ID: 1078736446

View in Genome Browser
Species Human (GRCh38)
Location 11:14024919-14024941
Sequence GATTAGAACTGAAAAGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078736443_1078736446 18 Left 1078736443 11:14024878-14024900 CCTTCAAGTGACAATATAGGTAT 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1078736446 11:14024919-14024941 GATTAGAACTGAAAAGAATCTGG 0: 1
1: 0
2: 1
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078736446 Original CRISPR GATTAGAACTGAAAAGAATC TGG Intronic
902828314 1:18992792-18992814 GAGGAGAACAGATAAGAATCAGG - Intergenic
903311715 1:22463860-22463882 CATTAGAAATGGAGAGAATCTGG + Intronic
904476258 1:30766430-30766452 GCTTAGGACTGAAAAGAATTCGG + Intergenic
906363859 1:45188852-45188874 GATTAGAATTGAAAAGGAGTTGG - Intronic
907220305 1:52902451-52902473 TATTAAAACAGAAAAGAAGCCGG - Intronic
908564129 1:65336864-65336886 GATTCCCACTTAAAAGAATCAGG - Intronic
908723404 1:67149472-67149494 GATTACAACAGAAAAAAATGGGG - Intronic
909145520 1:71925365-71925387 GGTTAGAAGTGGAAAGATTCGGG - Intronic
909821678 1:80071052-80071074 GGTTAGCACTGAACAGAATACGG + Intergenic
909882259 1:80894437-80894459 GATCAATACTGAAAAAAATCAGG - Intergenic
910466100 1:87501707-87501729 GATTAGAACTGGAAAGTCTGAGG + Intergenic
914886532 1:151589352-151589374 GAGAAGAAATGAAAAGAAGCTGG - Intergenic
916094578 1:161337548-161337570 GATGAGAAATGACAAGATTCTGG + Intronic
916163389 1:161942016-161942038 TCATAGAACTGAAAAGACTCTGG + Intronic
916178157 1:162060204-162060226 GATTAGAAGTGAAATGAGCCAGG - Intergenic
916206745 1:162322348-162322370 TATTAGAAAAGAAAAGTATCTGG + Intronic
916841388 1:168604792-168604814 AATTAAAAATGAAAAGAACCTGG - Intergenic
920596346 1:207274925-207274947 GATTAAAACTTAAAAAAAACTGG - Intergenic
920980746 1:210832408-210832430 AAGTAGATCTGAAAAGACTCTGG - Intronic
921230260 1:213063131-213063153 GCTTGGAACTAAAAAGAATGGGG - Intronic
921606686 1:217164623-217164645 GATTAGAACTTAAAAGGAGGAGG - Intergenic
922157698 1:223052915-223052937 GATCAGAACTGAAAAGACCTTGG + Intergenic
922355474 1:224771117-224771139 GAATCGAACAGAAAAGATTCTGG + Intergenic
922443061 1:225672604-225672626 TATTAGAACTGGAAAGAGGCTGG - Intergenic
924332528 1:242954387-242954409 TAATAAAACTGAGAAGAATCAGG + Intergenic
1063226245 10:4017514-4017536 GAGTTGATCTGAAAATAATCAGG - Intergenic
1064064038 10:12165191-12165213 GATTTAAACAGAAAAGAATCGGG - Intronic
1068689732 10:59903616-59903638 AATTAGAACTAAAAAGAGCCAGG + Intronic
1068751201 10:60594464-60594486 GAATAAGACTGGAAAGAATCAGG - Intronic
1068988096 10:63125256-63125278 GGTTAGTACTGAGAAGACTCAGG - Intergenic
1074742158 10:116495995-116496017 GATAAGAACCAAAAAAAATCTGG + Intergenic
1075024665 10:118975763-118975785 GGTGAGAACTGGAAAGACTCAGG - Intergenic
1075252296 10:120890588-120890610 GTTTAGAACTGAACAGCCTCTGG - Intronic
1076664878 10:132081534-132081556 GATAAGAACAGACAAGACTCAGG - Intergenic
