ID: 1078744071

View in Genome Browser
Species Human (GRCh38)
Location 11:14094706-14094728
Sequence AAGCAGTTACAAAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078744071 Original CRISPR AAGCAGTTACAAAATGAGGA AGG Intronic
901687958 1:10954750-10954772 AAAAAATTACAAAATGAGGTGGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903438726 1:23371197-23371219 AAGCACTTACAGAAGGAGGCAGG - Exonic
905066545 1:35189586-35189608 AAACAATTAGAAAACGAGGAAGG - Intronic
905479099 1:38248967-38248989 AAACAGAAACAAAATGGGGAGGG - Intergenic
905567758 1:38979408-38979430 AAGTACTTACAGAATTAGGAAGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906507552 1:46391446-46391468 AAGCACTTACAGAATCAGGAAGG - Intergenic
906767052 1:48443143-48443165 AAGTACTTACAGAATCAGGAGGG + Intronic
907464614 1:54626791-54626813 CAGCAGTTCCAAAATGAGAATGG - Intronic
908300910 1:62760353-62760375 AAGTACTTACAGAATCAGGAAGG + Intergenic
909105705 1:71404639-71404661 TAGCAGTTTAAAAATGAGAATGG - Exonic
909542848 1:76809979-76810001 AAGCTATTACAAAAAGAGAAGGG - Intergenic
910396950 1:86803094-86803116 AAGTACTTACAGAATCAGGAAGG - Intergenic
910757788 1:90710118-90710140 AAGCAGGCAGAAAATGAGAAGGG + Intergenic
911475710 1:98369650-98369672 ACACAGTTATAAAATGAGGAGGG + Intergenic
915453721 1:156024913-156024935 AATGAGTTAAAAAATGAGGCGGG - Intergenic
915916254 1:159942643-159942665 AAGCAGTTACAGAATTAGAATGG + Intronic
916892228 1:169123035-169123057 AAGTGGTTACATAATGAGGTGGG - Intronic
916969117 1:169991036-169991058 AATCAGTTAAAAAATTGGGAAGG + Intronic
917015337 1:170525119-170525141 AAGGAGTCAGAAAATGAGTAAGG + Intergenic
917227820 1:172802708-172802730 AAGTACTTACAGAATCAGGAAGG + Intergenic
917246669 1:173010301-173010323 GAGAAGTTACAAAATCAGGAAGG - Intergenic
917676609 1:177324633-177324655 AAGTACTTACAGAATCAGGAAGG + Intergenic
917960165 1:180136390-180136412 AGCCATTTAGAAAATGAGGAGGG + Intergenic
918123081 1:181556937-181556959 AAACAGTTACAAAAAAGGGAGGG - Intronic
918420203 1:184356604-184356626 AAGCAGTGAGAAAGGGAGGATGG + Intergenic
919719112 1:200812831-200812853 AAGAAGTCACAAAATGAGATAGG - Intronic
920169499 1:204062105-204062127 AAACAGTTAAAAAAAGAGGGCGG + Intergenic
921020180 1:211228046-211228068 AAGTACTTACAGAATCAGGAAGG + Intergenic
923161682 1:231319842-231319864 AAGCAGTCAAAAAATGAGTAGGG - Intergenic
1063310666 10:4949081-4949103 AAGAAGTTACAAAAGCTGGAGGG + Intronic
1064603061 10:17012716-17012738 AAGTACTTACAGAATCAGGAAGG - Intronic
1064615352 10:17148362-17148384 AAGTACATACAAAATGAAGAAGG + Exonic
1064707064 10:18084091-18084113 AAGAAGTGAGAGAATGAGGAAGG - Intergenic
1065082918 10:22144951-22144973 AAGTACTTACAGAATCAGGAAGG + Intergenic
1065491677 10:26288564-26288586 AAGCAGCTTTAAAATGAGCAGGG + Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068240908 10:54299826-54299848 AAGTACTTACAGAATCAGGAAGG + Intronic
1068943904 10:62708893-62708915 GAACATTTACAAAATGTGGAGGG - Intergenic
1069211765 10:65770419-65770441 AAGCACATACAAAATGAGCGTGG - Intergenic
1069364722 10:67685294-67685316 AAGTACTTACAGAATCAGGAAGG - Intronic
1069972548 10:72184700-72184722 AAGTAGATACAAAATCAGTATGG + Intronic
1070017184 10:72544883-72544905 AAGCAGTTTTAAAATGAATAGGG - Intronic
1071153493 10:82663497-82663519 AAGGAGTTAGCAAAGGAGGAAGG + Intronic
1071283265 10:84122440-84122462 AAGTACTTACAGAATCAGGAAGG - Intergenic
1074613293 10:115041337-115041359 AAGTACTTACAGAATCAGGAAGG + Intergenic
1074849943 10:117431809-117431831 AAGCAGCTACTAAATGGGGAAGG + Intergenic
1074930210 10:118117243-118117265 AAGAAATTAGAAAAGGAGGAGGG - Intergenic
1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG + Intergenic
1077436943 11:2546498-2546520 AAGTAGATACAAAATCAGTAAGG - Intronic
