ID: 1078742111

View in Genome Browser
Species Human (GRCh38)
Location 11:14076580-14076602
Sequence CATCATATACTCATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 811
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 774}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078742108_1078742111 9 Left 1078742108 11:14076548-14076570 CCTGACACAAAAAATTTAAATAG 0: 1
1: 0
2: 3
3: 55
4: 780
Right 1078742111 11:14076580-14076602 CATCATATACTCATGGTGGAAGG 0: 1
1: 0
2: 3
3: 33
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078742111 Original CRISPR CATCATATACTCATGGTGGA AGG Intronic
900878212 1:5361257-5361279 AAACTTATAATCATGGTGGAAGG - Intergenic
901214091 1:7544750-7544772 CAGCTTCCACTCATGGTGGAAGG + Intronic
901722474 1:11210601-11210623 CATCATTTACACATTGTGTATGG + Intronic
902905238 1:19551829-19551851 GATCTTTTACTCATGGTGGAAGG + Intergenic
903297923 1:22357306-22357328 CAACTTACAATCATGGTGGAAGG + Intergenic
905088837 1:35410053-35410075 CATCATATGATCATGGCAGAAGG + Intronic
906371749 1:45259633-45259655 AAACTTATAATCATGGTGGAAGG - Intronic
906549806 1:46655003-46655025 AATCTTACAATCATGGTGGAAGG + Intronic
906588276 1:47000250-47000272 AAACATAAAATCATGGTGGAAGG - Intergenic
907419863 1:54339974-54339996 CATCATATACTAATGCTGGAAGG + Intronic
907807970 1:57840607-57840629 AAACTTATAATCATGGTGGAAGG + Intronic
907877982 1:58513273-58513295 AAACTTATAATCATGGTGGAAGG - Intronic
908211447 1:61904692-61904714 AAACTTATAATCATGGTGGAAGG + Intronic
908426187 1:64009742-64009764 CATCAAATGCTCATCGTGAAAGG - Intronic
909023898 1:70461694-70461716 AAACATACAATCATGGTGGAAGG - Intergenic
909237870 1:73176417-73176439 CATCATATATTGATGCTGGCCGG + Intergenic
909740693 1:79026192-79026214 AAACTTATAATCATGGTGGAAGG - Intergenic
909830057 1:80176679-80176701 AAACTTATAATCATGGTGGAAGG - Intergenic
909834379 1:80234717-80234739 AAACTTATAATCATGGTGGAAGG - Intergenic
910028780 1:82690173-82690195 GATCTCATAATCATGGTGGAGGG + Intergenic
910395282 1:86787124-86787146 AAGCTTATAATCATGGTGGAAGG - Intergenic
910540401 1:88349648-88349670 AAACATAGAATCATGGTGGAAGG + Intergenic
910685000 1:89907069-89907091 CAGCATTTACTCATGCAGGAAGG + Intronic
910833822 1:91487276-91487298 GAGCTTTTACTCATGGTGGAAGG + Intergenic
911023893 1:93416563-93416585 AAACATACAATCATGGTGGAAGG - Intergenic
911032365 1:93503202-93503224 AAACTTATAATCATGGTGGAAGG + Intronic
911228339 1:95332507-95332529 AAACTTATAATCATGGTGGAAGG - Intergenic
911243538 1:95491472-95491494 AAACTTATAATCATGGTGGAAGG + Intergenic
911511339 1:98810365-98810387 AAACTTATAATCATGGTGGAAGG + Intergenic
911698801 1:100926384-100926406 AATCTTACAGTCATGGTGGAAGG + Intronic
911833238 1:102581549-102581571 AAACTTATAATCATGGTGGAAGG + Intergenic
912191942 1:107351410-107351432 GAGCTTTTACTCATGGTGGAAGG + Intronic
912313316 1:108644819-108644841 CAACATGTACTCAGGGTGGTCGG - Intronic
916218245 1:162417366-162417388 GAGCTTTTACTCATGGTGGAAGG + Intergenic
916649158 1:166818944-166818966 AAGCTTTTACTCATGGTGGAAGG + Intergenic
916904812 1:169271468-169271490 CATGATATAATAATGGTTGAAGG - Intronic
916951071 1:169780928-169780950 CTGCATACACTCATGGTTGAAGG - Intronic
917642887 1:176999865-176999887 AATCTTATAAACATGGTGGATGG - Intronic
918437311 1:184528995-184529017 CTCCATATACTGCTGGTGGAAGG - Intronic
918877717 1:190071005-190071027 AAACTTATAATCATGGTGGAAGG + Intergenic
919177065 1:194032698-194032720 AAGCTTTTACTCATGGTGGAAGG + Intergenic
919408627 1:197215731-197215753 AAACATACAGTCATGGTGGAAGG - Intergenic
919468264 1:197948344-197948366 TATCATATAGTCATTGTGGTTGG + Intergenic
919761643 1:201101928-201101950 CAACATATGCTGATGGAGGAGGG - Intronic
920741553 1:208585874-208585896 AAACTTACACTCATGGTGGAAGG - Intergenic
921216688 1:212943766-212943788 AAACTTATAATCATGGTGGAAGG - Intergenic
921284852 1:213600146-213600168 AAACTTACACTCATGGTGGAAGG - Intergenic
921510484 1:216022084-216022106 GAGCTTTTACTCATGGTGGAAGG - Intronic
921649363 1:217658364-217658386 AAGCTTTTACTCATGGTGGAAGG - Intronic
921678817 1:218007693-218007715 CAACATATACCCAAGGTGGCTGG - Intergenic
921758187 1:218882997-218883019 AAACTTATAATCATGGTGGAAGG + Intergenic
921833775 1:219757365-219757387 AAACTTTTACTCATGGTGGAAGG - Intronic
921897399 1:220414677-220414699 GAACTTTTACTCATGGTGGAAGG - Intergenic
921981899 1:221267910-221267932 AAGCTTTTACTCATGGTGGAAGG + Intergenic
922170717 1:223152196-223152218 GAGCTTTTACTCATGGTGGAAGG - Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
922358835 1:224802316-224802338 GACCTTTTACTCATGGTGGAAGG - Intergenic
923100007 1:230806674-230806696 AAACATATAATCATGGCGGAAGG + Intergenic
923172211 1:231428527-231428549 AAACATACAATCATGGTGGAAGG + Intergenic
923415191 1:233749682-233749704 GAGCTTTTACTCATGGTGGAAGG - Intergenic
924199425 1:241643335-241643357 GAGCTTTTACTCATGGTGGAAGG - Intronic
924287519 1:242503359-242503381 GAGCTTTTACTCATGGTGGAAGG - Intronic
924327389 1:242909460-242909482 CTGCTTCTACTCATGGTGGAAGG - Intergenic
1063085060 10:2809322-2809344 AATCATGCAATCATGGTGGAAGG - Intergenic
1063728543 10:8668352-8668374 AAACTTATAATCATGGTGGAAGG + Intergenic
1064304123 10:14149977-14149999 AAGCTTATAATCATGGTGGAAGG + Intronic
1064577766 10:16763353-16763375 GAGCTTTTACTCATGGTGGAAGG + Intronic
1064580791 10:16790859-16790881 AAACTTATAATCATGGTGGAAGG - Intronic
1064983465 10:21187193-21187215 AAACTTATAATCATGGTGGAAGG - Intergenic
1065448145 10:25824128-25824150 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1066264434 10:33761985-33762007 GATCTTCTAATCATGGTGGAAGG - Intergenic
1066719814 10:38325676-38325698 CATCATATTAACATGGTAGAGGG - Intergenic
1067364230 10:45610160-45610182 CATCATGTCCACATGGTGGAAGG - Intergenic
1067679257 10:48417606-48417628 CATCCTTTTCTCATGGTGAAAGG + Intronic
1067819341 10:49513582-49513604 AAACTTATAATCATGGTGGAAGG + Intronic
1068484460 10:57639600-57639622 CATTGTATAAACATGGTGGAAGG - Intergenic
1068781643 10:60925151-60925173 AAGCTTATAATCATGGTGGAAGG - Intronic
1068781933 10:60928958-60928980 AATCTTAAAATCATGGTGGAGGG + Intronic
1069077205 10:64051259-64051281 AAACTTATAATCATGGTGGAAGG + Intergenic
1069398562 10:68017016-68017038 CATCATAGCCTGATGGTGGTTGG + Intronic
1074189867 10:111126307-111126329 CATGATGCAATCATGGTGGAGGG - Intergenic
1074691859 10:116013183-116013205 CATCAAATTCTCTGGGTGGAGGG - Intergenic
1074855153 10:117467953-117467975 AAACTTATAATCATGGTGGAAGG + Intergenic
1075293368 10:121250540-121250562 CCTGAGATACTCATGGTGGAAGG + Intergenic
1075359083 10:121813529-121813551 CAGCACATACTCATGTTAGAGGG + Intronic
1075417700 10:122277573-122277595 CTGCTTGTACTCATGGTGGAAGG + Intronic
1076012104 10:126997420-126997442 AATCTTATAATTATGGTGGAAGG + Intronic
1078187565 11:9065425-9065447 AAACTTATAATCATGGTGGAAGG - Intronic
1078319954 11:10325440-10325462 GAACATATACTCCTGCTGGATGG + Intronic
1078742111 11:14076580-14076602 CATCATATACTCATGGTGGAAGG + Intronic
1079147471 11:17866850-17866872 CATCTTACACTGATGGTGGCAGG + Intronic
1079570935 11:21942524-21942546 AAACTTATAATCATGGTGGAAGG - Intergenic
1079747133 11:24147865-24147887 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1079850972 11:25533988-25534010 AAACTTATAATCATGGTGGAAGG + Intergenic
1080053724 11:27883810-27883832 AAACTTACACTCATGGTGGAAGG + Intergenic
1080480732 11:32647226-32647248 AAGCTTTTACTCATGGTGGAAGG + Intronic