1076783247 10:132736046-132736068 GAGCAGAACTGAAAAGATACTGG + Intronic
1076943932 10:133630786-133630808 GAGTAGAACTGGATTGAATCAGG + Intergenic
1078736446 11:14024919-14024941 GATTAGAACTGAAAAGAATCTGG + Intronic
1079464891 11:20720501-20720523 GATAAGAACAGAAAAGAGGCTGG - Intronic
1079539005 11:21549688-21549710 GATTACAAATAAAAAGATTCTGG - Intronic
1080698432 11:34623384-34623406 GATTAAAAATGAAAACAATATGG - Intronic
1081403877 11:42673840-42673862 GATCATAACTAAAAAGAACCTGG - Intergenic
1081563643 11:44242209-44242231 AACTAGAAATGAGAAGAATCTGG + Intronic
1085067221 11:73507985-73508007 GATTTGAACTGAATAGTGTCTGG - Intronic
1085915467 11:80882445-80882467 CTTTAAACCTGAAAAGAATCAGG + Intergenic
1086060770 11:82697650-82697672 GTTTAAAACAGAAAAGAATAAGG - Intergenic
1086668709 11:89520105-89520127 CATTAGAACTGAAAAGGGTTGGG + Intergenic
1087575022 11:99979082-99979104 AATTATAAGTGTAAAGAATCTGG + Intronic
1087866560 11:103235002-103235024 GATGAGAAATGAAAAGAAATTGG - Intronic
1088227205 11:107634356-107634378 CACTAGAACAGAAAACAATCTGG - Intronic
1090452460 11:126818982-126819004 TATTTGAACTGAAATGAACCTGG + Intronic
1090581432 11:128164363-128164385 GATTAGAATTCAAAAGTCTCTGG + Intergenic
1093055603 12:14553082-14553104 CATTAGAACTGAAGAGTAGCTGG - Intronic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1094289836 12:28834964-28834986 GATCAGAACTGAAATCAATTAGG - Intergenic
1095202781 12:39404374-39404396 GATTAGAAATAAAAATAATGTGG + Intronic
1096126412 12:49123066-49123088 GAGTAGAACAATAAAGAATCTGG + Intergenic
1096790833 12:54043769-54043791 GATTAGATCAGATAAGATTCTGG - Intronic
1097959264 12:65516527-65516549 GATTAGTCCTGCAAAGATTCAGG - Intergenic
1098693427 12:73519847-73519869 GTTTACAACTGAAAACAGTCAGG + Intergenic
1098990076 12:77056241-77056263 GTTTAGGGCTGAAAAGTATCAGG + Intronic
1099248450 12:80222076-80222098 GTTTGGGACTGAAAAGAAACAGG - Exonic
1099846377 12:88033220-88033242 GAATAGAACTGAAGAGAATAAGG - Intronic
1100260075 12:92924749-92924771 GTTAAGAAATGAAAAGAACCAGG - Intronic
1101478136 12:105071008-105071030 AATTAGAACTGAAAAGTTTTTGG + Intronic
1104145801 12:126032680-126032702 GATTAAAACTGATAACAGTCTGG + Intergenic
1105817270 13:24048023-24048045 GAATAGAACAGAAAGGCATCAGG - Intronic
1106059038 13:26268054-26268076 GATTAGACCTCAAAAGAGTCTGG - Intronic
1106890782 13:34243269-34243291 GTTTAGAACTTGAAAGAATGTGG + Intergenic
1107189576 13:37563012-37563034 GATTTGAATTGTAATGAATCTGG + Exonic
1107666410 13:42695045-42695067 GATTATTGCTGAAAAGAATGAGG - Intergenic
1111251362 13:85605926-85605948 GATGAGACCTGAAAAGAAACAGG + Intergenic
1111782055 13:92740804-92740826 GATTAGGAAAGAAAAGAAGCAGG + Intronic
1112096840 13:96142438-96142460 AAATAAGACTGAAAAGAATCTGG + Intronic
1112911270 13:104487373-104487395 TATTAGAACAGAAAGAAATCTGG + Intergenic
1113180511 13:107619961-107619983 GATTAGGAGTGGAAAGAAACAGG + Intronic