1078744071 11:14094706-14094728 AAGCAGTTACAAAATGAGGAAGG + Intronic
1078903912 11:15666727-15666749 AAGCAGATTAAAAATGAGAATGG - Intergenic
1078992230 11:16660997-16661019 CAGCAGTTAGAAAATTAGCAAGG - Intronic
1079811168 11:25001226-25001248 AAGTACTTACAGAATCAGGAAGG - Intronic
1080858091 11:36129667-36129689 AGGCAGTCAGAAAATGTGGAAGG + Intronic
1081033684 11:38115715-38115737 AAGTACTTACAGAATAAGGAAGG + Intergenic
1081714985 11:45243681-45243703 AAGCATTTCAAAAATGATGAAGG - Exonic
1081886704 11:46504148-46504170 AAGCAGCTATAAAAAGAGGCAGG + Intronic
1085232831 11:74987971-74987993 AAGAACTCACAAAATGATGAGGG - Intergenic
1085790390 11:79492731-79492753 AAACAGTTACAGAGGGAGGATGG + Intergenic
1086317904 11:85612508-85612530 AAGTACTTACAGAATCAGGAAGG + Intronic
1087109164 11:94444365-94444387 AAACAATAACAAAATGAGGTGGG - Intronic
1087171113 11:95050903-95050925 AAGCCTTTGCAAAATGCGGAAGG - Intergenic
1089639099 11:119835384-119835406 AAGCAGAGACAACATGGGGAGGG - Intergenic
1092312950 12:7377998-7378020 AAGCAGTCATCAAATGAAGAGGG - Intronic
1092733676 12:11558598-11558620 AAGCAGCTACACTATGGGGATGG - Intergenic
1094319500 12:29170096-29170118 AAGTACTTACAGAATCAGGAAGG - Intronic
1095527325 12:43142773-43142795 AAGCAATTAGGTAATGAGGATGG + Intergenic
1099083305 12:78213934-78213956 AAGCAGTTACAATTTATGGAGGG - Intergenic
1099293179 12:80797902-80797924 AAGTAATTATCAAATGAGGATGG + Intronic
1099356804 12:81646909-81646931 AAGCAGGGAGAAAAGGAGGAAGG + Intronic
1099466233 12:82991357-82991379 AATAAGTTATAAAAAGAGGATGG - Intronic
1099576607 12:84391291-84391313 AAGTACTTACAGAATCAGGAAGG - Intergenic
1100050636 12:90444866-90444888 AAGTACTTACAGAATAAGGAAGG - Intergenic
1100822898 12:98448146-98448168 AAGCACTTAGACAATGAGGAGGG - Intergenic
1101112844 12:101503157-101503179 TAGAAGTTCCAAAATGAGAAGGG - Intergenic
1101119625 12:101565452-101565474 AGGGAGTTACAAAATGAGGTTGG - Intergenic
1101299874 12:103468206-103468228 AAGCAGGCTCAAAATCAGGAAGG - Intronic
1103047760 12:117751863-117751885 AAGGAATTACCAAATGAGTATGG + Intronic
1103286946 12:119810401-119810423 AAGAAGTAACAAAATGTGGCTGG + Intronic
1103860508 12:124008853-124008875 TAGCACTTACAAAATGAGCCTGG - Intronic
1104054354 12:125217982-125218004 CAGCTGTTAAAAAATGAGGCGGG + Intronic
1104081630 12:125434886-125434908 AAGAAGTTTCAGCATGAGGAGGG - Intronic
1104212360 12:126701449-126701471 AAGGAGTTAGAAAATGATGATGG + Intergenic
1104553451 12:129778856-129778878 AAGCAGCTATATAATGATGATGG - Intronic
1105742168 13:23338152-23338174 AAACAGATACAAAAGGACGATGG - Exonic
1106163211 13:27218790-27218812 AAGTACTTACAGAATCAGGAGGG + Intergenic
1106320855 13:28637292-28637314 AAGCTATTACAAAATTAGGCCGG + Intergenic
1106791122 13:33155542-33155564 AAGAAGATACAAAATCAGGGAGG - Intronic
1106932463 13:34681797-34681819 AGGCTGTTACAAAAGGAGAAGGG - Intergenic
1107618654 13:42200847-42200869 AAAAAGGTACAAAATCAGGAAGG + Intronic
1107742120 13:43461724-43461746 AAGCAGTTTGAGAATGAGTAGGG + Intronic
1108515813 13:51201507-51201529 AAGTACTTACAGAATCAGGAAGG - Intergenic
1108818317 13:54316747-54316769 AAGTACTTACAGAATCAGGAAGG + Intergenic
1108822307 13:54368469-54368491 AATAAGTTAGAAAATGAAGAAGG + Intergenic
1109618286 13:64865718-64865740 AAGCAGTTACAAATTGCTGATGG - Intergenic
1110417112 13:75265101-75265123 AAGCTGTCAGAAAGTGAGGACGG + Intergenic
1110425773 13:75364558-75364580 AGGCAGTAAGAAAATGATGAAGG - Intronic
1111138280 13:84080382-84080404 AATAACTTACAAAATCAGGATGG - Intergenic
1111371370 13:87322258-87322280 AAAGTGTGACAAAATGAGGAGGG - Intergenic
1111400099 13:87722741-87722763 AATAACTTACAAAATGAGGAAGG - Intergenic
1112136434 13:96583582-96583604 AAGCACATTCAAAATGAGGTTGG - Intronic