1080577493 11:33613506-33613528 GAGCTTTTACTCATGGTGGAAGG + Intronic
1081032265 11:38098846-38098868 TAACTTATAATCATGGTGGAAGG + Intergenic
1081208249 11:40300050-40300072 GAGCTTCTACTCATGGTGGAAGG + Intronic
1081265311 11:41014092-41014114 CTTCATCTATGCATGGTGGAAGG + Intronic
1081688909 11:45062260-45062282 CAACATAAACTGACGGTGGAGGG - Intergenic
1082249426 11:49962378-49962400 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1082561538 11:54625961-54625983 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1082878498 11:58014084-58014106 AAACTTATAATCATGGTGGAAGG + Intergenic
1082886953 11:58095531-58095553 AAACTTATAATCATGGTGGAAGG + Intronic
1084578851 11:70009683-70009705 AAGCTTCTACTCATGGTGGAAGG + Intergenic
1084670217 11:70602172-70602194 GAGCTTTTACTCATGGTGGAAGG - Intronic
1085145602 11:74192795-74192817 AAGCTTATAATCATGGTGGAAGG - Intronic
1085404801 11:76255384-76255406 CCTCCTAGATTCATGGTGGAGGG + Intergenic
1086302107 11:85438055-85438077 GAGCTTCTACTCATGGTGGAAGG + Intronic
1086418985 11:86619102-86619124 GAGCTTTTACTCATGGTGGAAGG - Intronic
1086601624 11:88641110-88641132 AAGCTTTTACTCATGGTGGAAGG + Intronic
1086772074 11:90778720-90778742 CATCAAGTCCTCATGGGGGAAGG - Intergenic
1086988906 11:93281096-93281118 CATGATATCCTCATGGGGAAGGG + Intergenic
1087026447 11:93654467-93654489 AAACTTATAATCATGGTGGAAGG - Intergenic
1087423261 11:97959505-97959527 AAACTTATAATCATGGTGGAAGG + Intergenic
1087429374 11:98033050-98033072 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1088820136 11:113449496-113449518 CATGATCTGCTCATGTTGGAAGG - Intronic
1088943032 11:114479904-114479926 AAGCTTATAATCATGGTGGAAGG + Intergenic
1091471308 12:730551-730573 AAACTTATAATCATGGTGGAAGG + Intergenic
1092310131 12:7343504-7343526 AAGCTTATAATCATGGTGGAAGG + Intergenic
1093188499 12:16049073-16049095 AACCATATAATCATGGCGGAAGG - Intergenic
1093191280 12:16077882-16077904 CTTCTTCCACTCATGGTGGAAGG - Intergenic
1093596726 12:20971537-20971559 AAACTTATACTCATGGTGGAAGG - Intergenic
1093906852 12:24703206-24703228 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1094595263 12:31859770-31859792 AAACTTATAATCATGGTGGAAGG + Intergenic
1096565826 12:52478008-52478030 AAACTTATAATCATGGTGGAAGG - Intergenic
1096969060 12:55650978-55651000 AAACTTATAATCATGGTGGAAGG - Intergenic
1097894115 12:64807272-64807294 AAACTTATAATCATGGTGGAAGG - Intronic
1098675060 12:73279548-73279570 AAACTTATAATCATGGTGGAAGG - Intergenic
1098687021 12:73434594-73434616 CATCTTATGCTGATGGTGGCAGG + Intergenic
1098719983 12:73884115-73884137 AAACTTATAATCATGGTGGAAGG - Intergenic
1099054980 12:77828261-77828283 CTGCATCTACCCATGGTGGAAGG - Intergenic
1099324466 12:81196713-81196735 CAGCCTACAATCATGGTGGAAGG + Intronic
1099352191 12:81587384-81587406 AAACTTATAATCATGGTGGAAGG - Intronic
1099492951 12:83308259-83308281 AAACATACAATCATGGTGGAAGG - Intergenic
1099505557 12:83471752-83471774 AATCTTCTACTCATGGTGGAAGG - Intergenic
1099608074 12:84829821-84829843 AAACATATACTTATGGTGGAAGG - Intergenic
1099645373 12:85346968-85346990 AATCTTATAATCATGGTGGAAGG + Intergenic
1099790941 12:87332651-87332673 CTTCATCTTCACATGGTGGAAGG - Intergenic
1099990231 12:89713694-89713716 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1100119231 12:91348855-91348877 GATCAGATACTGAGGGTGGAAGG + Intergenic
1100139493 12:91599618-91599640 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1100194321 12:92227077-92227099 CAGTTTTTACTCATGGTGGAAGG - Intergenic
1100437415 12:94584337-94584359 GAGCTTTTACTCATGGTGGAAGG - Intronic
1100919161 12:99462912-99462934 GAACCTTTACTCATGGTGGAAGG - Intronic
1101021321 12:100557223-100557245 GAGCTTTTACTCATGGTGGAAGG + Intronic
1101791717 12:107933715-107933737 CAGGAAATAATCATGGTGGAAGG + Intergenic
1101982570 12:109420455-109420477 AAACATACAATCATGGTGGAAGG + Intronic
1102894075 12:116584589-116584611 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1103230564 12:119326965-119326987 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1103739706 12:123082945-123082967 CATCATATAATCATGGTAAGTGG + Intronic
1104100939 12:125608987-125609009 CAACTTACAATCATGGTGGAAGG + Intronic
1104538098 12:129637592-129637614 GAGCTTTTACTCATGGTGGAAGG - Intronic
1104742140 12:131185396-131185418 AAACTTATAATCATGGTGGAAGG + Intergenic
1105440478 13:20411267-20411289 CTTCATATGATAATGGTGGACGG - Intronic
1105730659 13:23212103-23212125 AAACTTATAATCATGGTGGAAGG - Intronic
1106439895 13:29757057-29757079 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1106577324 13:30987696-30987718 CATCCTCTATTCATGGGGGAGGG - Intergenic
1106718648 13:32417448-32417470 AAACTTATAATCATGGTGGAAGG - Intronic
1106850080 13:33780890-33780912 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1107069655 13:36256361-36256383 AAACTTATAATCATGGTGGAAGG + Intronic
1107298412 13:38939702-38939724 AAGCTTATAATCATGGTGGAAGG + Intergenic
1107366838 13:39688419-39688441 AAGCATAGAGTCATGGTGGAAGG + Intronic
1108128999 13:47276862-47276884 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1108263903 13:48685164-48685186 GAGCTTTTACTCATGGTGGAAGG + Intronic
1108920566 13:55668708-55668730 AAACTTATAATCATGGTGGAAGG + Intergenic
1109034713 13:57241701-57241723 CAGCTTGTACTCATGGTTGAAGG + Intergenic
1109132200 13:58601593-58601615 CAACTTACAATCATGGTGGAAGG + Intergenic
1109771921 13:66986099-66986121 AAACTTATAATCATGGTGGAAGG + Intronic
1109890224 13:68602144-68602166 GAGCCTTTACTCATGGTGGAAGG - Intergenic
1110033985 13:70655123-70655145 AAACTTATAGTCATGGTGGAGGG - Intergenic
1110182661 13:72635941-72635963 CTGCCTCTACTCATGGTGGAAGG - Intergenic
1110690028 13:78422157-78422179 CTTGCTAGACTCATGGTGGAGGG + Intergenic
1110868403 13:80422876-80422898 AAACTTATAATCATGGTGGAAGG + Intergenic
1110893515 13:80719806-80719828 AAACATACAATCATGGTGGAAGG + Intergenic
1111020288 13:82439401-82439423 AAACATATAATCATGGTGGAAGG - Intergenic
1111435088 13:88196313-88196335 AACCATATTATCATGGTGGAAGG - Intergenic
1111566956 13:90028748-90028770 CAACTTAAAATCATGGTGGAAGG - Intergenic
1111602207 13:90488914-90488936 AAACTTATAATCATGGTGGAAGG - Intergenic
1112114148 13:96334355-96334377 GATCTTTCACTCATGGTGGAAGG - Intronic
1112568355 13:100570336-100570358 AATCTTATAATCATGGCGGAAGG + Intronic
1112785478 13:102946893-102946915 AAACTTATAGTCATGGTGGAAGG - Intergenic
1112799459 13:103094083-103094105 CATGATGTTCTCATGGTGGTGGG - Intergenic
1113146082 13:107209055-107209077 CAGCATATCCACATGGGGGAGGG + Intronic
1113202961 13:107887309-107887331 AAACTTATAATCATGGTGGAAGG + Intergenic
1113238822 13:108313879-108313901 AAACTTATAATCATGGTGGAAGG - Intergenic
1114383282 14:22231471-22231493 AAGCTTATAATCATGGTGGAAGG + Intergenic
1114676686 14:24445300-24445322 AAACTTATAATCATGGTGGAAGG - Intergenic
1114764234 14:25352063-25352085 CTGCTTCTACTCATGGTGGAAGG + Intergenic
1115116190 14:29883071-29883093 GACCTTTTACTCATGGTGGAAGG + Intronic
1115249230 14:31328951-31328973 AAACATACAATCATGGTGGAAGG + Intronic
1115289111 14:31750920-31750942 AAACTTATAATCATGGTGGAAGG + Intronic
1115525665 14:34278339-34278361 AAACTTATAATCATGGTGGAAGG - Intronic