1115604278 14:34984486-34984508 GTTTGGAAATGAAAAGAATAAGG - Intronic
1115977262 14:39010897-39010919 GATTAAAACTTAAATAAATCAGG + Intergenic
1116674320 14:47886237-47886259 TATTAGAACTAAAAATAATATGG - Intergenic
1117734235 14:58752774-58752796 GAATAGAACCGAAAAGAGTTTGG - Intergenic
1120820623 14:88908706-88908728 TGTTAGAGTTGAAAAGAATCAGG + Intergenic
1121774470 14:96581627-96581649 AATAAGAACTCAAAAGAATGGGG - Intergenic
1202927282 14_KI270724v1_random:38275-38297 GAGTAGAACTGGATTGAATCAGG - Intergenic
1124172988 15:27393363-27393385 GAAAAGAAAAGAAAAGAATCAGG + Intronic
1124582120 15:30966170-30966192 GATTAATACTGAAAATATTCAGG - Intronic
1125279661 15:38030370-38030392 GAATTAAACTGAATAGAATCTGG - Intergenic
1125649616 15:41304819-41304841 GATTTGAGTTGAAAAGAGTCAGG + Intergenic
1126916316 15:53469976-53469998 CATTAAAACTGCAAAGAATGTGG - Intergenic
1127385866 15:58466288-58466310 GATTAGAAGTAAAAAGGTTCTGG + Intronic
1127634642 15:60857762-60857784 GATTAGTACCGAAGAGAAGCTGG + Intronic
1130744327 15:86634794-86634816 TAATATAACTGAAAAGACTCTGG + Intronic
1130784501 15:87081363-87081385 GATTAGAACTGGAAAGGAAGAGG + Intergenic
1130896624 15:88175033-88175055 GAGTAGGACAGAAAAGAATTGGG + Intronic
1133107216 16:3519985-3520007 AATTAGAACTGGAAAGAAATCGG + Exonic
1133150093 16:3821569-3821591 TATTAGGACTTAAAAGAATTAGG - Intronic
1134754454 16:16654329-16654351 AATTAGAACTGAGAAGAGTATGG - Intergenic
1134991608 16:18704709-18704731 AATTAGAACTGAGAAGAGTATGG + Intergenic
1135349976 16:21720646-21720668 GATTAGAAATGCAAAGTATTAGG - Intronic
1136616759 16:31403171-31403193 TATTAAAACTGAAAACAATATGG + Intronic
1138225037 16:55286312-55286334 GATAAGAACTGAATAGACTGGGG + Intergenic
1139324565 16:66142189-66142211 CCTTAGAAATGAAAAGACTCAGG + Intergenic
1140803132 16:78507144-78507166 GAGAACAAATGAAAAGAATCAGG + Intronic
1141218352 16:82045873-82045895 TATCAGGACTGAGAAGAATCAGG - Intronic
1141720633 16:85753368-85753390 GATGAGGAGTGGAAAGAATCCGG + Intergenic
1142588719 17:991088-991110 GATTTGATCTGAAAAGTATTGGG - Intergenic
1143832278 17:9661993-9662015 GCTTGGAACTGTCAAGAATCAGG + Intronic
1144402489 17:14919526-14919548 GATTAGAAGGGAAAAAAAGCAGG - Intergenic
1148488260 17:48005274-48005296 GATTAAAACAGAAAAGAACTGGG + Intergenic
1149345860 17:55734682-55734704 GATTAGAAATGCAAAGAAAATGG - Intergenic
1153535431 18:6097303-6097325 GATTACAATTTAAAAGAATATGG + Intronic
1154141076 18:11825239-11825261 GAAGAGAACTGAAAACAATCAGG - Intronic
1154559555 18:15808184-15808206 GATTTGATCTGAAGACAATCCGG - Intergenic
1154560385 18:15819717-15819739 GATTTGATCTGAAGACAATCCGG - Intergenic
1154614851 18:16565809-16565831 GATTTGATCTGAAGACAATCCGG - Intergenic
1154632581 18:16809412-16809434 GATTTGATCTGAAGACAATCCGG - Intergenic
1154655311 18:17121558-17121580 GATTTGATCTGAAGACAATCCGG - Intergenic
1154702026 18:17760866-17760888 GATTTGATCTGAAGACAATCCGG - Intergenic