1113410495 13:110082839-110082861 AAGCAGGTAAAACATAAGGAAGG + Intergenic
1113838336 13:113344241-113344263 CAGAAGTTACCAACTGAGGAAGG + Intronic
1115211123 14:30968046-30968068 AAGTACTTACAAAACTAGGAAGG + Intronic
1115285087 14:31706929-31706951 AAGTACTTACAGAATCAGGAAGG - Intronic
1115580896 14:34757693-34757715 AATCAGTCACAAAATTAGAAGGG + Intronic
1116036079 14:39628548-39628570 AAGCAGTTCTAAAAAGTGGATGG + Intergenic
1117079395 14:52136124-52136146 AAAAAGATACAAAATGAGGGGGG + Intergenic
1117248066 14:53906306-53906328 AAGCAGTTACACAAAGAGGTAGG - Intergenic
1117473035 14:56065861-56065883 AAGCAGTAACAAGGTGAGGGCGG + Intergenic
1118820181 14:69340014-69340036 AAGCATTTTCAAAATGCAGATGG + Intronic
1118867231 14:69713006-69713028 AAGCAGTGACAAAAGGGGGAGGG + Exonic
1119069948 14:71572440-71572462 AGGCAGTTACTAAATGAAGAAGG + Intronic
1119123062 14:72097826-72097848 AAGGAGCTACAATCTGAGGAAGG - Intronic
1123455846 15:20424338-20424360 AAGCTATTACAAAAAAAGGAGGG - Intergenic
1123635723 15:22306508-22306530 AAGCTATTACAAAAAAAGGAGGG + Intergenic
1123985274 15:25640408-25640430 CAGCAGTTACAAAAACAGAAAGG + Intergenic
1125058865 15:35394737-35394759 AAGCAGTTATACTATGAGGTTGG - Intronic
1126257773 15:46648108-46648130 AAGAAGTGAGAAAATTAGGATGG - Intergenic
1126492830 15:49258693-49258715 AAGCAAGTAGAAAATGAGAAGGG + Intronic
1127049943 15:55071196-55071218 AAGCAGATAGAAAATCAGCAAGG + Intergenic
1127646251 15:60962311-60962333 TAGCAGTTAGAAAGTGGGGAGGG - Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1129125258 15:73434823-73434845 AATCAGTGAATAAATGAGGATGG + Intergenic
1129134099 15:73531069-73531091 AAGCATTTACAAAATCATAATGG + Intronic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1129743837 15:78004245-78004267 AAGGAGTTAAAAGATGAGAAGGG + Intronic
1130032745 15:80330707-80330729 AAGCACTTGAAAAATGAGCAAGG - Intergenic
1130301847 15:82686094-82686116 AAGAAGACACAAAATCAGGAGGG + Intronic
1130883196 15:88072536-88072558 AAGCAGTTAAAAAATAAAGAAGG - Intronic
1131926130 15:97385875-97385897 AAGGAGCTACCAAATCAGGATGG + Intergenic
1131965173 15:97834610-97834632 AGGCAGTTACCAGATCAGGAGGG - Intergenic
1133568783 16:7021245-7021267 AAGTAGTAACCAAATGAGGTGGG - Intronic
1134765368 16:16752730-16752752 AAACAGCTAAAAAATGAAGAAGG - Intergenic
1134822556 16:17258414-17258436 AACCAGGAAGAAAATGAGGAAGG + Intronic
1134980688 16:18606481-18606503 AAACAGCTAAAAAATGAAGAAGG + Intergenic
1135339149 16:21631439-21631461 AAGTACTTACAGAATCAGGAAGG - Intronic
1137820438 16:51439547-51439569 ATGCATTTACTAAATGACGAGGG - Intergenic
1138048130 16:53747509-53747531 ACCCAGTTAAAAAATGGGGAAGG - Intronic
1140119240 16:72069135-72069157 AAGCACTTGCAAAACCAGGAAGG + Intronic
1140339443 16:74142343-74142365 AAGTAGTTACAACATGAAAATGG + Intergenic
1141261002 16:82453835-82453857 AAGCAGTTAAGGCATGAGGAGGG - Intergenic
1142611691 17:1111930-1111952 AAGCTGTTTCAGAAGGAGGAAGG - Intronic
1143382647 17:6506179-6506201 AACCAGCTGCATAATGAGGAAGG + Intronic
1145038920 17:19562112-19562134 CAGCAGTTACAAAATGCAAATGG + Intronic
1145324919 17:21814952-21814974 GGGCAGTTACAATAGGAGGAAGG - Intergenic
1146292067 17:31615526-31615548 AAGTAGTTAAAATATGAGCAAGG + Intergenic
1147728980 17:42585280-42585302 AAACAGTGACAAAATGGAGAAGG + Intronic
1148746518 17:49921192-49921214 AAGAAGGTACAAATTCAGGAGGG + Intergenic
1149014107 17:51888218-51888240 AGGAAGTAACAAAAGGAGGAAGG + Intronic
1149188351 17:54029085-54029107 AAGCAGTTACAATATCAGAAAGG - Intergenic
1154149055 18:11891576-11891598 AACTAGTTACAAAATGAGGTTGG - Intronic
1154166148 18:12015785-12015807 CACCAGTTACACAATGAGGCTGG - Intronic
1155780566 18:29827604-29827626 AAGCAGATCCAAAATGACCAGGG + Intergenic