1115715300 14:36097028-36097050 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1116104457 14:40483408-40483430 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1116369924 14:44117404-44117426 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1116397073 14:44459197-44459219 AAACTTATAGTCATGGTGGAAGG - Intergenic
1117281239 14:54243048-54243070 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1117283812 14:54266633-54266655 AAACTTATAATCATGGTGGAAGG - Intergenic
1117933375 14:60872133-60872155 AAGCTTTTACTCATGGTGGATGG + Intronic
1117984356 14:61373275-61373297 AAACTTATAATCATGGTGGAAGG + Intronic
1118240641 14:64054519-64054541 CATCACATGCTCATGGTCCATGG + Intronic
1118597101 14:67444200-67444222 CAACATATGCTCAAGGTGGTCGG - Intergenic
1118804516 14:69223953-69223975 GAGCTTTTACTCATGGTGGAAGG + Intronic
1120000913 14:79302393-79302415 AAGCTTTTACTCATGGTGGAAGG + Intronic
1120391266 14:83911218-83911240 AAACTTATAATCATGGTGGAAGG - Intergenic
1120404918 14:84083195-84083217 AAACTTATAATCATGGTGGAAGG + Intergenic
1120535376 14:85688762-85688784 AAACTTATAATCATGGTGGAAGG - Intergenic
1120591088 14:86373742-86373764 AATCTTACAATCATGGTGGAAGG - Intergenic
1120620241 14:86753956-86753978 AAACTTATAATCATGGTGGATGG + Intergenic
1120715929 14:87840695-87840717 CAGCATCTACTCATGGCAGAAGG + Intronic
1120717979 14:87860642-87860664 AAGCTTTTACTCATGGTGGAAGG + Intronic
1120858624 14:89234700-89234722 TCTCCTTTACTCATGGTGGAAGG - Intronic
1121210407 14:92204111-92204133 CTGCTTCTACTCATGGTGGAAGG - Intergenic
1121580007 14:95023089-95023111 AAACTTATAATCATGGTGGAAGG + Intergenic
1121888145 14:97563389-97563411 AAGCTTATAATCATGGTGGAAGG - Intergenic
1121994169 14:98589034-98589056 AAACTTATAATCATGGTGGAAGG - Intergenic
1122565678 14:102653776-102653798 AAACTTATAATCATGGTGGAAGG - Intronic
1123167606 14:106341386-106341408 AAACTTATAATCATGGTGGAAGG - Intergenic
1123170226 14:106366099-106366121 AAACTTATAATCATGGTGGAAGG - Intergenic
1123815848 15:23978063-23978085 AAACTTATACTCATGGCGGAAGG + Intergenic
1124106720 15:26745000-26745022 GAACTTTTACTCATGGTGGATGG + Intronic
1124507303 15:30289438-30289460 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1124607629 15:31182905-31182927 AAACTTATAATCATGGTGGAAGG + Intergenic
1124716851 15:32071728-32071750 AAGCTTATAATCATGGTGGAAGG - Intronic
1124736252 15:32249221-32249243 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1124946389 15:34270905-34270927 AAACTTATAATCATGGTGGAAGG + Intronic
1126441772 15:48697320-48697342 CAACTTACAATCATGGTGGAAGG - Intergenic
1126953309 15:53906812-53906834 AAACTTATAATCATGGTGGAAGG + Intergenic
1127770790 15:62229003-62229025 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1128750587 15:70146214-70146236 AAGCTTATACTAATGGTGGAAGG + Intergenic
1129560124 15:76557621-76557643 AAACTTATAGTCATGGTGGAAGG - Intronic
1129715528 15:77846400-77846422 AAACTTATAATCATGGTGGAAGG - Intergenic
1129901191 15:79150685-79150707 AAACTTATAATCATGGTGGAAGG + Intergenic
1130349118 15:83075008-83075030 CTGCTTCTACTCATGGTGGAAGG + Intergenic
1130582770 15:85153320-85153342 AAACTTATAATCATGGTGGAAGG - Intergenic
1130812436 15:87393984-87394006 CAGCTTCCACTCATGGTGGAAGG + Intergenic
1130982261 15:88820933-88820955 AAGCATACAATCATGGTGGAAGG + Intronic
1131506231 15:93022229-93022251 GAGCTTTTACTCATGGTGGAAGG + Intronic
1131929870 15:97429788-97429810 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1132113099 15:99116583-99116605 AAGCATACAGTCATGGTGGAAGG + Intronic
1132362199 15:101225658-101225680 GAGCTTTTACTCATGGTGGAAGG - Intronic
1133404803 16:5514966-5514988 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1133703781 16:8333978-8334000 CAACTTACAATCATGGTGGAAGG - Intergenic
1133837650 16:9381024-9381046 CAGCTTCCACTCATGGTGGAAGG + Intergenic
1134126598 16:11620419-11620441 AAGCTTATAGTCATGGTGGAAGG - Intronic
1135020775 16:18961249-18961271 CTTCTTCTACTCATGGTGGAAGG + Intergenic
1135072797 16:19367177-19367199 ATGCATTTACTCATGGTGGAAGG + Intergenic
1135196067 16:20395864-20395886 CTGCTTCTACTCATGGTGGAAGG - Intronic
1136594000 16:31234463-31234485 AAACTTATAATCATGGTGGAAGG + Intergenic
1136844834 16:33568054-33568076 AAACTTATAATCATGGTGGAAGG - Intergenic
1137358518 16:47791130-47791152 AAACATACAATCATGGTGGAAGG + Intergenic
1138153425 16:54680462-54680484 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1138578602 16:57924885-57924907 GAGCTTGTACTCATGGTGGAAGG - Intronic
1138797388 16:59985568-59985590 AAACTTATAATCATGGTGGATGG - Intergenic
1139041207 16:63001213-63001235 AAACTTATAGTCATGGTGGAAGG - Intergenic
1139163100 16:64535026-64535048 CAACTTACAGTCATGGTGGAAGG - Intergenic
1139193364 16:64890715-64890737 CTTGATAGACTCAAGGTGGAGGG - Intergenic
1139620872 16:68141191-68141213 CTTCATCTACTCATGGCTGATGG + Intronic
1140331509 16:74061661-74061683 AAACTTATAATCATGGTGGAAGG - Intergenic
1140465840 16:75181783-75181805 AAACTTATACTCATGGTGGAAGG + Intergenic
1140556253 16:75924838-75924860 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1141337545 16:83171153-83171175 AAACTTATAGTCATGGTGGAAGG + Intronic
1141511926 16:84517958-84517980 CTTCATGTACTCATGATGGTTGG + Intronic
1141908126 16:87041057-87041079 CATCATTCCCTCATGGTGGAGGG - Intergenic
1203155002 16_KI270728v1_random:1868352-1868374 AAACTTATAATCATGGTGGAAGG - Intergenic
1143424278 17:6821421-6821443 AAACTTATAATCATGGTGGAAGG - Intronic
1143626973 17:8116006-8116028 CATCTTATACACATGGTGCCAGG - Intronic
1144091172 17:11857879-11857901 GAGCTTCTACTCATGGTGGAAGG - Intronic
1144566241 17:16361950-16361972 CATCATTTGCACATTGTGGATGG + Intergenic
1146099325 17:29963993-29964015 AAGCTTATAATCATGGTGGAAGG - Intronic
1149113662 17:53064288-53064310 AAACTTATAATCATGGTGGAAGG - Intergenic
1149135685 17:53360483-53360505 AAACATAAAATCATGGTGGAAGG - Intergenic
1149619125 17:58028811-58028833 GAGCTTTTACTCATGGTGGATGG - Intergenic
1150933432 17:69610201-69610223 AATCTTACAATCATGGTGGAAGG + Intergenic
1151431181 17:74064341-74064363 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1152326400 17:79641920-79641942 AAACTTATAATCATGGTGGAAGG - Intergenic
1153067097 18:1058611-1058633 AATCTTATAATCATGGTGGAAGG + Intergenic
1153082027 18:1238398-1238420 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1153189524 18:2522154-2522176 CATGACTTTCTCATGGTGGAAGG - Intergenic
1155009930 18:21767249-21767271 AAACTTATAATCATGGTGGAAGG + Intronic
1155050184 18:22139831-22139853 CCCCAGATACCCATGGTGGAGGG + Intergenic
1155276007 18:24188103-24188125 TATCACATACTCATTGAGGAAGG + Intronic
1155746707 18:29362919-29362941 AAACTTATAGTCATGGTGGAAGG - Intergenic
1155816968 18:30324347-30324369 TAGCTTATTCTCATGGTGGAGGG + Intergenic
1156485222 18:37461353-37461375 AAACTTATAATCATGGTGGAAGG + Intronic
1156814956 18:41298534-41298556 GAGCGTTTACTCATGGTGGAAGG - Intergenic
1158124510 18:54086654-54086676 CCTAATATACTCATGGTGGAAGG + Intergenic
1158207646 18:55011277-55011299 CAGGAAATACACATGGTGGAAGG - Intergenic
1158328481 18:56336046-56336068 AAGCCTATAATCATGGTGGAAGG - Intergenic
1158689088 18:59644199-59644221 CATTAGATTCTCATGGTGGCAGG - Intronic
1159245992 18:65806009-65806031 TACAATAGACTCATGGTGGAGGG + Intronic
1159695491 18:71552139-71552161 GAGCTTATACTCATGGTGGAAGG - Intergenic
1160353100 18:78201748-78201770 AAACTTATAATCATGGTGGAAGG - Intergenic
1162002616 19:7756775-7756797 AAACTTATAATCATGGTGGAAGG - Intergenic
