTCATATGGCAGAAGG + Intronic
1169822533 20:9728182-9728204 CGGTGTCTTCATGTGGTGGAAGG - Intronic
1169837933 20:9901189-9901211 CTGTATCTTCACATGGTGGAAGG + Intergenic
1170671520 20:18438825-18438847 CTGTGTCTTCATATGGTGGAAGG + Intronic
1171229769 20:23475109-23475131 TTGCACCTTCTGGTGGAGGAAGG + Intergenic
1173645074 20:44628219-44628241 TTGCATCTTCAGGATGAGGATGG + Intronic
1173677837 20:44853151-44853173 CTGCATCTTCACATGGTGGAAGG + Intergenic
1174148715 20:48470645-48470667 CTTCATTTTCCTGTGGATGAGGG - Intergenic
1175048139 20:56126636-56126658 CTGTGTCTTCATATGGTGGAAGG - Intergenic
1175685443 20:61024792-61024814 CTGCATGTCCCTGTGGCGGAGGG - Intergenic
1175795330 20:61767177-61767199 CTGCATGCTCATGTGGGGGCGGG - Intronic
1177255181 21:18652315-18652337 CTGCATCTTCATATGGTGGAAGG - Intergenic
1177566584 21:22830873-22830895 CTGCTTCTTCATGTAAAGCAGGG - Intergenic
1178291206 21:31370023-31370045 CTGTGTCCTCATGTGGTGGAAGG - Intronic
1178550538 21:33534574-33534596 CTGCAGCTTCATTTTGAGGTAGG - Exonic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179602268 21:42487731-42487753 CTTTATCTTCATGTGGAAGTGGG - Intronic
1179645880 21:42775830-42775852 CTGGGTGCTCATGTGGAGGAAGG + Intergenic
1180703221 22:17793022-17793044 CTGTATCTTCGTGGGGAGGTGGG - Intronic
1181037393 22:20176491-20176513 CTGGATCCTCTTGTGCAGGAGGG - Intergenic
1181885139 22:26016027-26016049 CTGCATCTTCATGGGGAACTGGG + Intronic
1181975708 22:26727889-26727911 CTGCATCTTCACATGGCAGAAGG + Intergenic
1183153607 22:36056856-36056878 CTACATCCTCACGTGGGGGAAGG + Intergenic
1183337988 22:37261648-37261670 CTGTATCCTCACGTGGTGGAGGG - Intergenic
1184438716 22:44496191-44496213 CTGCATATTCATGTGCAGAGTGG + Exonic
1184850916 22:47119903-47119925 CTGCATCCTTATGTGGTGGAAGG + Intronic
1184956368 22:47889461-47889483 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
1184966026 22:47972903-47972925 CTGCGTCCTCATGTGGGGGGAGG + Intergenic
1185070960 22:48655485-48655507 CTCCATCCTCACGTGGTGGAAGG + Intronic
1185099037 22:48827895-48827917 ATGCAGCTTCAGGTGGAGGCGGG + Intronic
1185235630 22:49711127-49711149 CTGTGTCTTCCTGTGGTGGAAGG + Intergenic
949153146 3:794531-794553 CTGCATCCTCACGTGGAAGAAGG - Intergenic
949224731 3:1681023-1681045 CTGCATCATAATGTGGCAGAAGG + Intergenic
949579842 3:5376935-5376957 CTGCAGCTTGACGTGGAGGAGGG + Intergenic
949741141 3:7236061-7236083 CTGCATCCTCATGTGGTAGAAGG + Intronic
949908223 3:8877341-8877363 CTGTGTCCTCATGTGGCGGAAGG + Exonic
950235818 3:11319440-11319462 CTGTGTCCTCATGTGTAGGATGG + Intronic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
950783089 3:15409237-15409259 CTCCAACTACATCTGGAGGAGGG - Intronic
950948769 3:16977903-16977925 CTGCATCCTCACATGGTGGAAGG + Intronic
951021580 3:17786677-17786699 CTGAGTCCTCATGTGGAGGAAGG - Intronic
951533961 3:23724913-23724935 CTGCGTCCTCATGGGGAAGAAGG + Intergenic
951571259 3:24065510-24065532 CTGTATGTTCCTTTGGAGGAAGG + Intergenic
951782344 3:26377816-26377838 CTGTATCTTCATCTGGGTGATGG + Intergenic
951822865 3:26832997-26833019 CTGCATTTTCATCTGGAGTTCGG - Intergenic