1155375622 18:25153920-25153942 CATTAGAACTGGAAATACTCAGG - Intronic
1155564998 18:27124284-27124306 GTTTACAACTGGCAAGAATCAGG - Intronic
1156007217 18:32456634-32456656 CATAGGAAATGAAAAGAATCAGG + Intronic
1156119720 18:33827517-33827539 GATTAGAGCTGCAAGGAAGCTGG + Intergenic
1160245331 18:77154501-77154523 GTTTTGAACTAAAAAGAATATGG + Intergenic
1160427827 18:78790473-78790495 GACCACAACTGAAAAGAACCTGG - Intergenic
1161006410 19:1939327-1939349 GATTAAAGCTGAAATGAATCAGG + Intergenic
1163009830 19:14418238-14418260 GATTAGATCAGGAAAGGATCCGG + Intronic
925332601 2:3070710-3070732 GCTTGGAAGTGAAATGAATCTGG - Intergenic
926264948 2:11307751-11307773 AATCAGAACTGAAAATATTCAGG + Intronic
926599683 2:14828788-14828810 GATTAGAAGTGAAAAGATGAGGG + Intergenic
927317415 2:21701128-21701150 GAGTGGAACTGAAAAGAAAAAGG - Intergenic
928039229 2:27857520-27857542 TCTTAGATCTGAAAAGAATCTGG - Intronic
928740475 2:34346429-34346451 GGTTAAAACTGAATAGAATTTGG - Intergenic
930259343 2:49126772-49126794 GATTAGAAGTGAAAAGACCTGGG - Intronic
930689773 2:54349559-54349581 GATGAGAACTGCAAAAAATAAGG - Intronic
930750755 2:54932089-54932111 GATTAGAACTGAAGATCATATGG - Intronic
931794943 2:65700242-65700264 AATTAGAACCGAAAGGAAGCAGG + Intergenic
931975746 2:67642336-67642358 GAGTAGAATTGAACAGAATGAGG - Intergenic
932391285 2:71393006-71393028 AATTAAAACTGATAATAATCTGG + Intronic
932743736 2:74313841-74313863 GAATGGAAATGAAAAGAAGCAGG + Intronic
932838579 2:75060526-75060548 CATTAGAACTGAAAAGGACATGG + Intronic
934842246 2:97634178-97634200 AATTGGAAGTAAAAAGAATCAGG + Intergenic
936277217 2:111110105-111110127 TATTAGACCTGCAAAGAAGCAGG - Intronic
936800202 2:116257237-116257259 GATTAGATTTGAAAGGAACCAGG - Intergenic
939834964 2:147118606-147118628 GAATAGAGCTGAAAACAATTTGG - Intergenic
940767154 2:157802130-157802152 GGTAACATCTGAAAAGAATCAGG + Intronic
943540782 2:189211710-189211732 GATTAAAAATGAAAATACTCAGG + Intergenic
945890938 2:215430299-215430321 GATTAGTGCTGTAAAGAAGCTGG - Intronic
946721552 2:222614109-222614131 GAAAAGAACTGAAAACATTCTGG + Intronic
947143003 2:227036942-227036964 GACAAGAACTGGAAAGAATATGG - Intronic
947707214 2:232285973-232285995 GAGAATAACTGAGAAGAATCAGG + Intronic
1171365744 20:24622967-24622989 GAATACATCTGAAAAGAATGAGG + Intronic
1171415127 20:24973025-24973047 AATTACATCTGAAAAGACTCAGG + Intronic
1171781290 20:29420955-29420977 GAGTAGAACTGGATTGAATCAGG + Intergenic
1172326039 20:34035487-34035509 GCTTAGAACCCAGAAGAATCTGG + Intronic
1179087930 21:38236986-38237008 GAGTAGAAATGAAAAGGAACTGG - Intronic
1179249401 21:39660516-39660538 GATTAGACCTCAAAAGCATGAGG - Intronic
1182162644 22:28138557-28138579 GATCAGAACAGAAAACAATCCGG + Intronic
949637635 3:6000760-6000782 GCTTGGCACTGAAAAGTATCAGG - Intergenic
950577459 3:13841094-13841116 GCTTAGAAATGAACACAATCAGG + Intronic
952110459 3:30117887-30117909 GATGAATACTGAAAAGAATAAGG - Intergenic