1155917327 18:31569542-31569564 GAGCAGATAGAAAATGAGAATGG + Intergenic
1156931029 18:42643656-42643678 AAGAAGGTACACACTGAGGAGGG - Intergenic
1157006926 18:43594296-43594318 AATCATTTAGAAAAAGAGGAAGG - Intergenic
1158902749 18:61981459-61981481 AAACAATTACATAATGAGAAAGG - Intergenic
1158975022 18:62703375-62703397 AATAAGTTAAAAAATGAGTATGG - Intergenic
1159364077 18:67443562-67443584 AAGCAGGAAGAAAACGAGGAGGG + Intergenic
1160099646 18:75908134-75908156 AAGCCGATTCAAAATGTGGAAGG + Intergenic
1161597717 19:5159794-5159816 AAGTACTTACAGAATCAGGAAGG - Intronic
1161982111 19:7635390-7635412 AAGCTGTTACAAAAGGAGGAAGG + Intronic
1163659755 19:18569618-18569640 AAGGAATTATGAAATGAGGATGG - Intergenic
1163832898 19:19555605-19555627 TTGCTGTTTCAAAATGAGGAAGG + Intergenic
1163857877 19:19720171-19720193 CAGCAGGCAGAAAATGAGGAAGG + Intronic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1164992537 19:32694785-32694807 AAGTACTTACAGAATCAGGAAGG - Intronic
1165961999 19:39542688-39542710 AAGAAGCTACAAATAGAGGAAGG + Intergenic
1167906758 19:52666981-52667003 AAGTAGTTACAGAATCAGGAAGG + Intronic
1168511250 19:56975195-56975217 CAGCAGTTTCAAATTTAGGATGG + Intergenic
928006554 2:27567567-27567589 AAGCAGTTACAACCTGGGGATGG + Intergenic
929021621 2:37558947-37558969 AAGCAGCTCCCAGATGAGGAAGG + Intergenic
930057358 2:47262344-47262366 AAGCTACTACAAAATGAGCAGGG - Intergenic
930296427 2:49560397-49560419 AAGCAGTACCAACCTGAGGAAGG + Intergenic
931540822 2:63327265-63327287 AAGTACTTACAGAATCAGGAAGG + Intronic
932035200 2:68238486-68238508 AACCAGTTACAGCATAAGGATGG + Intronic
932097682 2:68866104-68866126 AAGCAGTGACAAGGAGAGGAAGG - Exonic
932947432 2:76252538-76252560 AAATATTTACAAAATGGGGAAGG - Intergenic
933506594 2:83183521-83183543 AAGCAGTCAGACTATGAGGAAGG + Intergenic
938765490 2:134458377-134458399 AAGCAGGTACAGAATGATGGTGG - Intronic
941980707 2:171453461-171453483 ATGAAATTACAAAATGAGTAAGG + Intronic
942033525 2:171988162-171988184 AAGCAGTTAGAAAACGTGGTAGG - Intronic
942101895 2:172591848-172591870 AAGTACTTACAGAATCAGGAAGG - Intronic
942858700 2:180584006-180584028 AACAAGTTACATAATCAGGAGGG + Intergenic
943196182 2:184753240-184753262 ATGTATTTACAAAATGAGGCTGG + Intronic
943345844 2:186735549-186735571 AGGCAGTTACATTTTGAGGAAGG + Intronic
943872185 2:193013702-193013724 AAGCAATTACACAAAGAAGAAGG + Intergenic
943902264 2:193455414-193455436 AAGTACTTACAGAATCAGGAAGG + Intergenic
943937569 2:193940804-193940826 AACCAGCTTCAAAAAGAGGAGGG + Intergenic
944476266 2:200110095-200110117 ATTCTGTTACAAAATGAGGAGGG - Intergenic
944585922 2:201173648-201173670 ACGCAGTTTTAAAATGAGAAAGG - Exonic
944788953 2:203104281-203104303 AAGAAGTTACATAATGATAAAGG - Intronic
944912824 2:204327072-204327094 AAGGAGGGACAAAATGAGGGAGG + Intergenic
945659641 2:212669668-212669690 GAGAAGTTACAAAATGAATAAGG - Intergenic
945831738 2:214795535-214795557 AAGAATGTAGAAAATGAGGAAGG + Intronic
946346677 2:219116727-219116749 AAGCAGAAAGAAAATGGGGATGG + Intronic
946485976 2:220101139-220101161 ACTCAGTTACAAAATTAAGAGGG - Intergenic
947062231 2:226179804-226179826 AAGCAGATCCAAACTGAGAAGGG + Intergenic
947423576 2:229962270-229962292 AAGTAGTTAGAAAATGAATATGG - Intronic
948774144 2:240273039-240273061 AAGTAGTTGGAAATTGAGGAAGG - Intergenic
1169603989 20:7294596-7294618 AAGGAGATACAAACTGAGCAGGG - Intergenic
1169765810 20:9146784-9146806 AAGCAATTATAATAAGAGGATGG + Intronic
1170239690 20:14150202-14150224 AAGAAGTTAAAAACTGAGGTCGG + Intronic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1170912159 20:20583541-20583563 TGGGACTTACAAAATGAGGATGG + Intronic
1171007215 20:21478333-21478355 AAACAATAACAATATGAGGAAGG + Intergenic
1171261853 20:23741095-23741117 AAGTACTTACAGAATCAGGAAGG + Intergenic