952210192 3:31222506-31222528 CTGTATCTTCCTGTGAAAGATGG + Intergenic
952686241 3:36151816-36151838 CTGCATCCTCATATGGTGGAAGG + Intergenic
953202764 3:40792211-40792233 CTCCAGGTTCATGTGGAGGCAGG - Intergenic
953330014 3:42044683-42044705 CTCCATCTGCATGGGGAGAAGGG + Intronic
953587322 3:44214872-44214894 CTGCATATCCATGTGGTGGCTGG - Intergenic
953746723 3:45580033-45580055 CTGCATCATCCTCTGGTGGAAGG - Intronic
954749312 3:52804709-52804731 CTGCATCTGCAGGTGCAGCAAGG - Exonic
954773129 3:52991775-52991797 GTGCATCCTCATGTGGTAGAAGG - Intronic
955375698 3:58394802-58394824 CTCCTTCTTCAGATGGAGGAAGG - Intronic
955613589 3:60782819-60782841 CTGTATCCTCACGTGGACGAAGG + Intronic
955944801 3:64182588-64182610 CTGCATCCTCAGGTGGTGAAAGG - Intronic
956057469 3:65315509-65315531 CTGTATCTTTATATGGCGGAGGG + Intergenic
956134071 3:66081840-66081862 CTGCATCCTCATGTGGGGCTTGG - Intergenic
956571862 3:70705569-70705591 CTGCATCCTCACATGGGGGAAGG + Intergenic
957463104 3:80548149-80548171 CTGAGTCTTCATATGGTGGAAGG + Intergenic
957587394 3:82149745-82149767 CTATGTCTTCATGTGGTGGAAGG + Intergenic
957866696 3:86034406-86034428 CTGTATCCTCATGTCGTGGAAGG - Intronic
958662477 3:97088561-97088583 CTGTGTCTTCAGGTGCAGGAAGG - Intronic
958745248 3:98126402-98126424 CTGCATCCTTATGTGGTCGAAGG + Intergenic
959003227 3:100989147-100989169 CTGCATCCTCACATGGTGGAAGG - Intronic
959010857 3:101074397-101074419 CTGTGTCTTCATGTAGTGGAAGG + Intergenic
959886674 3:111510451-111510473 CTGCATCTTCACATGGAGGAAGG + Intronic
960006390 3:112785553-112785575 CTGCATCATCCCATGGAGGAAGG - Intronic
960162312 3:114363951-114363973 CTGTATCTTGAATTGGAGGAAGG - Intronic
960371478 3:116846324-116846346 CTGCTTGTTGATGTGGAGGAGGG + Intronic
960517609 3:118619288-118619310 CAGCAACTGCATGTGAAGGAGGG + Intergenic
960542792 3:118880011-118880033 ATGCATCTGCATGTGAGGGAGGG + Intergenic
960629053 3:119710377-119710399 CTGTGTCCTCACGTGGAGGAAGG + Intronic
961198570 3:125025265-125025287 CTGCATCCCCACGGGGAGGAGGG + Intronic
962177383 3:133168366-133168388 CTACATCTTCACATGGCGGAAGG + Intronic
962577858 3:136771102-136771124 CTGTGTCCTCATATGGAGGAAGG - Intergenic
963173726 3:142277386-142277408 CTGCATCCTCACGTGGTGAAAGG - Intergenic
963300312 3:143590207-143590229 CAGCATCTTCATCTGGAAAATGG + Intronic
963678527 3:148345449-148345471 CTATATCTTTATGTGGTGGAAGG - Intergenic
964203618 3:154146200-154146222 CTACATCTTCACGTGGTAGAAGG + Intronic
965701563 3:171463630-171463652 ATGCATCTTCATGTGGTGGAAGG - Intergenic
965746247 3:171929113-171929135 CTGTGTCCTCATGTGGTGGAAGG - Intronic
966037291 3:175435264-175435286 CTGTATTTTCAAGTGGATGATGG - Intronic
966183939 3:177211576-177211598 CTGCATCATAACGTGGAGAAAGG - Intergenic
966194341 3:177298314-177298336 CTGCATCTTTGTGTGGCTGAAGG - Intergenic
966693825 3:182768912-182768934 CTGCATCCTTACGTGGTGGAAGG + Intergenic
966762741 3:183431625-183431647 CTGCATCATAACGTGGTGGAAGG - Intergenic
968105160 3:195995583-195995605 CTTCATCTTCCCGTGGATGAGGG - Intergenic
968799949 4:2736129-2736151 CTGTATCTTCATATGGTAGAAGG + Intergenic