1164411967 19:28013810-28013832 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1165271243 19:34709498-34709520 CAGCACATACTCAAGGTGGGAGG - Intergenic
1165371592 19:35410722-35410744 AAACATAGAATCATGGTGGAAGG + Intergenic
1167981096 19:53276443-53276465 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1167985016 19:53307303-53307325 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1168647905 19:58072810-58072832 AAGCTTTTACTCATGGTGGAAGG - Intronic
925110119 2:1328004-1328026 AAACTTTTACTCATGGTGGAAGG + Intronic
925258484 2:2509665-2509687 GAGCTTCTACTCATGGTGGAAGG + Intergenic
925292065 2:2754740-2754762 AAACATACAATCATGGTGGAAGG - Intergenic
925474132 2:4193589-4193611 AAACATATAATCATGGTGGAAGG + Intergenic
925612567 2:5714432-5714454 CATCATACACACATTCTGGAAGG - Intergenic
925795055 2:7532202-7532224 AATCTTACAATCATGGTGGAAGG + Intergenic
926616269 2:14999610-14999632 AAACTTATAATCATGGTGGAAGG - Intergenic
928816570 2:35302497-35302519 CAGCTTTTACTCATGATGGAAGG - Intergenic
929519456 2:42634404-42634426 CAACTTACAATCATGGTGGAAGG + Intronic
929767628 2:44860630-44860652 AAGCTTATAATCATGGTGGAAGG - Intergenic
930237466 2:48901872-48901894 AAACTTATAATCATGGTGGAAGG + Intergenic
930727016 2:54692380-54692402 GAGCCTTTACTCATGGTGGAAGG - Intergenic
930772772 2:55144396-55144418 GAGCATTTACTCATGGTGGAAGG + Intergenic
931369857 2:61651992-61652014 CAGCTTATAGTCATGATGGAAGG + Intergenic
931529875 2:63201225-63201247 AAACTTATAATCATGGTGGAAGG - Intronic
931983639 2:67720986-67721008 AAACTTATAATCATGGTGGAAGG - Intergenic
932325727 2:70860305-70860327 AAGCTTTTACTCATGGTGGAAGG - Intergenic
932527028 2:72481168-72481190 AAACTTATAATCATGGTGGAAGG - Intronic
932603445 2:73146280-73146302 GAGCTTTTACTCATGGTGGAAGG - Intronic
932846081 2:75137099-75137121 CCTTGTATACTCATGGTGCATGG + Intronic
932908629 2:75782427-75782449 AAACTTATAATCATGGTGGAAGG + Intergenic
933091880 2:78130655-78130677 GAGCATTTACTCATGGTGGAAGG - Intergenic
933374642 2:81464073-81464095 GAGCTTTTACTCATGGTGGAGGG + Intergenic
933374646 2:81464096-81464118 AATCTTTTACCCATGGTGGAGGG + Intergenic
933629383 2:84638828-84638850 GAGCTTTTACTCATGGTGGAAGG + Intronic
934933525 2:98447223-98447245 CATCAACTACTCATGGTGTCAGG + Intronic
935189335 2:100763389-100763411 AAACTTATAATCATGGTGGAAGG - Intergenic
935799370 2:106678242-106678264 CATCATATAATAATGTTGGCAGG - Intergenic
935813682 2:106826301-106826323 AAGCTTTTACTCATGGTGGAAGG + Intronic
936161678 2:110088061-110088083 AATCTTACAATCATGGTGGAAGG - Intronic
936182985 2:110283293-110283315 AATCTTACAATCATGGTGGAAGG + Intergenic
936941005 2:117883876-117883898 AAACTTATAATCATGGTGGAAGG - Intergenic
936977610 2:118235230-118235252 AAGCATTTAATCATGGTGGAAGG - Intergenic
937270973 2:120652420-120652442 CCTCATAGACTCATGGTGCTTGG - Intergenic
937462914 2:122104730-122104752 GAACTTATAATCATGGTGGAAGG + Intergenic
937777959 2:125803650-125803672 AAACTTATAATCATGGTGGAAGG + Intergenic
937818797 2:126284837-126284859 CTGCATCTATTCATGGTGGAGGG - Intergenic
937889363 2:126925446-126925468 AAACTTATAATCATGGTGGAAGG - Intergenic
938870847 2:135474583-135474605 AAGCTTTTACTCATGGTGGAAGG - Intronic
939037268 2:137148241-137148263 AAACTTATAATCATGGTGGAAGG - Intronic
939167344 2:138653860-138653882 AAGCTTTTACTCATGGTGGAGGG + Intergenic
939445839 2:142309616-142309638 AAACTTATAATCATGGTGGAAGG + Intergenic
939480185 2:142738683-142738705 AAACTTACACTCATGGTGGAAGG + Intergenic
939678203 2:145098190-145098212 CATCATATGCTCATGGGCTATGG - Intergenic
939781939 2:146459825-146459847 AATCTTACAATCATGGTGGAAGG + Intergenic
939808429 2:146803791-146803813 GAGCTTTTACTCATGGTGGAAGG + Intergenic
940194694 2:151080627-151080649 AACCTTTTACTCATGGTGGAAGG + Intergenic
940691814 2:156927822-156927844 AAACTTATAATCATGGTGGAAGG + Intergenic
940929515 2:159410537-159410559 GAACTTACACTCATGGTGGAAGG - Intronic
941554056 2:166953454-166953476 TACCAGACACTCATGGTGGAAGG - Intronic
941579751 2:167280261-167280283 AAACATACAGTCATGGTGGAAGG + Intergenic
942137392 2:172940537-172940559 GAGCTTTTACTCATGGTGGAAGG - Intronic
942185341 2:173420182-173420204 CATGATAAACTCCTGGAGGAAGG - Intergenic
942597877 2:177609317-177609339 GAGCTTTTACTCATGGTGGAAGG - Intergenic
942837375 2:180316230-180316252 AAGCTTTTACTCATGGTGGAGGG - Intergenic
942845331 2:180417574-180417596 AAACTTATAATCATGGTGGAAGG - Intergenic
942846283 2:180429544-180429566 AAACTTATAATCATGGTGGAAGG + Intergenic
943152671 2:184133890-184133912 AAACTTATAATCATGGTGGAAGG - Intergenic
943219169 2:185082604-185082626 AAACTTATAATCATGGTGGAAGG - Intergenic
943248279 2:185484045-185484067 AAACTTATAATCATGGTGGAAGG - Intergenic
943480591 2:188412138-188412160 AAACTTATAGTCATGGTGGAAGG + Intronic
943893391 2:193320806-193320828 GAGCTTTTACTCATGGTGGAAGG - Intergenic
944227170 2:197359730-197359752 AAGCTTCTACTCATGGTGGAAGG + Intergenic
944331278 2:198469319-198469341 GAACTTTTACTCATGGTGGAAGG + Intronic
945121955 2:206466877-206466899 AAACTTTTACTCATGGTGGAAGG + Intronic
945145402 2:206733086-206733108 CAGCTTCTACTCATGGTGGAAGG + Intergenic
945562701 2:211358372-211358394 AAACTTATAATCATGGTGGAAGG + Intergenic
945790982 2:214304987-214305009 GAACACTTACTCATGGTGGATGG - Intronic
946762217 2:223005801-223005823 AAACTTACACTCATGGTGGAAGG + Intergenic
947127096 2:226881052-226881074 AAACTTATAATCATGGTGGAAGG + Intronic
947292088 2:228586902-228586924 CATTAGCTACTCATGGTGTATGG - Intergenic
947443327 2:230142079-230142101 AAACTTACACTCATGGTGGAAGG - Intergenic
947495035 2:230628940-230628962 AAACTTATAATCATGGTGGAAGG - Intergenic
947498048 2:230653177-230653199 TATCATAGACTCTTTGTGGAGGG + Intergenic
947962242 2:234248933-234248955 CAACTTACAATCATGGTGGAAGG - Intergenic
948343600 2:237276688-237276710 AAACTTATAATCATGGTGGAAGG + Intergenic
1169307212 20:4502399-4502421 CATGTTCTTCTCATGGTGGATGG + Intergenic
1169334309 20:4742737-4742759 CTGCTTCTACTCATGGTGGAAGG - Intergenic
1169662703 20:7998041-7998063 AAACTTATAATCATGGTGGAAGG - Intronic
1169765150 20:9140724-9140746 AAGCTTTTACTCATGGTGGAAGG - Intronic
1170121974 20:12921790-12921812 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1170456626 20:16539605-16539627 AAGCTTTTACTCATGGTGGAAGG - Intronic
1171451498 20:25239097-25239119 AATCTTACAATCATGGTGGAAGG + Intergenic
1172299061 20:33835802-33835824 CTGCATCCACTCATGGTGGAAGG + Intronic
1173056867 20:39623027-39623049 AAACTTATAATCATGGTGGAAGG - Intergenic
1173240028 20:41286957-41286979 CAACTTACAGTCATGGTGGAAGG - Intronic
1173422151 20:42910886-42910908 AAACTTATAATCATGGTGGAAGG + Intronic
1173993392 20:47319894-47319916 CCTCATGTACACATGTTGGAGGG - Intronic
1175065341 20:56279895-56279917 GAGCATACAATCATGGTGGAAGG - Intergenic
1175798507 20:61787317-61787339 AAACTTATAATCATGGTGGAAGG + Intronic
1176424879 21:6542230-6542252 CCTCCTTTACTCAAGGTGGACGG - Intergenic
1176688338 21:9874915-9874937 AAACATACACTTATGGTGGAAGG + Intergenic
1176883634 21:14228735-14228757 AAACATATAATCATGGTAGAAGG - Intergenic
1176982320 21:15397552-15397574 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1177347317 21:19890614-19890636 AAACTTATAATCATGGTGGAAGG - Intergenic
1177418569 21:20826344-20826366 AAACTTATAATCATGGTGGAAGG + Intergenic
1177892478 21:26823181-26823203 AAACTTATAATCATGGTGGAAGG - Intergenic