1171270988 20:23816975-23816997 AAGTACTTACAGAATCAGGAAGG + Intergenic
1172340910 20:34156737-34156759 AAGTACTTACAGAATCAGGAAGG + Intergenic
1177453068 21:21297197-21297219 AATGAGTTAAAAAATGAGTAAGG + Intronic
1177516417 21:22157369-22157391 AATCTGCTTCAAAATGAGGATGG - Intergenic
1177698067 21:24599143-24599165 AAGCAGGCACAGAATGTGGAAGG + Intergenic
1177982258 21:27928843-27928865 AATCAACCACAAAATGAGGAAGG - Intergenic
1178836958 21:36106471-36106493 AAGTACTTACAGAATCAGGAAGG + Intergenic
1180207711 21:46272282-46272304 CACCAGTGAGAAAATGAGGAAGG - Intronic
1180855394 22:19041874-19041896 CAGCAGTGACAGGATGAGGAAGG + Exonic
1181901725 22:26161531-26161553 GAGAAGGGACAAAATGAGGAGGG + Intergenic
1184319206 22:43726463-43726485 AAGCAGATACAAACTGAAGCTGG + Intronic
950068172 3:10130306-10130328 AAGCAGTTTTTAAATTAGGAGGG + Intergenic
950277326 3:11673711-11673733 CAGCAGATACAAAATCAGAATGG + Intronic
951698510 3:25470494-25470516 AAGCATTTTCCAGATGAGGAAGG + Intronic
952554813 3:34520062-34520084 AAGTACTTACAGAATCAGGAAGG - Intergenic
954599288 3:51855293-51855315 AAGAACTTACAGAATCAGGAAGG + Intergenic
954604582 3:51898946-51898968 AAGTACTTACAGAATCAGGAAGG + Intronic
955880801 3:63542963-63542985 AATCATTTAAAAAATGTGGAGGG - Intronic
956099654 3:65754085-65754107 AAGCAAACAGAAAATGAGGATGG - Intronic
956643117 3:71432988-71433010 AAGCAGGTACAAAATGATCAGGG - Intronic
957526366 3:81383601-81383623 ATGCAGTTACTGAAGGAGGAGGG + Intergenic
958551233 3:95616165-95616187 TAGCAGTCACAACATGAGGAAGG + Intergenic
959731447 3:109607974-109607996 AACCAGTTGGAAGATGAGGAAGG + Intergenic
959809370 3:110596814-110596836 AACCTGTTACAAAATGGGGAGGG - Intergenic
960063972 3:113351127-113351149 AAGTACTTACAGAATCAGGAAGG + Intronic
960130608 3:114051879-114051901 AAACAGTTACAAAAAGACCATGG + Intronic
961515681 3:127433004-127433026 AAGCAGTAACAAGAGGAGGATGG + Intergenic
961560917 3:127729579-127729601 AAGAAGTTCCAAAATGTAGATGG + Intronic
961761715 3:129174728-129174750 GAGAAGATACAAAATGAAGATGG - Intronic
963204015 3:142614376-142614398 AGGCAGTGAAAGAATGAGGATGG + Intronic
963693475 3:148535152-148535174 AATAAGTTATAAAATGAGGAAGG - Intergenic
963697228 3:148576800-148576822 AAGTACTTACAGAATCAGGAAGG + Intergenic
963796151 3:149633086-149633108 AAGCTGTTAAAAAATAAGTATGG + Intronic
963991808 3:151664892-151664914 AAGTACTTACAGAATCAGGAAGG - Intergenic
964422396 3:156517540-156517562 AAGAAGGTATAAAAAGAGGAAGG + Intronic
965139697 3:164817508-164817530 AAGTACTTACAGAATCAGGAAGG + Intergenic
966054164 3:175661991-175662013 AAGCAATTATAAAATGTGTATGG - Intronic
966406518 3:179604322-179604344 AGGCAGCAACAAAATGAGGAAGG + Intronic
966675321 3:182579959-182579981 AAGCAGCTAAAAAGTGAAGAAGG - Intergenic
966682780 3:182660981-182661003 AAGCATATTCAAAATGAGAAAGG - Intergenic
967257100 3:187604456-187604478 AAGAAGTTATAAAATTTGGAAGG - Intergenic
967330292 3:188283225-188283247 AAGCTTTTCCAATATGAGGAGGG - Intronic
967836760 3:193971424-193971446 AAGCAGAGAGAAAAGGAGGAAGG + Intergenic
970170517 4:13284652-13284674 TAGCAGTTACCAAATAATGAAGG + Intergenic
970178705 4:13365101-13365123 AAGCAGTTGAAAATTGAGGGAGG + Intronic
970747353 4:19315449-19315471 AACCAGTAACAAAATGGAGATGG - Intergenic
970807374 4:20052182-20052204 AATGAGTTAGAAAATGAGGGTGG - Intergenic
971678210 4:29663526-29663548 AAGCTTTTACAAAATGGTGATGG + Intergenic
972651336 4:41020504-41020526 AAGTACTTACAGAATCAGGAAGG + Intronic
972784833 4:42316735-42316757 AAGTACTTACAGAATCAGGAAGG + Intergenic
974457675 4:62148751-62148773 AAGTAGTTACATTATGAGGGTGG - Intergenic
975110754 4:70623769-70623791 AAGCTGTTCCTAGATGAGGAGGG - Intergenic
975771896 4:77734057-77734079 ATACAGTTAAAAAATGAAGAAGG - Intronic