969129237 4:4979249-4979271 CTGCATCTTCACATTGTGGAAGG - Intergenic
969214418 4:5710925-5710947 CAGCGTCTTCATCAGGAGGATGG + Intergenic
969293473 4:6255319-6255341 CTGAGTCACCATGTGGAGGAAGG - Intergenic
969347878 4:6580578-6580600 CTGCATCTTGAGGAGGAGGGTGG - Intronic
969435536 4:7187072-7187094 GTGTATCCACATGTGGAGGAAGG - Intergenic
969547116 4:7837407-7837429 CTGTGTCCTCATGTGGCGGAAGG - Intronic
970382997 4:15526927-15526949 CTCAGTCTTCATGGGGAGGAGGG - Intronic
970719331 4:18968015-18968037 CTTCATCGTCATGTGGTGGAAGG - Intergenic
970800091 4:19963067-19963089 CTGCATCCTCACATGGTGGAGGG + Intergenic
971725808 4:30310319-30310341 CTGCATTTCCAGGTGGAGTATGG - Intergenic
972295206 4:37731172-37731194 CTGCATCATCACACGGAGGAAGG + Intergenic
972733004 4:41813694-41813716 CTCCATCCTCATGTGGAGGAAGG + Intergenic
972841383 4:42933696-42933718 CTGCATCTTCACATGGTGAAAGG - Intronic
972872917 4:43322922-43322944 CTGCATCTAAATGTGAGGGATGG - Intergenic
972902610 4:43703311-43703333 CTGCATCTTCATCTGCATTAGGG + Intergenic
973208490 4:47587674-47587696 CTGCACCTTCAGATGGTGGAAGG + Intronic
973969239 4:56194644-56194666 CTGTGTCTTCATGTGGCAGAAGG - Intronic
975796339 4:78010569-78010591 CTGCATCCTCACTTGAAGGAAGG - Intergenic
976282949 4:83343105-83343127 CTGCATCGTCCTATGGAGGGAGG - Intergenic
976313171 4:83632923-83632945 GTGCAGCTTCATGTGCAGGTGGG - Intergenic
976319050 4:83690721-83690743 CTGCATCTTCACATGATGGAAGG + Intergenic
976790116 4:88868977-88868999 CAGCATCTTCATTTGGAAGATGG + Intronic
977125717 4:93165032-93165054 CTGCATTCTCATCTGGAAGATGG + Intronic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
978204460 4:106063792-106063814 CTGTGTCTTCATGTGGAAGAAGG - Intronic
980423228 4:132592234-132592256 CTCCATCTCCATGATGAGGAGGG - Intergenic
980967628 4:139537991-139538013 ATGCATATTCATGTGTATGATGG + Intronic
980976571 4:139616785-139616807 CTGCATCCTCACATGGTGGAAGG + Intergenic
982069324 4:151681824-151681846 CTGTGTCTGCATGTGGTGGAAGG + Intronic
982121772 4:152150128-152150150 TTGTCTCTTCATGTGGTGGAGGG + Intergenic
982177292 4:152718166-152718188 CTGCATCCTCACTTGGTGGAAGG + Intronic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
982676019 4:158376696-158376718 CTGCATCATCACATGGAGGAAGG + Intronic
982821344 4:159943825-159943847 CTGCATCTGCCTCTTGAGGATGG - Intergenic
983155472 4:164341631-164341653 CTGTGTCATCATGTGGTGGAAGG + Intronic
983512057 4:168619465-168619487 CATCATCTTCATGTGCAGGTTGG - Intronic
983656302 4:170088878-170088900 CTGCATCCTCACGTGGTAGAAGG - Intronic
983813138 4:172089326-172089348 AAGCATCTTCAGTTGGAGGAGGG + Intronic
984609059 4:181817709-181817731 TTGCATCCTCATATGGAAGAAGG - Intergenic
985527853 5:416090-416112 CTGCACCTTCACGTGGATGCTGG - Intronic
985640208 5:1060066-1060088 ATGCATGCTCATGTGCAGGAAGG - Intronic
985828727 5:2212774-2212796 CTGCCTCCTCATGGGGGGGATGG - Intergenic
986255335 5:6098286-6098308 CTGCATCCTCATGTGGCAGAAGG + Intergenic
987061159 5:14245439-14245461 CTTCATCTACAAGTGGAGGAGGG - Intronic
987101696 5:14596811-14596833 CTGCATTGTAATGTGGTGGAGGG + Intronic