952667914 3:35929637-35929659 GTTTAGAACCGAAATGTATCTGG - Intergenic
957732312 3:84154922-84154944 GAATAGGTCTGAAAAGAATAGGG + Intergenic
957868607 3:86058137-86058159 GATTAGATGGAAAAAGAATCTGG - Intronic
958664866 3:97124266-97124288 GATTAATACTGAAACGCATCTGG - Intronic
959133008 3:102381515-102381537 GTAAAGAACTGAAAAGTATCTGG + Intronic
960862584 3:122167187-122167209 GATTGAAATTAAAAAGAATCAGG - Intergenic
961636039 3:128333571-128333593 CATTAGAAGTGAATGGAATCAGG + Intronic
962692925 3:137918823-137918845 GAATAAAACTGAAAAGCCTCAGG + Intergenic
963471115 3:145743123-145743145 GATGGGAAATGAAAAGAAACAGG - Intergenic
963735865 3:149017071-149017093 GTTTAGAACAGAAAAGGAACTGG - Intronic
966719989 3:183053111-183053133 GACTAGACCTAAACAGAATCAGG - Intronic
966741761 3:183240831-183240853 GATTAGAACTTGAAAGAAAGTGG - Intronic
968000285 3:195200906-195200928 GTTTAGAAGTGAAGAAAATCAGG + Intronic
970456877 4:16232609-16232631 GCTTAGAACTGAAAAGAAAACGG - Intergenic
971637928 4:29087381-29087403 GTTAAGAACAGAAAAGAAACAGG + Intergenic
972243617 4:37221379-37221401 GATTGAAACTGATAAAAATCAGG - Intergenic
973223424 4:47754725-47754747 GATTTGCACTGAAGAGAAACAGG + Intronic
975220355 4:71806725-71806747 AATTAGAACTGATAACAGTCTGG - Intergenic
975799663 4:78047035-78047057 GTTTAGAACCGAAAAGTATATGG - Intergenic
976327480 4:83788462-83788484 GATGAGAACTCAAAAGAAAGAGG - Intergenic
977329166 4:95615061-95615083 GATTAGAATTGATATGAAACCGG + Intergenic
978218242 4:106234677-106234699 GACAAGAAATGAAAAAAATCTGG + Intronic
979414614 4:120420762-120420784 GATTAGATCTGATAAGAAAATGG + Intergenic
979680309 4:123452259-123452281 AATTATAATTCAAAAGAATCAGG - Intergenic
979924418 4:126542776-126542798 GATTAGAGCTGAAGAAAATGTGG + Intergenic
980039834 4:127926448-127926470 GAATAGAAGAGAAAAGAATAAGG - Intronic
980415108 4:132477503-132477525 GACAAGAAGTGAATAGAATCTGG - Intergenic
980878674 4:138687535-138687557 GATTAGAAAAGAAAGGAACCAGG + Intergenic
981674764 4:147329415-147329437 AATTAGAACTTTAAAAAATCTGG - Intergenic
982724433 4:158890689-158890711 GATGAGAAGTCAAAAGAATTAGG + Intronic
984333245 4:178354425-178354447 TAATAGAACTCAAAAGAATTGGG - Intergenic
984469078 4:180142958-180142980 GATTAGAAGTGAAAAGGTTCTGG + Intergenic
984523594 4:180829827-180829849 CATGAGAACTGAAAAGAATATGG + Intergenic
985234159 4:187854627-187854649 GAATATAAATGAAAAAAATCGGG + Intergenic
985447286 4:190031243-190031265 GAGTAGAACTGGATTGAATCAGG + Intergenic
986602116 5:9482768-9482790 AAGTGGAACTGAAAAGAAGCTGG + Intronic
988897804 5:35696989-35697011 GGTGAGAAAGGAAAAGAATCAGG + Intronic
988931367 5:36038780-36038802 GATCATGGCTGAAAAGAATCTGG - Intronic
990345058 5:54863641-54863663 GATTCTAACTGAAAAGCATGAGG - Intergenic
991640548 5:68747411-68747433 GGTTAAAACTGGAAAGAATTTGG - Intergenic
992961953 5:81964800-81964822 GATTAGGACTGAAAAGCCACAGG + Intergenic
994291955 5:98037541-98037563 TTTTAGAACTAAAAAGAATCTGG + Intergenic