975800373 4:78055280-78055302 TAGCAGCTGCAAAATTAGGAGGG + Intergenic
975838681 4:78451641-78451663 AAGCAGTGTCAAAGCGAGGAAGG + Intronic
975873055 4:78803246-78803268 AAGAAGTTACCAAAAAAGGAGGG - Intronic
976768781 4:88628098-88628120 AAGCAGATACAAAATTAGTAAGG - Intronic
976888552 4:90015759-90015781 AGGAATTTACCAAATGAGGAAGG - Intergenic
976912750 4:90327573-90327595 AGGCAGTGAGAAAATGAGTATGG - Intronic
977404240 4:96575825-96575847 AAGCAGATAGAAAAAAAGGAAGG + Intergenic
978244335 4:106554133-106554155 ACGCAGTTAGAAAATAAAGAAGG - Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
978908056 4:114032688-114032710 AAGCAGATACAAAATTAGCTGGG - Intergenic
979859731 4:125678302-125678324 AACCTGTGACAAAATGAGTATGG - Intergenic
979898825 4:126192287-126192309 AGGCAGTTTCAAAGTGATGAAGG - Intergenic
980281520 4:130728785-130728807 AAGAAGTTAAAAAATTAGAAGGG + Intergenic
981065339 4:140477877-140477899 AACCAGGCACAAAATGATGAGGG + Intronic
981837142 4:149067211-149067233 AAAAAGTTAAAAAGTGAGGAGGG + Intergenic
982214456 4:153068346-153068368 AAGCAGTTACAAAAAAACAAGGG - Intergenic
982423878 4:155233734-155233756 AAGCAGCTTAAAAATGAGGGTGG - Intergenic
982877523 4:160666541-160666563 AAGTACTTACAGAATCAGGAAGG + Intergenic
983834450 4:172371060-172371082 AAGTACTTACAGAATCAGGAAGG - Intronic
984821445 4:183886098-183886120 AGGCAGATGCAAAATCAGGAGGG + Intronic
985179332 4:187239555-187239577 AGGCAGGTACAAAGGGAGGAAGG - Intergenic
986162432 5:5242036-5242058 CAGCAGCTACAAAATAAGAAAGG - Exonic
987391734 5:17382685-17382707 AAGCAATTGAAAAATGTGGAGGG + Intergenic
987598668 5:20036421-20036443 AAGGAGTGAAAAAAAGAGGAGGG + Intronic
989807601 5:45629280-45629302 AAGCAGTCATAAAATCAGTAAGG + Intronic
989964132 5:50449288-50449310 AAGTACTTACAGAATCAGGAAGG - Intergenic
990419392 5:55616641-55616663 AAGTACTTACAGAATCAGGAAGG + Intergenic
990644468 5:57828396-57828418 AAGGAGTTAACAAAGGAGGATGG + Intergenic
991618773 5:68523607-68523629 AAGCAGCTTCCAAATGAGAAAGG + Intergenic
991956088 5:71997213-71997235 AAGCAGCTAAGAAAGGAGGATGG - Intergenic
992270846 5:75061485-75061507 AAGCAGAAACAAAATGGGGGAGG - Intergenic
992978602 5:82142093-82142115 AAGCAGTGAGAAAATGAATATGG + Intronic
994022395 5:95042758-95042780 AAGGTGTTACTAAATGAGAAAGG - Intronic
994466882 5:100147154-100147176 AAGCAGTTACACAGTTAGAAAGG - Intergenic
994857478 5:105142935-105142957 AAGCAGGTAGTTAATGAGGAGGG - Intergenic
995034337 5:107515879-107515901 AAGCAGTTTAAAAATGAACAGGG + Intronic
996100344 5:119438872-119438894 AAGTACTTACAGAATCAGGAAGG + Intergenic
998233394 5:140376889-140376911 AATCAGTTACAAAAAGATAAAGG - Intergenic
998909879 5:146947627-146947649 AAGCAGTCACAAAATAGGGCTGG - Intronic
998915422 5:147006279-147006301 AAGTACTTACAGAATCAGGAAGG + Intronic
999279278 5:150354356-150354378 AAGCAGGAACAAAGAGAGGATGG - Intergenic
1000783388 5:165512749-165512771 AGACAGTTACTATATGAGGAAGG + Intergenic
1000972498 5:167729360-167729382 AAGCAGTTACTAACACAGGAAGG - Intronic
1001144880 5:169175141-169175163 AAGAAGGAACAAAATGAAGAAGG + Intronic
1001191826 5:169638395-169638417 GGGCAGTTACAAAGTAAGGAAGG + Intronic
1001691644 5:173637310-173637332 AAAAAGTAACAAAATGAGGCTGG + Intergenic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1003881945 6:10487184-10487206 AAGCAGAAACAAAACGAGGGAGG + Intergenic
1004264720 6:14139181-14139203 AATCAGTTACAAAATTATGGGGG - Intergenic
1004278814 6:14261432-14261454 AAGCAGTCAAAAAGTCAGGAGGG + Intergenic
1004493044 6:16135411-16135433 AAGCAGTTAAAAGATGTGGAGGG - Intronic
1005083619 6:21981522-21981544 AAGCAGTTTCCAAAGCAGGAAGG - Intergenic
1005125372 6:22441177-22441199 AAGCATTAACTAGATGAGGAGGG + Intergenic