987417144 5:17674247-17674269 CTCTGTCCTCATGTGGAGGAAGG + Intergenic
987465961 5:18272344-18272366 CTGAATCCCCATGTGGTGGAAGG + Intergenic
987684320 5:21177426-21177448 CTACATCCACATGTGGATGAAGG - Intergenic
987828318 5:23062525-23062547 CTGCATCCTCATATAGTGGAAGG + Intergenic
987969744 5:24927243-24927265 CTCCATCTTCATATAGTGGAAGG - Intergenic
989518219 5:42368978-42369000 CTGCATCATCATGTGGAAGAAGG + Intergenic
990087466 5:51996290-51996312 CTGCATCTTCAAGTTGATGAAGG + Intergenic
990435437 5:55785751-55785773 CCTCATCCTCAGGTGGAGGAGGG - Exonic
990630292 5:57661502-57661524 CTGTATCTTTATATGTAGGAGGG + Intergenic
990911228 5:60854519-60854541 CTGTGTCTTCATGTGGTGGAAGG + Intergenic
990949647 5:61286099-61286121 CTGCATCCTCATGTGGTGGAAGG + Intergenic
990962718 5:61411727-61411749 CTGTGTCTTCATGTGGTAGAAGG + Intronic
991322083 5:65384972-65384994 CTGCATCTTCACATGGTAGAAGG + Intronic
992041454 5:72837323-72837345 CAGCATCCTCACATGGAGGAAGG + Intronic
992556342 5:77907095-77907117 CTGCAGCTTCCTGTGGAAGTGGG + Intergenic
992822283 5:80509405-80509427 CTGCATTTTCATCTGGTGGAAGG - Intronic
993524721 5:88950344-88950366 TTGCATTTTAATGTAGAGGATGG + Intergenic
993572352 5:89557152-89557174 ATGTATCTTCACGTGGCGGAGGG + Intergenic
993587941 5:89755467-89755489 CTGCCTCTTCACATGGTGGAAGG - Intergenic
994665933 5:102705244-102705266 CTGCATCCTCATATGGCAGAAGG - Intergenic
995058585 5:107789321-107789343 CTGCATCCTCACATGGTGGAAGG - Intergenic
995641116 5:114258876-114258898 CTGATGCTCCATGTGGAGGATGG + Intergenic
995819327 5:116210009-116210031 CTGCATCATTATGTGGCAGAAGG + Intronic
996178518 5:120389940-120389962 CTGTCTCTTCATGTGATGGAAGG + Intergenic
996426859 5:123322209-123322231 CTACGTCTTCATATGGTGGAAGG - Intergenic
996701253 5:126452248-126452270 TTGGATCCTCATGTGGTGGAAGG + Intronic
997056918 5:130454241-130454263 TTGCATCCTCATGTGGTGGAAGG - Intergenic
997388884 5:133497180-133497202 CTCCTTCTTCATGTGGAAGTGGG - Intronic
997478172 5:134161076-134161098 CATCATCTTCAGGAGGAGGAGGG + Exonic
997709566 5:135992458-135992480 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
997737695 5:136226246-136226268 CTGCATCCTCCTGTGGAACAAGG + Exonic
997855961 5:137373053-137373075 CTGCATCATCACATGGTGGAAGG - Intronic
998306815 5:141085697-141085719 TTGTTTCTTCATGTGAAGGACGG + Intergenic
998648177 5:144087860-144087882 CTGCTTCTTCATATGTAGTATGG + Intergenic
998700775 5:144696995-144697017 GTGCATCCTCATATGGTGGAAGG - Intergenic
998743244 5:145228866-145228888 CTGCATCCTCGTGTGGCTGAAGG + Intergenic
999297229 5:150467305-150467327 CTGCATCCTCACATGGTGGAAGG - Intergenic
1000827284 5:166060617-166060639 CTGCATCATCACATGGAGGAAGG - Intergenic
1001443026 5:171760640-171760662 CTGCATCCTCATGTGGCAGAAGG + Intergenic
1001756854 5:174176994-174177016 TTGCATCCTCACGTGGTGGAAGG + Intronic
1002001129 5:176196810-176196832 CTGGGTGTGCATGTGGAGGAAGG - Intergenic
1002253206 5:177942162-177942184 CTGGGTGTGCATGTGGAGGAAGG + Intergenic
1002579394 5:180198561-180198583 CTGCATCTTCACATGGGGGAAGG + Intronic
1003058622 6:2844429-2844451 CTGTATCTTCACGTGGCGGTGGG + Intergenic