994512791 5:100726780-100726802 GATTGGAAATGCAAAGAATTTGG + Intergenic
994549683 5:101215728-101215750 GAATAGAACTGGCAAGAATGAGG - Intergenic
994676644 5:102831141-102831163 GACTAGAAATCAAAAGAACCAGG - Intronic
995580249 5:113592019-113592041 GATTGGAAGGGAAAAGAGTCAGG + Exonic
996208553 5:120775540-120775562 AAATAGAAATGAACAGAATCAGG - Intergenic
996870661 5:128189247-128189269 GATTAGAACTAAAAAAAATTTGG - Exonic
996929513 5:128869316-128869338 GCTAAGAAATGAAAAGATTCAGG - Intronic
998631015 5:143898700-143898722 GATGAGAAATGAAAAGAAAAAGG - Intergenic
1001731697 5:173964914-173964936 GATTAGCAATGAACAGGATCAGG + Intergenic
1006039304 6:31240714-31240736 GAGTAAAACTGAAAAGAAATGGG + Intergenic
1007828934 6:44623484-44623506 CATTATAACTAAAAAGAAGCAGG - Intergenic
1007904664 6:45447296-45447318 TATCAGAACTGGAAAGCATCAGG - Intronic
1011051928 6:83160627-83160649 GAATTGAACTGAAAAGAATAGGG + Intronic
1011512481 6:88116239-88116261 GAAAAGCCCTGAAAAGAATCTGG - Intergenic
1011748346 6:90430283-90430305 GAGTAGAACAGAAAGGAATTGGG + Intergenic
1012270965 6:97210281-97210303 GATAATAAGTGAACAGAATCAGG + Intronic
1012567692 6:100680390-100680412 GAATACAACTGAAGAGAATAAGG + Intronic
1012979708 6:105816596-105816618 GATTTGAACTCAGAATAATCTGG - Intergenic
1016015069 6:139175601-139175623 GATTAGCACTGGAAAGGACCTGG + Intronic
1017351740 6:153450779-153450801 AATTAGAACGGAACAGAATAGGG - Intergenic
1018394360 6:163366173-163366195 AATTAAAATTAAAAAGAATCAGG - Intergenic
1019115767 6:169760846-169760868 GAGTAGAAGTGAAGAGAACCTGG + Intronic
1020582152 7:10016544-10016566 TATTAGAAATGAAAATTATCGGG - Intergenic
1020965096 7:14855703-14855725 AATTAAATATGAAAAGAATCTGG - Intronic
1024194886 7:47049126-47049148 GATTATACCTGAAAAGACTCTGG + Intergenic
1024197174 7:47070873-47070895 GATAAGAACTGAAAACATTTTGG + Intergenic
1024454980 7:49595118-49595140 TATTAGAAATGCAAAGAAGCAGG + Intergenic
1024799564 7:53060386-53060408 TCTTAGAACTGAAATGAGTCAGG - Intergenic
1026052256 7:66957006-66957028 GATTAGAAAGAAAAAGAAACAGG - Exonic
1027980320 7:85211074-85211096 AATTGGAACTGTAGAGAATCAGG - Intergenic
1028214771 7:88117991-88118013 GATTAAAAATTAAAATAATCAGG - Intronic
1030363253 7:108617759-108617781 GAATGAAACTGAAATGAATCAGG - Intergenic
1031524001 7:122801910-122801932 TATTAGAATTGATAAGACTCTGG + Intronic
1031785393 7:126024742-126024764 GATTAGAACTGAATAATATTAGG + Intergenic
1032270620 7:130401325-130401347 GATATGAACTGAAAAAAAGCAGG + Intronic
1034055331 7:148028683-148028705 AATTTGTACTAAAAAGAATCAGG + Intronic
1034071035 7:148185571-148185593 GCTTAGACCTGAGAAAAATCTGG - Intronic
1035147622 7:156835744-156835766 GAATAGAAGTGAAATGAATATGG - Intronic
1037224792 8:16572864-16572886 TATTAGAACTGGAAAGATTTGGG + Intergenic
1038465128 8:27755149-27755171 CATTACCACTGAAAAGAACCAGG + Intronic
1041199544 8:55438021-55438043 GATTAAAACTGAAAAGGTTCTGG + Intronic