1005174282 6:23026237-23026259 TAGCAGTTACAATAAGAGGTGGG + Intergenic
1006222072 6:32499636-32499658 AAGTACTTACAGAATCAGGAAGG + Intergenic
1006619334 6:35352027-35352049 AACAAGTTAAAAAATGAGGTGGG - Intronic
1007581969 6:42965205-42965227 AAGGAGGCACAAAATGAGGGTGG + Intronic
1008159413 6:48059343-48059365 AAGAAGTTAAAAAATGGGCAGGG + Intronic
1008180677 6:48324570-48324592 AATAAGTTACAATATCAGGATGG - Intergenic
1008671368 6:53772539-53772561 AAGAGGTTATAAAATGAGGTTGG - Intergenic
1008979034 6:57462226-57462248 AAGGAGGTATAAAATGATGAAGG + Intronic
1010075304 6:71790847-71790869 AAGTACTTACAGAATCAGGAAGG + Intergenic
1010824183 6:80452743-80452765 AAACAGTAACAAAATGAAGGAGG + Intergenic
1010864389 6:80956061-80956083 AAGAAGTTACAAAAAAGGGAAGG + Intergenic
1011183116 6:84643966-84643988 TAGCTGTTACGACATGAGGAAGG + Intergenic
1011449995 6:87482482-87482504 AAGTACTTACAGAATCAGGAAGG - Intronic
1011603850 6:89082757-89082779 AAGCAGTTACTAAACCAGAAAGG + Intronic
1012426274 6:99118260-99118282 GAGAAGTTAAAAAATGAGTATGG + Intergenic
1012441059 6:99262776-99262798 AAGTACTTACAGAATCAGGAAGG - Intergenic
1012814759 6:104009198-104009220 AAGCACTTATAACATGAGGAGGG - Intergenic
1012935286 6:105361503-105361525 ATGCACTTTCAAACTGAGGAAGG + Intronic
1013977649 6:116095354-116095376 AAGTATTTACAGAATCAGGAAGG + Intergenic
1014894787 6:126888703-126888725 TAGAAGATACAACATGAGGAAGG - Intergenic
1016097041 6:140050817-140050839 AACCAGATACAAACTGAGGTTGG + Intergenic
1016647180 6:146423989-146424011 GTGCAGTCACAAAATGGGGATGG - Intronic
1016938872 6:149468480-149468502 AAGCAGTCACATATGGAGGAAGG + Intronic
1017989660 6:159475112-159475134 CATGAGTTACAAAATGGGGATGG + Intergenic
1018290033 6:162283098-162283120 TAACAGTGACAAAATGAAGATGG - Intronic
1018844739 6:167547618-167547640 AAGGAGTGACAAGGTGAGGAGGG - Intergenic
1020184264 7:5946939-5946961 AAGCAGTTAGGAAATGTGGAGGG - Intronic
1020298653 7:6777827-6777849 AAGCAGTTAGGAAATGTGGAGGG + Intronic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1022269317 7:28790716-28790738 AAGCAGTCACTAAATGCAGAAGG + Intronic
1022547048 7:31199592-31199614 AAGCAGTTATAAATTGTGGGTGG - Intergenic
1023077735 7:36500469-36500491 AAGTACTTACAGAATCAGGAAGG - Intergenic
1023436484 7:40145745-40145767 AAGTACTTACAGAATCAGGAAGG - Intronic
1023798955 7:43816388-43816410 AAGTACTTACAGAATCAGGAAGG + Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026049377 7:66932106-66932128 AAGCAGCTAGTAAAGGAGGAAGG - Intronic
1026178299 7:68016867-68016889 AGGCAGTAACAGAAAGAGGAGGG + Intergenic
1027380241 7:77600414-77600436 TCTCAGTTATAAAATGAGGATGG + Intronic
1029559562 7:101293582-101293604 GGGCAGTTACAATAGGAGGAAGG - Intergenic
1029916881 7:104219344-104219366 AAGCAGTCACAGATTGATGATGG - Intergenic
1030556713 7:111034155-111034177 AAGTAGTTACAAAATGAGGAGGG + Intronic
1031199601 7:118663244-118663266 ATGCAGTTATAAAATCAGTAAGG - Intergenic
1031274174 7:119697153-119697175 AAGCAATTAAAAGATTAGGAAGG + Intergenic
1031561344 7:123242552-123242574 AAGCACTCACAAAATTCGGAGGG - Intergenic
1031754830 7:125625525-125625547 AAACAATTACAAAATAATGAAGG + Intergenic
1033534007 7:142295419-142295441 TAGCAGTTACAAATTGTGAAAGG + Intergenic
1034041242 7:147879417-147879439 AAGCTGTAATAAAAAGAGGAAGG - Intronic
1034041832 7:147886023-147886045 AAGCAGCTACAAAATGGGAAGGG - Intronic
1034579414 7:152029611-152029633 AAGTACTTACAGAATCAGGAAGG - Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037210698 8:16383553-16383575 AAGCAGTAAATAAAGGAGGAAGG - Intronic
1039942797 8:42105592-42105614 AGGGAGATACAAAATGAGAAGGG + Intergenic
1040667416 8:49651120-49651142 AAGTACTTACAGAATCAGGAAGG - Intergenic
1040975765 8:53193158-53193180 AAGCAGTAGGAAAATGAGTAAGG - Intergenic