1003191302 6:3877742-3877764 CTGTGTCCTTATGTGGAGGAAGG + Intergenic
1003652841 6:7977198-7977220 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1003684980 6:8293800-8293822 GTGCAGGTTAATGTGGAGGAAGG + Intergenic
1004039881 6:11965100-11965122 CTGCATCATCCTATGGTGGAAGG + Intergenic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1004900436 6:20188677-20188699 CTGCATGTGCATTAGGAGGAGGG - Intronic
1004981286 6:21027654-21027676 CTGTATCATCCTGTGGTGGAGGG - Intronic
1005360248 6:25024406-25024428 CTGCATCCTCGTGTGGGTGAAGG - Intronic
1005809344 6:29504317-29504339 CTGTGTCCTCATGTGGTGGAAGG + Intergenic
1006010559 6:31039645-31039667 CTGCATCCTCATCTGGAGGCTGG + Intergenic
1006018779 6:31104238-31104260 CGGCACCTGCATGTGGAGGGGGG - Intergenic
1006947190 6:37792533-37792555 CTGTATCTTGATGTGGAGGGCGG - Intergenic
1007749264 6:44062211-44062233 CTGCACCTTCACCTGGAGCAGGG + Intergenic
1007814862 6:44514519-44514541 CTGCATCCTCACGTGGTGGAAGG - Intergenic
1007828114 6:44616975-44616997 CTGCATCCTCACATGGTGGAGGG - Intergenic
1007896401 6:45365248-45365270 CTGCAACTTCAAGTAGTGGAAGG - Exonic
1008367594 6:50700553-50700575 CTGCATCATCATAAGGTGGAGGG - Intergenic
1008615465 6:53221737-53221759 CTGCTTTCTCCTGTGGAGGAGGG - Intergenic
1008925292 6:56885684-56885706 CTGCATCCTCACCTGGTGGAAGG - Intronic
1009868148 6:69423589-69423611 ATGCATCGTCATTTGGTGGAAGG + Intergenic
1010602895 6:77852678-77852700 CTGCATCCTCATGTGGTGGAAGG + Intronic
1010668586 6:78658643-78658665 CTCCATCTTCATGGTGAGAATGG + Intergenic
1011897814 6:92253784-92253806 CTGCAACTTCATCTGGAGCTTGG + Intergenic
1013297735 6:108774618-108774640 CTGCATTCTGATCTGGAGGAGGG + Intergenic
1014220539 6:118794713-118794735 CTGCCTCTTCATATGGAGAAAGG - Intergenic
1014335311 6:120126422-120126444 CTGTGTCATCATGTGGTGGAAGG + Intergenic
1014503618 6:122225793-122225815 CTGCATCCTCACATGGTGGAAGG + Intergenic
1015133045 6:129835834-129835856 CTGCATCTTGATGTGGAGATGGG + Intronic
1016563519 6:145424757-145424779 CTGCATCCTCACGTGGTGGAAGG - Intergenic
1016795009 6:148108397-148108419 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1017346767 6:153391861-153391883 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1017807644 6:157959938-157959960 CTGCATCCTCACATGGAGGAAGG - Intergenic
1017996590 6:159536876-159536898 CTGCATCATTATGTGGTGGAAGG + Intergenic
1018719969 6:166565097-166565119 CTGCATCTTCCTGTTGAGTCTGG + Intronic
1019011066 6:168843931-168843953 CTGTGTCTTTATGTGGTGGAGGG + Intergenic
1019100876 6:169628178-169628200 CTGTATCCTCAAGTGGTGGATGG - Intronic
1021040252 7:15853387-15853409 CAGCATCATGATGTGGTGGAGGG + Intergenic
1022386811 7:29907646-29907668 CTGCATCTTCACATGGTGAAAGG - Intronic
1022620331 7:31977283-31977305 CTGCATCATCATATGTTGGAGGG - Intronic
1023098583 7:36689472-36689494 CTGCATCCTCAAGTGGCTGAAGG + Intronic
1023204673 7:37735088-37735110 CTGCATCTTCATGGGATGGAAGG + Intronic
1023770418 7:43551891-43551913 CTGTGTCTTCATGTGGAGGAAGG + Intronic
1024132071 7:46363231-46363253 CTGCATCCTCATATGGCAGAAGG + Intergenic