1042138894 8:65659646-65659668 GATTAGATCTGACAGGAAGCGGG + Intronic
1042432954 8:68728889-68728911 GAGTAGAAGTAGAAAGAATCAGG - Intronic
1042514374 8:69644253-69644275 GATTTGAACTCAAACTAATCAGG - Intronic
1042877649 8:73454554-73454576 GATTAGGACTCAATAGAATGGGG + Intronic
1043277937 8:78424207-78424229 GATTAGAACAGAAATAAATAAGG - Intergenic
1043277938 8:78424234-78424256 GATTAGAACAGAAATAAATAAGG - Intergenic
1043888277 8:85627783-85627805 TATTAGAGCTGGAAAGAATCTGG + Intergenic
1044158571 8:88882670-88882692 GAATAAAAGTGAATAGAATCTGG - Intergenic
1044855437 8:96470397-96470419 GTTTAGAACTAAAAAGAATAAGG - Intergenic
1045882125 8:107053572-107053594 GATCAGTAATGAAAAAAATCAGG + Intergenic
1046907551 8:119589934-119589956 GATTAGAAATAAAAATAAACAGG - Intronic
1048111975 8:131477822-131477844 CTTTAGAACATAAAAGAATCTGG + Intergenic
1048635411 8:136290240-136290262 GATTAGAACAGGAATGAATCAGG + Intergenic
1048873567 8:138818318-138818340 GATTCCAACTGAAAAGTATCAGG - Intronic
1049079650 8:140431849-140431871 CCTTAAAGCTGAAAAGAATCTGG - Intronic
1049852633 8:144841362-144841384 GATTAGGACTGAAAATGAGCAGG + Exonic
1050591442 9:7164438-7164460 GATCTGAAATGAAAAGATTCTGG + Intergenic
1052818105 9:33117442-33117464 GATGAGAAATGTCAAGAATCAGG + Intronic
1053468441 9:38327167-38327189 GGTTAGAGCTGAAAGGAATTGGG - Intergenic
1055722374 9:79190030-79190052 GATTAGACATGAAAACACTCAGG - Intergenic
1055954255 9:81759452-81759474 GATTAAAAGTCAAAAAAATCTGG - Intergenic
1056397615 9:86195998-86196020 CTTTAGAACTGGAAAGGATCTGG - Intergenic
1058479376 9:105375350-105375372 GTTTTGAACTGTAAAGAATTAGG + Intronic
1058697656 9:107573437-107573459 CAATAGAACTGAAAAGAAACAGG + Intergenic
1059263326 9:113000992-113001014 GATTAGAATGGAAAAGAATCTGG + Intergenic
1061661407 9:132132599-132132621 GACTGGAAGTGACAAGAATCAGG + Intergenic
1185937216 X:4271434-4271456 GATTAAAAGTGAAATGAGTCAGG + Intergenic
1188713732 X:33434408-33434430 GTTGAGAACCGAAAAGAAACTGG + Intergenic
1190018250 X:46848131-46848153 GAATAGAAGTAAAAAGATTCAGG - Intronic
1192117479 X:68425173-68425195 GAACAGAACTGAAGGGAATCAGG + Intronic
1193392959 X:80950389-80950411 GATTTGTACTGAACAGAATGAGG + Intergenic
1196075491 X:111571180-111571202 TATAAGAAGTGATAAGAATCTGG + Intergenic
1196462749 X:115946887-115946909 GAGGGGAAATGAAAAGAATCTGG + Intergenic
1198424913 X:136507928-136507950 GATCAGACCTGAGAAGAATAAGG - Intronic
1199194884 X:145016512-145016534 GACTAGAGCTGAAAAGAGCCTGG + Intergenic
1199695296 X:150339591-150339613 GAATGGAATTGAAAAGAATGAGG + Intergenic
1201229850 Y:11853641-11853663 TAATAAAACTGAGAAGAATCAGG + Intergenic
1202171577 Y:22051242-22051264 GAGTAGAGATGAAAACAATCTGG + Intergenic
1202219785 Y:22535130-22535152 GAGTAGAGATGAAAACAATCTGG - Intergenic
1202323392 Y:23660953-23660975 GAGTAGAGATGAAAACAATCTGG + Intergenic
1202547379 Y:26009101-26009123 GAGTAGAGATGAAAACAATCTGG - Intergenic