1041490767 8:58430235-58430257 AAGCAGTTACAGAAGGCTGAGGG + Intronic
1041573492 8:59365853-59365875 AAAAAATTACAAAATGAGAAGGG - Intergenic
1041691398 8:60691489-60691511 AAACAGTGAGAAAAGGAGGATGG - Intronic
1042582530 8:70297072-70297094 AAGCAGTTAAAGTATAAGGACGG - Intronic
1042892952 8:73633581-73633603 AGGCGGCTACAAGATGAGGATGG + Intronic
1042917810 8:73892555-73892577 AAGGAGTGAGAAAGTGAGGATGG + Intergenic
1043413222 8:80021439-80021461 AAACAGTTACAAAAGGAGACTGG + Intronic
1043490967 8:80748769-80748791 AGGAAGTTAAAAAACGAGGAAGG + Intronic
1043613336 8:82092932-82092954 AAGTACTTACAGAATCAGGAAGG - Intergenic
1043626304 8:82264068-82264090 AAGCAGTTAGAAAATCTGTAAGG - Intergenic
1044456189 8:92395027-92395049 AAGTACTTACAGAATCAGGAAGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1045533374 8:103004789-103004811 AAGCAGTTGCAAGTGGAGGATGG + Intergenic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046117490 8:109801499-109801521 AATCAGTACCAAATTGAGGAAGG - Intergenic
1046403555 8:113740798-113740820 AAGCTAGTTCAAAATGAGGATGG - Intergenic
1046460354 8:114525947-114525969 ATACAGTTAAAAAATAAGGAAGG - Intergenic
1046861158 8:119093136-119093158 AAGCATTTACAAAAAGATGGAGG - Intronic
1047349358 8:124058818-124058840 AAGCTGGTAAATAATGAGGATGG - Intronic
1047444746 8:124909439-124909461 AAGTACTTACAGAATCAGGAAGG + Intergenic
1049267653 8:141677678-141677700 AAGCAGTTCCAAAAAGTGGTTGG + Intergenic
1050059531 9:1691759-1691781 AAGCATTTAAAATATGAGAATGG + Intergenic
1050886656 9:10775418-10775440 GAGTAGTGACAAAATGATGAAGG - Intergenic
1051778480 9:20661821-20661843 AGGCAGGTACAAAATGATGTGGG + Intronic
1052289982 9:26829450-26829472 AAGTACTTACAGAATCAGGAAGG + Intergenic
1053422473 9:37988145-37988167 AAGCAGTTCCAAAGTGAAGAAGG - Intronic
1055150828 9:72997411-72997433 CAGCATTTACAAACTGAGTATGG - Intronic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055457959 9:76490674-76490696 AAGTACTTACAGAATCAGGAAGG - Intronic
1062391282 9:136334921-136334943 CAGCAGTTACAGTTTGAGGAGGG + Intronic
1185886773 X:3790169-3790191 AAGCAGTTCCAAGAGGAGGAAGG + Intergenic
1186918201 X:14246408-14246430 AAGCAGTTTCTAAAAGAAGAAGG + Intergenic
1188251254 X:27897810-27897832 AAACAGTTAAAATATGAGCAAGG + Intergenic
1189739957 X:44107361-44107383 AAGCAATTGCAAAATGATGGTGG + Intergenic
1190964153 X:55281558-55281580 ATGCTGTTAAAAAATGATGATGG + Intronic
1192482291 X:71496014-71496036 AAGTACTTACAGAATCAGGAAGG - Intronic
1193444284 X:81580182-81580204 AAACAGTAACAAAAAGAGCACGG + Intergenic
1194643977 X:96435753-96435775 AAGCAGCTACACAATGCTGAAGG + Intergenic
1195710069 X:107766508-107766530 AAGCAGATACAAAAGGAAGAGGG + Intronic
1195754346 X:108186589-108186611 AAGAAGTTATATAAAGAGGAAGG + Intronic
1195955216 X:110321304-110321326 AGTCAGTTACAAAGAGAGGAAGG - Intronic
1196068664 X:111494806-111494828 AAGCAGTTACAGAAAGAGTCAGG + Intergenic
1196126901 X:112110679-112110701 AAGTACTTACAGAATCAGGAAGG - Intergenic
1196189225 X:112777590-112777612 AATCATTTGCAAAGTGAGGAAGG - Exonic
1196778227 X:119360331-119360353 AACCAGTTACAAATTTAGGTAGG + Intergenic
1196943637 X:120802220-120802242 AAGCAATTACAAAATATGAAAGG - Intergenic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198742328 X:139854195-139854217 AAGTACTTACAGAATCAGGAAGG + Intronic
1199996669 X:153030481-153030503 GAGGAGTTGGAAAATGAGGATGG + Intergenic
1200148103 X:153937295-153937317 AAGCAGTCAAAAAATAAGTAAGG - Intronic
1201271739 Y:12262394-12262416 AAGTACTTACAGAATCAGGAAGG - Intergenic
1201405845 Y:13649294-13649316 AAGCAGTAAAAAAATGATAAAGG - Intergenic
1201568175 Y:15387807-15387829 AAGTACTTACAGAATCAGGACGG - Intergenic
1202089673 Y:21176709-21176731 AAGTACTTACAGAATCAGGAAGG - Intergenic