1024888263 7:54169592-54169614 CTGCATGTGCATTAGGAGGATGG + Intergenic
1025983047 7:66423671-66423693 CATCATCTTCAGGGGGAGGAGGG + Intergenic
1026418689 7:70210182-70210204 CTGCATCTGCATGTAGAAGAAGG - Intronic
1026614485 7:71889270-71889292 CTGCGTCCTCATGTGGTGGAAGG + Intronic
1026658995 7:72282561-72282583 CTGCATTTTCACATGGTGGAAGG - Intronic
1028107879 7:86902117-86902139 CTGCATCCTCATGTGGTGGAAGG + Intronic
1029223984 7:99011864-99011886 CTGCTGCTCCAAGTGGAGGAAGG + Intronic
1029877450 7:103769348-103769370 CTGTATCCTCACGTGGTGGAAGG - Intronic
1029902994 7:104061815-104061837 CTACATCCTCATGTGGGGAATGG - Intergenic
1030254510 7:107493172-107493194 CTGCATCCTTACGTGGTGGAAGG - Intronic
1030599493 7:111577445-111577467 CTGCCTGTTCTTGTGGAGTATGG - Intergenic
1030985239 7:116233839-116233861 CTGCATCTTCACATGGAGGAAGG + Intronic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1031882400 7:127211709-127211731 CTGCATCTTCACAGGGTGGAAGG - Intronic
1031905627 7:127457422-127457444 CTGCAGCTTGAGGTGGAGAAGGG - Intergenic
1032459403 7:132098656-132098678 CTGTATCTTCATGTGGATTTGGG + Intergenic
1032495671 7:132360280-132360302 TGGCAGCTTCATGTGGATGAGGG - Intronic
1032961590 7:137041633-137041655 CTGCTTCTTCATGTGGTAGAAGG + Intergenic
1033594330 7:142845256-142845278 CTGCATCCTCACGTGGCAGAAGG - Intergenic
1034309399 7:150073189-150073211 CTGTGTCCTCATGTGGTGGAAGG - Intergenic
1034330040 7:150274632-150274654 CTGCGTCCTCAGGTGCAGGATGG - Intronic
1034481888 7:151328081-151328103 CTGAGTCTTCATGTGATGGAAGG - Intergenic
1034668015 7:152835229-152835251 CTGCGTCCTCAGGTGCAGGATGG + Intronic
1034797460 7:154027453-154027475 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1034997609 7:155587930-155587952 CAGCATCTGAATGTGGAGCAGGG + Intergenic
1035443619 7:158924265-158924287 CGGCATCTTCCTGTGGAGCTAGG - Intronic
1035719936 8:1784378-1784400 CTGCATCCTCACGTGGTGGAGGG + Exonic
1036130200 8:6102788-6102810 CTGCCTCCTCACCTGGAGGAAGG + Intergenic
1036161497 8:6393046-6393068 ATGTATCTTCATGTGGTGGAAGG - Intergenic
1036484544 8:9167431-9167453 CTGTATCCTCATGTGGTTGAAGG + Intronic
1037371361 8:18183140-18183162 CTGACTCCTCATGTGGTGGAAGG + Intronic
1037933560 8:22899093-22899115 CTGCTTCTTCATCTGGAAAATGG + Intronic
1038161629 8:25045145-25045167 CTGCATCATTATGTGGGAGAAGG + Intergenic
1039214803 8:35258146-35258168 CTGCATCGTCACATGGAGGAAGG + Intronic
1039797862 8:40930767-40930789 CTGCATCTTCAGGTGAGAGATGG - Intergenic
1040422917 8:47257513-47257535 CTGCATCTTCACATGGCAGAAGG - Intergenic
1040946276 8:52888030-52888052 CTGCATCCTCATATGGCAGAGGG - Intergenic
1040984555 8:53279634-53279656 CTGTGTCTTCAGGTGGGGGAAGG - Intergenic
1041106352 8:54447735-54447757 GGGCATCTTTTTGTGGAGGATGG - Intergenic
1041333224 8:56751140-56751162 CTGCATCATAACATGGAGGAAGG + Intergenic
1041819211 8:62010480-62010502 CTGCATCTGCATTTGCTGGATGG - Intergenic
1042057600 8:64782387-64782409 CTGTGCCCTCATGTGGAGGAAGG - Intronic
1042295811 8:67216336-67216358 CTGCATTCTCACGTGGTGGAAGG - Intronic
1042470559 8:69182948-69182970 CTTCATCTTCATATGAAGAATGG - Intergenic