1177922413 21:27169099-27169121 AAACTTACACTCATGGTGGAAGG - Intergenic
1178264134 21:31126714-31126736 CCTCAAATTCTCATGGCGGAGGG + Intronic
1178668146 21:34566773-34566795 AAGCTTCTACTCATGGTGGAAGG + Intronic
1179143369 21:38746855-38746877 AAACTTATAATCATGGTGGAAGG - Intergenic
1179345828 21:40556584-40556606 CAGCTTCCACTCATGGTGGAAGG + Intronic
1179399738 21:41072760-41072782 CCTCATACACTCATGCTGGGCGG - Intergenic
1179592927 21:42422766-42422788 CATGATATACTTGTGGGGGAAGG + Intronic
1179700368 21:43150539-43150561 CCTCCTTTACTCAAGGTGGACGG - Intergenic
1180102758 21:45597137-45597159 AAACTTATAGTCATGGTGGAAGG + Intergenic
1180114046 21:45684642-45684664 AAGCTTTTACTCATGGTGGAAGG - Intronic
1181506630 22:23362794-23362816 AAACTTATAATCATGGTGGAAGG - Intergenic
1182213093 22:28692957-28692979 AAACTTATAATCATGGTGGAAGG - Intronic
1182765699 22:32756733-32756755 GAGCTTCTACTCATGGTGGAAGG - Intronic
1183724230 22:39579564-39579586 AAGCTTTTACTCATGGTGGAAGG + Intronic
1184589476 22:45471981-45472003 AAACTTACACTCATGGTGGAAGG - Intergenic
1184668473 22:46000823-46000845 CATCATCTGCCCAGGGTGGAAGG - Intergenic
1184800650 22:46756829-46756851 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1185124669 22:49002052-49002074 CAGCACATGCTCATGGTTGAGGG + Intergenic
949113551 3:292714-292736 GAGCTTTTACTCATGGTGGAAGG + Intronic
949394843 3:3603626-3603648 CAACAAATATTCATGGTGCATGG + Intergenic
950201084 3:11044523-11044545 AAGCTTTTACTCATGGTGGAAGG - Intergenic
951223469 3:20094196-20094218 AATCTTACAATCATGGTGGAAGG + Intronic
951226198 3:20124362-20124384 GAACTTATACTCATGGTGCAGGG + Intronic
951469215 3:23037330-23037352 CATCACATACACAAGGTTGATGG + Intergenic
951934157 3:28003033-28003055 GAGCTTTTACTCATGGTGGAAGG + Intergenic
952188269 3:30993984-30994006 AAACTTATAATCATGGTGGAAGG + Intergenic
952739307 3:36720249-36720271 AAGCTTACACTCATGGTGGAAGG - Intronic
952784855 3:37143082-37143104 GAGCTTTTACTCATGGTGGAAGG - Intronic
952805948 3:37352268-37352290 AAACTTATAATCATGGTGGAAGG + Intronic
953049580 3:39328565-39328587 AAACTTATAATCATGGTGGAAGG + Intergenic
953127457 3:40105462-40105484 GAGCCTTTACTCATGGTGGAAGG + Intronic
953184854 3:40628374-40628396 AAACTTATAATCATGGTGGAAGG - Intergenic
953481296 3:43254545-43254567 AAACTTTTACTCATGGTGGATGG - Intergenic
953959895 3:47258710-47258732 GAGCTTTTACTCATGGTGGAAGG - Intronic
955273721 3:57527476-57527498 AAGCTTATAATCATGGTGGAAGG + Intronic
955395296 3:58553063-58553085 CAACTTACAATCATGGTGGAAGG + Intergenic
955527262 3:59833937-59833959 AAACTTATAGTCATGGTGGAAGG - Intronic
955664806 3:61338786-61338808 AAGCTTTTACTCATGGTGGAAGG - Intergenic
955879224 3:63525972-63525994 CAGCTTCTACTCATGGTAGAAGG + Intronic
956261235 3:67344083-67344105 AATCTTACAATCATGGTGGAAGG - Intergenic
956860519 3:73319235-73319257 AAACATACAATCATGGTGGAAGG - Intergenic
957016555 3:75070401-75070423 AAACATGTCCTCATGGTGGAAGG - Intergenic
957301043 3:78391296-78391318 AAACATACAATCATGGTGGAAGG - Intergenic
957375053 3:79344962-79344984 AAACTTATAATCATGGTGGAAGG - Intronic
957591683 3:82207399-82207421 AAACCTATAATCATGGTGGAAGG + Intergenic
957610026 3:82453883-82453905 CAACTTACAATCATGGTGGAAGG - Intergenic
957711174 3:83861040-83861062 AAACTTATAATCATGGTGGAAGG + Intergenic
957978679 3:87479617-87479639 AAACTTATAATCATGGTGGAAGG - Intergenic
958151832 3:89701926-89701948 AATCTTACAATCATGGTGGAAGG + Intergenic
958736608 3:98016420-98016442 AAGCTTCTACTCATGGTGGAAGG - Intronic
958846115 3:99266870-99266892 AAGCTTTTACTCATGGTGGAAGG + Intergenic
959284444 3:104390324-104390346 AAACATACAATCATGGTGGAAGG + Intergenic
959476977 3:106822962-106822984 AAACTTATAATCATGGTGGAAGG + Intergenic
959810532 3:110613816-110613838 AAACTTACACTCATGGTGGAAGG - Intergenic
960014404 3:112870736-112870758 GAGCTTTTACTCATGGTGGAAGG + Intergenic
960150524 3:114244623-114244645 GAGCTTTTACTCATGGTGGAAGG - Intergenic
960376969 3:116915061-116915083 CATCATATACTTATCTTTGATGG - Intronic
960540559 3:118857183-118857205 AAACTTATAATCATGGTGGAAGG + Intergenic
960554209 3:119009551-119009573 AAACTTATAGTCATGGTGGAAGG - Intronic
960959722 3:123061762-123061784 GAGCTTTTACTCATGGTGGAAGG + Intergenic
962657695 3:137565453-137565475 GAGCTTTTACTCATGGTGGAAGG - Intergenic
963433585 3:145240931-145240953 AAACTTACACTCATGGTGGAAGG + Intergenic
963670370 3:148244166-148244188 CATCATATACTAATGATAGTAGG + Intergenic
963700179 3:148616359-148616381 CATCATAAACATATGGGGGAAGG - Intergenic
963747103 3:149135520-149135542 AAACTTATAATCATGGTGGAAGG - Intronic
964161718 3:153653732-153653754 AAGCTTCTACTCATGGTGGATGG - Intergenic
964305225 3:155332493-155332515 CATCATATACTAAGGGCAGAGGG + Intergenic
964421246 3:156505779-156505801 GAGCTTATAATCATGGTGGAAGG + Intronic
964605911 3:158559783-158559805 AAACTTATAATCATGGTGGAAGG - Intergenic
964792882 3:160469604-160469626 AAACTTATAATCATGGTGGAAGG - Intronic
964965998 3:162494755-162494777 AAACTTATAATCATGGTGGAAGG - Intergenic
965638457 3:170808374-170808396 AAACTTATAATCATGGTGGAAGG - Intronic
965990561 3:174812019-174812041 GAGCTTTTACTCATGGTGGAAGG - Intronic
966101204 3:176270467-176270489 CTTCATCTACTCAAGGTGGAAGG - Intergenic
966507660 3:180725085-180725107 AAACTTATAATCATGGTGGAAGG - Intronic
966767004 3:183472444-183472466 AAGCTTTTACTCATGGTGGAAGG - Intergenic
967183727 3:186928567-186928589 AAACTTATAATCATGGTGGAAGG + Intergenic
967223135 3:187266050-187266072 CATCATATCAACATGATGGAGGG + Intronic
967504944 3:190243531-190243553 AATCTTTTACTCATGGTGGAAGG + Intergenic
967509526 3:190293129-190293151 AAACGTATAATCATGGTGGAAGG + Intergenic
967691023 3:192473858-192473880 CATGATATTCTCATGGTGGAGGG - Intronic
968414181 4:415587-415609 AATCATCTCCTCATAGTGGACGG + Intergenic
969095139 4:4727170-4727192 GAACTTGTACTCATGGTGGAAGG - Intergenic
969121998 4:4917706-4917728 AAACTTATAATCATGGTGGAAGG + Intergenic
970551961 4:17190606-17190628 TATCATATACTGATGGATGATGG + Intergenic
970733710 4:19140645-19140667 AACCTTATAATCATGGTGGAAGG + Intergenic
970799717 4:19958236-19958258 AAACTTACACTCATGGTGGAAGG + Intergenic
970897503 4:21120527-21120549 CAACTTATAATCATGGTGGAAGG + Intronic
971001356 4:22326390-22326412 CAACCTACAATCATGGTGGAAGG + Intergenic
971021856 4:22545322-22545344 AAACTTATAATCATGGTGGAAGG + Intergenic
971376239 4:26057949-26057971 AAGCTTTTACTCATGGTGGAAGG + Intergenic
971620045 4:28844514-28844536 AAACTTTTACTCATGGTGGAAGG - Intergenic
971716055 4:30178790-30178812 AAACTTACACTCATGGTGGAAGG + Intergenic
971753937 4:30683773-30683795 AAACTTACACTCATGGTGGAAGG - Intergenic
972254839 4:37342316-37342338 AAGCTTTTACTCATGGTGGAAGG - Intronic
972734389 4:41826585-41826607 CATCATATGGTCATGCTGGCAGG - Intergenic
972828498 4:42787674-42787696 CACCATTTCCTCATGGTAGAGGG + Intergenic
972976510 4:44642794-44642816 GAGCTTTTACTCATGGTGGAAGG - Intronic
973091129 4:46137618-46137640 CTTCTTACAATCATGGTGGAAGG - Intergenic
973580939 4:52343530-52343552 AAACTTATAATCATGGTGGAAGG + Intergenic
973953135 4:56037655-56037677 AAGCTTTTACTCATGGTGGAAGG + Intergenic
974074990 4:57160401-57160423 AATCTTACAATCATGGTGGAAGG - Intergenic
974142809 4:57909165-57909187 AAACTTACACTCATGGTGGAAGG - Intergenic
974259608 4:59508791-59508813 CAACTTACAATCATGGTGGACGG - Intergenic
974516597 4:62922478-62922500 AATCTTACAATCATGGTGGAAGG + Intergenic