1042474684 8:69233783-69233805 CTGCATCTTTATATGGAGTAAGG + Intergenic
1043374534 8:79633610-79633632 CTGCATTTTCATGTGGCAAAAGG + Intronic
1044068581 8:87727154-87727176 CAGCATCTTCATGGAGTGGAAGG + Intergenic
1044657795 8:94566298-94566320 CCGCATCATCATGTGGTGGAAGG - Intergenic
1044958546 8:97506500-97506522 CTGCATCTTCATCTGCTGGCAGG - Intergenic
1045395266 8:101754509-101754531 CTGTGTCCTCATGTGGTGGAAGG + Intronic
1045404475 8:101852008-101852030 CTGCATCCTCACATGGTGGAAGG - Intronic
1045738773 8:105328882-105328904 CTGAGTCTTCATTTGGAGGTGGG - Intronic
1046079430 8:109353341-109353363 CTGCATCCTCACATGGTGGAAGG + Intergenic
1046751731 8:117933908-117933930 GGGCATCTTCACGTGGAGCAAGG - Intronic
1047295551 8:123567606-123567628 TTGCATCCTCAAGTGGTGGAAGG + Intergenic
1047328991 8:123867870-123867892 CTGCATCTTGATCTGGATGCTGG - Intronic
1047341320 8:123983145-123983167 CGGCATCATCATGTTGATGAGGG - Intronic
1047375669 8:124293805-124293827 CTGAATCTTCATGTGGCAGTCGG - Intergenic
1047524384 8:125619930-125619952 CAGGATCTTCATGAGCAGGATGG + Intergenic
1047633121 8:126729784-126729806 CTGCATTCTCATGTGGTGAAAGG + Intergenic
1047962558 8:130021504-130021526 CTGCATCCTCAAGTAGTGGAAGG + Intergenic
1048367479 8:133750913-133750935 CTGCATCCTCATGTGGCAGAAGG - Intergenic
1048552922 8:135450114-135450136 CTGGGACTTCATGGGGAGGAGGG + Intergenic
1048841687 8:138572348-138572370 CTGTAACCTCATATGGAGGAGGG + Intergenic
1048841795 8:138573041-138573063 CTGCATCCTAATATGGAGGAAGG + Intergenic
1048927019 8:139280553-139280575 CTGCATCCTCATGTGGTGGAAGG + Intergenic
1049361623 8:142214783-142214805 CTACATCCTCACGTGGCGGAGGG - Intronic
1052668243 9:31521587-31521609 CTGTATCCTCATGTGGTAGAAGG + Intergenic
1052852025 9:33384211-33384233 CTGTGTCTTCATGTGGTCGAAGG + Intergenic
1054704534 9:68449086-68449108 CTGTATCCTCATGTGGCAGAAGG + Intronic
1054941582 9:70748643-70748665 CTGCATCTTCATGTGGTGGAGGG - Intronic
1055616876 9:78082203-78082225 CTGCATCTTCACATGGCAGAAGG - Intergenic
1055625998 9:78178315-78178337 CTGCATCCTCATGTGGCCGAAGG + Intergenic
1055716776 9:79126543-79126565 CTCTGTCTTCATGTGGTGGAAGG - Intergenic
1056386542 9:86101563-86101585 CTGCATCAGCCTGTGGTGGAAGG + Intergenic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1056853334 9:90103180-90103202 CTGCACCTTCACATGGTGGAAGG - Intergenic
1057647440 9:96890071-96890093 CTGCCTCGGGATGTGGAGGATGG - Intergenic
1057816107 9:98296219-98296241 CTACATCTTCATGTGGCAGAAGG - Intronic
1057945638 9:99325775-99325797 CTGTGTCTTTATGTGGTGGAAGG + Intergenic
1057974391 9:99588881-99588903 CTGCATCCTCACATGGTGGAAGG - Intergenic
1058897917 9:109416032-109416054 CTAGATCTGAATGTGGAGGAAGG - Intronic
1059793371 9:117664453-117664475 CTGCATCGTCATATAGTGGAAGG + Intergenic
1060601668 9:124882263-124882285 CTGCATCCTCATCTGGAAGTGGG - Intronic
1060731727 9:126041503-126041525 CTGCATCCTCATATGGTGGAAGG - Intergenic
1060785884 9:126451386-126451408 CTGCACCTCCAGGTGGAGGAGGG + Intronic
1060889892 9:127181381-127181403 CTGCATCTTCACCTGTAGAATGG - Intronic
1061089339 9:128418161-128418183 CTGTGTCTTCATGTGGCAGAAGG + Intronic