974543463 4:63269435-63269457 CATGATCTTCTTATGGTGGATGG - Intergenic
975361422 4:73476040-73476062 AATCTTACAATCATGGTGGAAGG + Intergenic
975394287 4:73856946-73856968 AAGCTTTTACTCATGGTGGAAGG + Intergenic
975419483 4:74145871-74145893 GAGCATTTACTTATGGTGGAAGG - Intronic
975506395 4:75143428-75143450 AAGCTTATAATCATGGTGGAAGG + Intergenic
975804438 4:78097529-78097551 CATCTCACAATCATGGTGGAAGG + Intronic
976122039 4:81794057-81794079 AATCTTACAATCATGGTGGAAGG + Intronic
976706576 4:88025906-88025928 AAACTTATAATCATGGTGGAAGG - Intronic
976871859 4:89803825-89803847 AAGCTTATAATCATGGTGGAAGG - Intronic
977646162 4:99415194-99415216 AAACTTATAATCATGGTGGAAGG - Intronic
978100787 4:104839002-104839024 GAGCTTTTACTCATGGTGGAAGG - Intergenic
978353917 4:107850178-107850200 AAACTTATAATCATGGTGGAAGG - Intronic
978408767 4:108406777-108406799 AAGCTTACACTCATGGTGGAAGG + Intergenic
978484064 4:109229947-109229969 GAGCTTTTACTCATGGTGGAAGG + Intronic
978711682 4:111790074-111790096 CAGGATATACTCATGGGGAAAGG - Intergenic
979060753 4:116058252-116058274 AAACTTATAATCATGGTGGAAGG + Intergenic
979446870 4:120824019-120824041 CTCCTTCTACTCATGGTGGAAGG - Intronic
979603004 4:122606666-122606688 GAGCTTTTACTCATGGTGGAAGG - Intergenic
979858867 4:125668205-125668227 AAGCTTACACTCATGGTGGAAGG - Intergenic
979969414 4:127115277-127115299 AAACTTATAATCATGGTGGAAGG - Intergenic
979986885 4:127326105-127326127 AAGCTTCTACTCATGGTGGAAGG - Intergenic
980190298 4:129516629-129516651 AAGCTTTTACTCATGGTGGAAGG + Intergenic
980240710 4:130170942-130170964 AATAACATAATCATGGTGGATGG + Intergenic
980351713 4:131692715-131692737 AAACATACACTTATGGTGGAAGG + Intergenic
980758961 4:137202970-137202992 AAACTTATAATCATGGTGGAAGG + Intergenic
981053185 4:140331951-140331973 GAGCTTTTACTCATGGTGGAAGG + Intronic
981275305 4:142892563-142892585 AAACCTATAATCATGGTGGAAGG - Intergenic
981588701 4:146332587-146332609 GAGCACTTACTCATGGTGGAAGG - Intronic
981821089 4:148888354-148888376 AAGCTTATAATCATGGTGGAAGG + Intergenic
982098827 4:151948063-151948085 AAACTTATAATCATGGTGGAAGG - Intergenic
982505065 4:156206598-156206620 AAACTTATAATCATGGTGGAAGG + Intergenic
982566996 4:156997982-156998004 GAGCTTTTACTCATGGTGGAAGG + Intergenic
983578890 4:169288110-169288132 AAACTTATAATCATGGTGGAAGG + Intergenic
983886588 4:172987250-172987272 AAACCTATAATCATGGTGGAAGG + Intronic
984131119 4:175877485-175877507 AAACTTATAATCATGGTGGAAGG + Intronic
985035363 4:185834219-185834241 CAACCTACACTCATGGTGGAAGG + Intronic
985108429 4:186521472-186521494 CCTCCTCTATTCATGGTGGAAGG - Intronic
985311677 4:188608189-188608211 CATCATTTACTCAAGGTGGCAGG + Intergenic
985474279 5:69530-69552 AAGCTTATAATCATGGTGGAAGG - Intergenic
985617626 5:933427-933449 AAACTTATAATCATGGTGGAAGG + Intergenic
986457825 5:7937700-7937722 AAACTTATAATCATGGTGGAAGG - Intergenic
986846560 5:11763155-11763177 AAACATACACTCATGATGGAAGG - Intronic
987186340 5:15423990-15424012 AAACTTACACTCATGGTGGATGG - Intergenic
987743227 5:21936899-21936921 AAACTTATAATCATGGTGGAAGG - Intronic
988647429 5:33109470-33109492 GAGCTTATACTCATGGTGGAAGG - Intergenic
988739098 5:34051987-34052009 AAACATGTACTCATGGTGGCAGG + Intronic
988781692 5:34528358-34528380 CCTCATATTCTGCTGGTGGATGG - Intergenic
988876829 5:35456314-35456336 GAACTTTTACTCATGGTGGAAGG - Intergenic
989256125 5:39367324-39367346 AAACTTATAATCATGGTGGAAGG + Intronic
989515555 5:42338952-42338974 AAACTTATAATCATGGTGGAAGG + Intergenic
989540001 5:42607148-42607170 AAACTTATAATCATGGTGGAAGG - Intronic
990222347 5:53606312-53606334 GACCTTTTACTCATGGTGGAAGG + Intronic
990439622 5:55831845-55831867 AAACTTATAATCATGGTGGAAGG - Intergenic
990498324 5:56370500-56370522 GAGCTTTTACTCATGGTGGAAGG - Intergenic
990578705 5:57148432-57148454 AAACATACAATCATGGTGGAAGG - Intergenic
991204703 5:64037619-64037641 AAACTTATAATCATGGTGGAAGG - Intergenic
991409264 5:66330594-66330616 AAACTTATAATCATGGTGGAAGG - Intergenic
991411868 5:66353802-66353824 AAACATACAATCATGGTGGAAGG + Intergenic
991524873 5:67545217-67545239 AAACTTATAATCATGGTGGAAGG - Intergenic
991749690 5:69787632-69787654 AAACTTATAATCATGGTGGAAGG + Intergenic
991763420 5:69947008-69947030 AAACTTATAATCATGGTGGAAGG - Intergenic
991783907 5:70171121-70171143 AAACTTATAATCATGGTGGAAGG + Intergenic
991801269 5:70367446-70367468 AAACTTATAATCATGGTGGAAGG + Intergenic
991827330 5:70642596-70642618 AAACTTATAATCATGGTGGAAGG - Intergenic
991842649 5:70822068-70822090 AAACTTATAATCATGGTGGAAGG - Intergenic
991876352 5:71171496-71171518 AAACTTATAATCATGGTGGAAGG + Intergenic
992205182 5:74423793-74423815 AATCTTACAATCATGGTGGAAGG + Intergenic
992682495 5:79167010-79167032 GAGCTTTTACTCATGGTGGAAGG - Intronic
992725672 5:79604797-79604819 AAACTTACACTCATGGTGGAAGG + Intergenic
993016749 5:82543373-82543395 AAGCTTTTACTCATGGTGGAAGG - Intergenic
993017040 5:82545680-82545702 AAGCTTTTACTCATGGTGGAAGG - Intergenic
993129711 5:83879980-83880002 AAACCTATAGTCATGGTGGAAGG - Intergenic
993196148 5:84748842-84748864 CATAATATAGTCCTGGTAGAAGG + Intergenic
993388756 5:87291761-87291783 GAGCTTTTACTCATGGTGGAAGG - Intronic
993882047 5:93374476-93374498 AAGCTTTTACTCATGGTGGAAGG - Intergenic
993986412 5:94602746-94602768 AAACTTACACTCATGGTGGAAGG - Intronic
995463720 5:112429346-112429368 CTCCTTCTACTCATGGTGGAAGG + Intergenic
995536000 5:113137135-113137157 AAACTTATAATCATGGTGGAAGG + Intronic
995668728 5:114575206-114575228 CAACTTATAACCATGGTGGAAGG - Intergenic
996330896 5:122327634-122327656 AAACTTATAATCATGGTGGAAGG - Intronic
996452459 5:123641176-123641198 AATCATACCATCATGGTGGAAGG + Intergenic
996696304 5:126399545-126399567 CAACTTACAATCATGGTGGAAGG - Intronic
996722299 5:126641702-126641724 AAGCTTTTACTCATGGTGGAAGG - Intergenic
996892615 5:128440396-128440418 AAACATACAATCATGGTGGAAGG + Intronic
997183661 5:131859571-131859593 GAGCTTTTACTCATGGTGGAAGG - Intronic
997651204 5:135522746-135522768 AAACATATAATCCTGGTGGAAGG + Intergenic
997755622 5:136396390-136396412 CATCATCTGCTGTTGGTGGATGG - Intronic
997828180 5:137126256-137126278 AAGCATCCACTCATGGTGGAAGG - Intronic
998018294 5:138750484-138750506 GAACTTTTACTCATGGTGGAAGG + Intronic
998711731 5:144833597-144833619 AAACTTTTACTCATGGTGGATGG - Intergenic
998733678 5:145110261-145110283 AATCATAAACTCATGGAGAATGG + Intergenic
1000103674 5:158038475-158038497 AAACTTATAGTCATGGTGGAAGG - Intergenic
1000231060 5:159315608-159315630 CATCATACACTTGTGATGGATGG - Exonic
1000585371 5:163090977-163090999 AATCTTTTACTCATGGTGAAAGG + Intergenic
1001871043 5:175156226-175156248 CAACATATTCTCTTGGAGGAAGG + Intergenic
1002767554 6:255500-255522 CATCCCATTCTCATGGTGGAAGG - Intergenic
1002845651 6:942192-942214 CTGCTTCTACTCATGGTGGAGGG + Intergenic
1002958076 6:1888323-1888345 AAACTTATAATCATGGTGGAAGG + Intronic
1003119177 6:3306083-3306105 AAGCTTTTACTCATGGTGGAGGG + Intronic
1003938296 6:10998134-10998156 AAGCCTATAATCATGGTGGAAGG - Intronic
1004603316 6:17171456-17171478 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1004778873 6:18882405-18882427 GAGCTTACACTCATGGTGGAAGG - Intergenic
1004898630 6:20173094-20173116 GAACTTATAATCATGGTGGAAGG - Intronic
1005597484 6:27393397-27393419 GAGCTTTTACTCATGGTGGAAGG - Intronic
1005680211 6:28199312-28199334 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1005817010 6:29561670-29561692 AAGCTTTTACTCATGGTGGAAGG + Intronic
1006282629 6:33067444-33067466 AAGCTTTTACTCATGGTGGAAGG - Intronic
1008430736 6:51413670-51413692 AAACTTATAATCATGGTGGAAGG - Intergenic
1008556392 6:52676737-52676759 AAACTTATAATCATGGTGGAAGG + Intronic
1008578799 6:52886469-52886491 AAACTTATAGTCATGGTGGAAGG - Intronic
1008653070 6:53583313-53583335 GAACTTTTACTCATGGTGGAAGG - Intronic
1009963155 6:70549047-70549069 CTTCATATATTAGTGGTGGAAGG + Intronic
1010457538 6:76075632-76075654 CAACTTACAATCATGGTGGAAGG + Intergenic
1010551698 6:77231348-77231370 AAACTTATAATCATGGTGGATGG - Intergenic
1010974764 6:82299297-82299319 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1011011034 6:82704580-82704602 CATCTTACATTGATGGTGGAGGG + Intergenic
1011046639 6:83091166-83091188 CATGGTATCCTCATGGTGGTGGG - Intronic
1011323395 6:86121921-86121943 AATCTTACAATCATGGTGGAAGG - Intergenic
1011448658 6:87470434-87470456 TAGCTTTTACTCATGGTGGAAGG + Intronic
1011540684 6:88424627-88424649 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1011645623 6:89455332-89455354 GAGCTTTTACTCATGGTGGAAGG + Intronic
1011694906 6:89903611-89903633 AAACTTATAATCATGGTGGAAGG + Intergenic
1011845762 6:91561519-91561541 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1012472518 6:99588279-99588301 AATCTTACAATCATGGTGGAAGG - Intergenic
1012674282 6:102095351-102095373 CATGATATAATCAGGGTGGGAGG + Intergenic
1013417173 6:109935455-109935477 AAACTTATAATCATGGTGGAAGG + Intergenic
1013716257 6:112966990-112967012 CAACTTATAATCATGGCGGAAGG + Intergenic
1014893675 6:126873194-126873216 GAGCTTTTACTCATGGTGGAGGG - Intergenic
1014901371 6:126969839-126969861 AAACATACAATCATGGTGGAAGG + Intergenic
1014943440 6:127470173-127470195 AATCTTACAATCATGGTGGAAGG + Intronic
1015027649 6:128556081-128556103 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1015178492 6:130337315-130337337 AAACTTATAATCATGGTGGAAGG - Intronic
1015822477 6:137279397-137279419 AATCTTACAATCATGGTGGAAGG + Intergenic
1015903166 6:138088379-138088401 CATCATATAATCATAATAGATGG - Intergenic
1016786054 6:148011658-148011680 AAACTTATAATCATGGTGGAAGG - Intergenic
1016880458 6:148906094-148906116 CATCATGGAATCATGCTGGATGG - Intronic
1016950692 6:149576962-149576984 AAGCTTTTACTCATGGTGGAAGG + Intronic
1017189853 6:151641397-151641419 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1017228991 6:152052089-152052111 CAGCTTTTACTCATGGTGGAAGG + Intronic
1017350256 6:153432554-153432576 AAACCTATAATCATGGTGGAAGG - Intergenic
1017379360 6:153810508-153810530 AAACCTATAGTCATGGTGGAAGG - Intergenic
1017768103 6:157623405-157623427 AAACTTATAATCATGGTGGAAGG - Intronic
1017812892 6:157996819-157996841 GAGCTTTTACTCATGGTGGAAGG - Intronic
1018155920 6:160984814-160984836 AAACTTATAATCATGGTGGAAGG - Intergenic
1018161232 6:161044780-161044802 AAGCTTTTACTCATGGTGGAAGG + Intronic
1018355010 6:163004406-163004428 AATCTTACAATCATGGTGGAAGG + Intronic
1018359460 6:163052608-163052630 AAACTTATAATCATGGTGGAAGG - Intronic
1018857365 6:167684435-167684457 AAACTTATAATCATGGTGGAAGG + Intergenic
1019040940 6:169104737-169104759 AAACTTATAATCATGGTGGAGGG + Intergenic
1020516582 7:9128605-9128627 AAGCTTGTACTCATGGTGGAAGG - Intergenic
1020705379 7:11537557-11537579 AAGCTTTTACTCATGGTGGAAGG - Intronic
1020754761 7:12188988-12189010 CTTCTTCTACTCATGGTGGAAGG - Intergenic
1021200971 7:17728321-17728343 TAGCTTTTACTCATGGTGGAAGG + Intergenic
1021706587 7:23373957-23373979 AAGCATTTACTCATGGTGAAAGG - Intronic
1022699431 7:32744393-32744415 AAGCTTATAATCATGGTGGAAGG + Intergenic
1022899001 7:34783275-34783297 AAACTTATAATCATGGTGGAAGG + Intronic
1023495470 7:40790333-40790355 AAACTTATAATCATGGTGGAAGG - Intronic
1023897577 7:44446826-44446848 AATCATATAATCATGTTTGATGG - Intronic
1024167557 7:46749964-46749986 GAGCTTATACTGATGGTGGAAGG + Intronic
1024300894 7:47886688-47886710 AAACTTTTACTCATGGTGGAGGG - Intronic
1025937500 7:66048978-66049000 GATCTTCTACTCATGGCGGAAGG + Intergenic
1026224790 7:68430767-68430789 AAACTTATAATCATGGTGGAAGG - Intergenic
1026679213 7:72452537-72452559 AAGCTTCTACTCATGGTGGAAGG - Intergenic
1026687979 7:72528819-72528841 CATCATGTTCTCAAAGTGGAGGG + Intergenic
1026702246 7:72656742-72656764 AGGCATACACTCATGGTGGAAGG + Intronic
1026723199 7:72850668-72850690 CATCATGTTCTCAAAGTGGAGGG + Intergenic
1027506507 7:79022050-79022072 AAACTTATAATCATGGTGGAGGG - Intronic
1028865014 7:95699219-95699241 AAACTTTTACTCATGGTGGAAGG + Intergenic
1030141677 7:106310691-106310713 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1030384969 7:108857369-108857391 CAACTTACAATCATGGTGGAAGG + Intergenic
1030538291 7:110796136-110796158 AAGCTTATAATCATGGTGGAAGG - Intronic
1030577985 7:111314036-111314058 GAGCTTTTACTCATGGTGGAAGG - Intronic
1031643111 7:124190090-124190112 CAGCTTAAAATCATGGTGGAAGG + Intergenic
1031669685 7:124527893-124527915 AAGCTTATAATCATGGTGGAAGG + Intergenic
1032392569 7:131565552-131565574 AAACTTATAATCATGGTGGAAGG + Intergenic
1032695809 7:134335190-134335212 GAGCTTGTACTCATGGTGGAAGG - Intergenic
1033671246 7:143495331-143495353 AAACTTATAATCATGGTGGAAGG - Intergenic
1033997921 7:147375108-147375130 AAACTTATAATCATGGTGGAAGG - Intronic
1034003701 7:147444912-147444934 AAACTTATAATCATGGTGGAAGG + Intronic
1034565711 7:151913593-151913615 AAACTTATAATCATGGTGGAAGG + Intergenic
1034621053 7:152457387-152457409 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1034691973 7:153021311-153021333 AAGCTTTTACTCATGGTGGAGGG + Intergenic
1035006258 7:155663389-155663411 GAGCTTTTACTCATGGTGGAAGG + Intronic
1036080309 8:5548043-5548065 CAGCATATACACATGGTGCAAGG - Intergenic
1036151686 8:6305001-6305023 GATCAGATACTGATGGTGGCAGG + Intergenic
1036202008 8:6777884-6777906 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1036729080 8:11245935-11245957 AAACTTATAATCATGGTGGAAGG - Intergenic
1036734505 8:11298930-11298952 CATCATATTTTCATGCTGCAGGG - Intronic
1036783669 8:11670639-11670661 CCTCATACACACAAGGTGGATGG + Intergenic
1037098694 8:15016817-15016839 AAGCTTTTACTCATGGTGGAAGG + Intronic
1037165093 8:15817660-15817682 CAACTTATAATCATGGTGGAAGG - Intergenic
1037780624 8:21865953-21865975 AACCTTCTACTCATGGTGGAAGG - Intergenic
1038045830 8:23764880-23764902 CATCATTTCCTCTTGGTAGATGG - Intergenic
1038333916 8:26631287-26631309 AAACTTATAATCATGGTGGAAGG + Intronic
1038355056 8:26821327-26821349 AAGCATACAGTCATGGTGGAAGG + Intronic
1038523528 8:28253847-28253869 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1038939364 8:32286691-32286713 AAACTTCTACTCATGGTGGAAGG - Intronic
1039167511 8:34701240-34701262 AAGCTTATAATCATGGTGGAAGG - Intergenic
1039491353 8:37949919-37949941 CATCTCCCACTCATGGTGGAAGG - Intergenic
1040644881 8:49386987-49387009 AAACATACAATCATGGTGGAAGG - Intergenic
1041471638 8:58216086-58216108 AAACTTATAATCATGGTGGAAGG - Intergenic
1041510486 8:58649763-58649785 GAGCTTTTACTCATGGTGGAAGG - Intronic
1041607464 8:59799597-59799619 CAAAATATGCTAATGGTGGAGGG - Intergenic
1041818787 8:62004851-62004873 GATCTCATAATCATGGTGGAGGG - Intergenic
1042749231 8:72140004-72140026 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1042908128 8:73795414-73795436 AAGCTTTTACTCATGGTGGAAGG - Intronic