1061548167 9:131316672-131316694 CTGCATCCTCACCTGGGGGAAGG - Intergenic
1062304142 9:135893052-135893074 CTGCAGCTTCTTGAGGAGCAGGG - Intronic
1185789035 X:2914528-2914550 CTGCATTTTCAGGTGGGGCAAGG - Intronic
1185838438 X:3367202-3367224 CTGCATCCTCATGTGGCTGAAGG + Intergenic
1186103152 X:6177940-6177962 CTGTATCCTCATGTGGTAGAAGG - Intronic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1186785718 X:12954590-12954612 CTGAATCTTGATGGGGAGGGTGG + Intergenic
1186963463 X:14762130-14762152 CTGCATCCTCACATGGTGGAAGG + Intergenic
1187057900 X:15758322-15758344 CTGCATCCTCACGTGGTGGAAGG + Intronic
1187071644 X:15894214-15894236 CTGTGTCTTCATATGGGGGAAGG + Intergenic
1187192017 X:17044251-17044273 CAGCAGCTTCATGAGCAGGAGGG + Intronic
1187412173 X:19061082-19061104 CTCCTTCCTCATATGGAGGAGGG + Intronic
1187984804 X:24798412-24798434 CATCATCTTCATGTTGAGTAGGG - Intronic
1188122894 X:26332020-26332042 CTGCATCTTAATATGGCAGAAGG - Intergenic
1188847257 X:35088381-35088403 CTGCATCATAATATGGTGGAAGG + Intergenic
1189096352 X:38144360-38144382 CTGCTTCCACTTGTGGAGGAAGG + Intronic
1189215347 X:39318375-39318397 CTGCTTCTTCATGTGGCAGAAGG + Intergenic
1189244261 X:39551064-39551086 CTGCCTCTTAAGGTAGAGGAGGG - Intergenic
1189255165 X:39632381-39632403 CTGCATCTTCACATGGCAGAAGG + Intergenic
1189302533 X:39962593-39962615 CTGCATCTTCACATGGCAGAAGG + Intergenic
1189636887 X:43020508-43020530 CTGCATCTTCACATACAGGAAGG - Intergenic
1189740147 X:44109446-44109468 CTGCATCCTCACATGGTGGAAGG + Intergenic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1192018153 X:67354461-67354483 CTGCATCCTCATATGGTGGAAGG + Intergenic
1192275268 X:69623366-69623388 CTGTATCCTCACGTGGTGGAAGG + Intronic
1192622548 X:72693655-72693677 CTGCCTTTTCCTGGGGAGGAGGG + Intronic
1192767916 X:74161543-74161565 GTGCATTTGCACGTGGAGGAGGG - Intergenic
1194173909 X:90623940-90623962 CTACATCTTCACATGGAAGAAGG + Intergenic
1194353153 X:92846926-92846948 CTGTAACTTCTTGTGGAAGATGG + Intergenic
1195305546 X:103579279-103579301 CTGCATTTTCATGTGGATTTTGG + Intronic
1195549877 X:106156161-106156183 CTGCATCTTCACATGGCAGAAGG + Intergenic
1195636707 X:107125125-107125147 CTTCATCTTCATGTTGAACAGGG - Intronic
1196366544 X:114930744-114930766 CTGCATCATAATATGGAGGAAGG + Intergenic
1197401314 X:125994842-125994864 CTGCATCATCCTGTGGTGGAAGG + Intergenic
1198120754 X:133590171-133590193 CTGCATCCTCATGTTGCAGACGG - Intronic
1198528887 X:137529653-137529675 CTGCATACTCATATGAAGGAAGG - Intergenic
1198881902 X:141291109-141291131 CTGCATCTTCACATGGTGGAAGG + Intergenic
1199235527 X:145488048-145488070 CAGCATCTTCAGGTGGTGCAGGG + Intergenic
1199497754 X:148472024-148472046 CTGCATCTTCACATGGCAGAAGG - Intergenic
1200520128 Y:4201641-4201663 CTACATCTTCACATGGAAGAAGG + Intergenic
1200661509 Y:5964015-5964037 CTGTAACTTCTTGTGGAAGATGG + Intergenic
1201492271 Y:14555368-14555390 TTGTATCCTCATGTGGTGGAAGG + Intronic
1201505601 Y:14696065-14696087 CTGCATCTTCATGTCCAGCAGGG + Intronic
1201597146 Y:15682957-15682979 CTGCATCCTCACATGGTGGAAGG - Intergenic