1043137646 8:76548644-76548666 ATTTATTTACTCATGGTGGAAGG + Intergenic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1043269575 8:78314797-78314819 TATTATATTCTCATGGAGGAGGG - Intergenic
1043284652 8:78514362-78514384 AAACCTATAATCATGGTGGAAGG - Intergenic
1043480265 8:80645661-80645683 GAGCTTTTACTCATGGTGGAAGG - Intronic
1043884902 8:85587927-85587949 CACCTGATACTCCTGGTGGATGG - Intergenic
1044515776 8:93136741-93136763 GAGCTTTTACTCATGGTGGAAGG + Intronic
1044765681 8:95571554-95571576 AAACTTATAATCATGGTGGAAGG - Intergenic
1044919751 8:97156181-97156203 AAGCTTATAATCATGGTGGAAGG - Intergenic
1044930426 8:97246856-97246878 CAGCTTCTACTCATGTTGGAAGG - Intergenic
1045084934 8:98672000-98672022 AAACTTATAATCATGGTGGAAGG - Intronic
1045100261 8:98837002-98837024 CATCATACACTCATGAAAGAAGG + Intronic
1045437151 8:102174713-102174735 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1045700547 8:104861760-104861782 AAACTTATAGTCATGGTGGAAGG - Intronic
1045838406 8:106550709-106550731 AATCATGGAATCATGGTGGAAGG - Intronic
1045884272 8:107077880-107077902 AAACTTATAATCATGGTGGAAGG + Intergenic
1046201316 8:110931766-110931788 CTGCTTTTACTCATGGTGGAAGG + Intergenic
1046652162 8:116848009-116848031 AAGCTTATAGTCATGGTGGAAGG - Intronic
1046839335 8:118840070-118840092 AAACTTATAATCATGGTGGAAGG - Intergenic
1046889113 8:119401490-119401512 AAGCCTTTACTCATGGTGGAAGG - Intergenic
1047189178 8:122662236-122662258 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1047239036 8:123068847-123068869 AAACTTATAATCATGGTGGAAGG + Intronic
1047617681 8:126576464-126576486 AAGCTTATAATCATGGTGGAAGG + Intergenic
1048127698 8:131655755-131655777 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1048130555 8:131692886-131692908 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1048217394 8:132508988-132509010 CTGCTTCTACTCATGGTGGAAGG + Intergenic
1048226711 8:132594746-132594768 AAACTTACACTCATGGTGGACGG - Intronic
1050900548 9:10942652-10942674 AAACTTATAATCATGGTGGAAGG - Intergenic
1051919915 9:22252499-22252521 AAACCTTTACTCATGGTGGAAGG + Intergenic
1052084702 9:24250087-24250109 AAACTTATACTCATGGTGAAAGG + Intergenic
1052193555 9:25684816-25684838 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1052266215 9:26576785-26576807 AATCTTACAATCATGGTGGAAGG + Intergenic
1053781004 9:41606986-41607008 AAACATACACTTATGGTGGAAGG - Intergenic
1054168947 9:61817143-61817165 AAACATACACTTATGGTGGAAGG - Intergenic
1054341138 9:63863267-63863289 GAGCATTTACTCATGATGGAAGG + Intergenic
1054668585 9:67763668-67763690 AAACATACACTTATGGTGGAAGG + Intergenic
1055084634 9:72301429-72301451 AAGCTTACACTCATGGTGGAAGG - Intergenic
1055089477 9:72348121-72348143 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1055209910 9:73779264-73779286 AAACTTACACTCATGGTGGAAGG - Intergenic
1055782154 9:79831688-79831710 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1055807513 9:80113377-80113399 AAACTTATAATCATGGTGGAAGG + Intergenic
1056227060 9:84506045-84506067 AAACTTATAATCATGGTGGAAGG + Intergenic
1056835055 9:89948101-89948123 AAACTTATAATCATGGTGGAAGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057132911 9:92667056-92667078 CATCATGTTCTCATGGTAGAGGG + Intronic
1059617694 9:115968521-115968543 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1059928247 9:119234754-119234776 TATCATATTCTCCTAGTGGAAGG - Intronic
1060046760 9:120347658-120347680 AAACTTATAGTCATGGTGGAAGG - Intergenic
1060178705 9:121516716-121516738 CAGCTTTTACTCATGGTGGAGGG - Intergenic
1060308802 9:122440638-122440660 AATCTTATAATCATGGTGGATGG + Intergenic
1060314029 9:122491726-122491748 CAGGATGTACACATGGTGGATGG + Intergenic
1060505332 9:124193497-124193519 GAACTTTTACTCATGGTGGAGGG - Intergenic
1061930527 9:133830551-133830573 AAACTTATAGTCATGGTGGAAGG - Intronic
1186261889 X:7789009-7789031 CTGCTTATACTCATGGTAGAAGG - Intergenic
1186385586 X:9107309-9107331 AAGCTTCTACTCATGGTGGAAGG - Intronic
1187348845 X:18493101-18493123 CAACATAAACTCATGGAAGAAGG - Intronic
1187363682 X:18649924-18649946 CATCAAATGCTCAAAGTGGAGGG - Intronic
1187628795 X:21145223-21145245 AAGCGTATAATCATGGTGGAAGG + Intergenic
1187707134 X:22020114-22020136 CATCATTTACAAATGGGGGATGG - Intergenic
1188500288 X:30818288-30818310 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1188621163 X:32225779-32225801 GAGCTTTTACTCATGGTGGAAGG - Intronic
1189016839 X:37293941-37293963 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1189070298 X:37856469-37856491 GAGCTTTTACTCATGGTGGAAGG + Intronic
1189255452 X:39635034-39635056 AAGCTTTTACTCATGGTGGAAGG - Intergenic
1190032317 X:46986088-46986110 CTGCTTCTACTCATGGTGGAAGG - Intronic
1190517734 X:51242493-51242515 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1192090603 X:68151921-68151943 AAACTTATAATCATGGTGGAAGG + Intronic
1192299128 X:69881789-69881811 AAGCTTTTACTCATGGTGGAAGG + Intronic
1192426981 X:71085890-71085912 CCTCATATCCTCATGGAGGCAGG - Intergenic
1193402116 X:81057651-81057673 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1193467431 X:81866662-81866684 AAACTTATAATCATGGTGGAAGG + Intergenic
1193837779 X:86366843-86366865 AAGCTTATAATCATGGTGGAAGG - Intronic
1193840825 X:86405859-86405881 AAACATACAATCATGGTGGAAGG + Intronic
1193845763 X:86467765-86467787 AAACATACAATCATGGTGGAAGG + Intronic
1193948730 X:87770663-87770685 AAACTTATAGTCATGGTGGAAGG - Intergenic
1193988559 X:88276502-88276524 AAACATACAATCATGGTGGAAGG - Intergenic
1194019081 X:88665460-88665482 CATCATATACTCAATGATGATGG - Intergenic
1194341461 X:92711581-92711603 AAGCTTATAATCATGGTGGAAGG + Intergenic
1194449130 X:94020983-94021005 CCTCATATATACATGGTGGATGG - Intergenic
1195260505 X:103126910-103126932 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1195325987 X:103758920-103758942 AAACATACAATCATGGTGGAAGG + Intergenic
1195443103 X:104920584-104920606 GAGCTTTTACTCATGGTGGAAGG - Intronic
1196129732 X:112142402-112142424 CTTCCTATCCTGATGGTGGAAGG + Intergenic
1196261118 X:113582904-113582926 AAGCTTTTACTCATGGTGGAAGG + Intergenic
1196298463 X:114026646-114026668 CATCAAATTCATATGGTGGAAGG - Intergenic
1196673822 X:118398434-118398456 CAACAGATACTGATGGTGGAAGG + Exonic
1196837937 X:119830456-119830478 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1197075308 X:122345682-122345704 AATCTTATAATTATGGTGGAAGG + Intergenic
1197583334 X:128311842-128311864 AAACTTATAATCATGGTGGAAGG + Intergenic
1198083045 X:133257114-133257136 AAACCTACACTCATGGTGGAAGG - Intergenic
1198153445 X:133933752-133933774 AAGCTTTTACTCATGGTGGAAGG - Intronic
1198920701 X:141722632-141722654 AAACTTATAATCATGGTGGAAGG - Intergenic
1199078745 X:143552656-143552678 AAACTTATAATCATGGTGGAAGG - Intergenic
1199155159 X:144537849-144537871 AAACATACAATCATGGTGGAAGG + Intergenic
1199185597 X:144911639-144911661 AAACTTATAATCATGGTGGAAGG + Intergenic
1199220172 X:145308597-145308619 AAACATACAATCATGGTGGAAGG + Intergenic
1199434035 X:147793140-147793162 AATCATGTCATCATGGTGGAAGG + Intergenic
1200320223 X:155180621-155180643 AAACTTATAATCATGGTGGAAGG + Intergenic
1200926724 Y:8661417-8661439 CATGACATTCTCATTGTGGAGGG + Intergenic
1201224806 Y:11808373-11808395 CTGCTTCTACTCATGGTGGAAGG - Intergenic
1201713747 Y:17020577-17020599 AAACTTATAATCATGGTGGAAGG - Intergenic