ID: 1078747892

View in Genome Browser
Species Human (GRCh38)
Location 11:14132641-14132663
Sequence CCACTGTGCTTGGCACATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 717
Summary {0: 1, 1: 1, 2: 12, 3: 98, 4: 605}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078747880_1078747892 24 Left 1078747880 11:14132594-14132616 CCTTCAGGGCAACACCATATCCA 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG 0: 1
1: 1
2: 12
3: 98
4: 605
1078747881_1078747892 10 Left 1078747881 11:14132608-14132630 CCATATCCAGTCCTCCTCAGTGT 0: 1
1: 0
2: 1
3: 19
4: 286
Right 1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG 0: 1
1: 1
2: 12
3: 98
4: 605
1078747879_1078747892 25 Left 1078747879 11:14132593-14132615 CCCTTCAGGGCAACACCATATCC 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG 0: 1
1: 1
2: 12
3: 98
4: 605
1078747883_1078747892 4 Left 1078747883 11:14132614-14132636 CCAGTCCTCCTCAGTGTCCAGGG 0: 1
1: 0
2: 2
3: 41
4: 273
Right 1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG 0: 1
1: 1
2: 12
3: 98
4: 605
1078747885_1078747892 -1 Left 1078747885 11:14132619-14132641 CCTCCTCAGTGTCCAGGGCCCGC 0: 1
1: 0
2: 2
3: 33
4: 256
Right 1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG 0: 1
1: 1
2: 12
3: 98
4: 605
1078747886_1078747892 -4 Left 1078747886 11:14132622-14132644 CCTCAGTGTCCAGGGCCCGCCAC 0: 1
1: 0
2: 0
3: 23
4: 257
Right 1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG 0: 1
1: 1
2: 12
3: 98
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078747892 Original CRISPR CCACTGTGCTTGGCACATAA TGG Intronic
901096900 1:6688901-6688923 GCACAGTGCCAGGCACATAATGG - Intronic
901126084 1:6929782-6929804 CCACTGTGCCCGGCCCTTAAAGG + Intronic
901471420 1:9459360-9459382 CCACTGTGCTTGGCCCAAAATGG - Intergenic
901635599 1:10668788-10668810 GCCCTGTGCTTGGCACAGACAGG - Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
901886757 1:12229077-12229099 CCACTGTGCCCAGCTCATAATGG + Intergenic
902360237 1:15938401-15938423 CCACTGTGCCTGGCCAGTAACGG + Intronic
902989157 1:20174097-20174119 TCCCAGTGCTTGGCACATAAGGG + Intronic
903851577 1:26310086-26310108 CCACTGTGCCCGGCCCAAAAAGG + Intronic
903871763 1:26440628-26440650 CCACTGTGGATGGCACATCTGGG - Intronic
904088272 1:27926478-27926500 TCACAGTTCTTGGCACATAGAGG + Intergenic
904208159 1:28868439-28868461 CCAAAGTGCCTGGCACATAGTGG + Intergenic
904699026 1:32347357-32347379 CCACAGTGCCTGGCCCATAGGGG + Intergenic
905877751 1:41443799-41443821 CCACAGTGCTGAGCACATAGTGG - Intergenic
906590489 1:47020571-47020593 CCCCTGTGCTGGGCACATGCTGG - Intergenic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
907093280 1:51749712-51749734 CCACCGTGCTTGGCTCTAAATGG - Intronic
907281081 1:53347546-53347568 CCACTGTGCCCGGCCTATAAAGG + Intergenic
907321827 1:53607501-53607523 GCACTGTACCTGGCACATAATGG - Intronic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
908331946 1:63079732-63079754 CCACTGTACTGGGTATATAATGG + Intergenic
908411040 1:63865726-63865748 GTACAGTGCTTGGCACATAGCGG + Intronic
909062306 1:70893176-70893198 ACAAGGTGCCTGGCACATAATGG - Intronic
909512468 1:76470228-76470250 TCACAGTGCTAGGCACAGAATGG - Intronic
909682042 1:78302754-78302776 CCACTGTGCCTAACACATAGTGG - Intergenic
909701371 1:78527748-78527770 TCTCTGTGCTGGGCACATAGTGG - Intronic
909853397 1:80498180-80498202 CCACTGTGCCTGGCCCAACACGG - Intergenic
909901696 1:81145509-81145531 CAACTATTCTGGGCACATAATGG + Intergenic
910225461 1:84931736-84931758 CCACTGTGCCTGGCCCAGAGGGG - Intronic
910252885 1:85216660-85216682 CCACTGTGCCTGGCCCAGATTGG - Intergenic
910682537 1:89882225-89882247 GCACAGGGCTTAGCACATAAGGG - Intronic
911078197 1:93900634-93900656 GCACTGTGCTTGGTACTTTATGG - Intronic
911090912 1:94016262-94016284 CCACTATACTGGGCACAGAAAGG + Intronic
911282824 1:95952505-95952527 CCACTGTGCCTGGCCCATTCTGG + Intergenic
912433900 1:109644889-109644911 CTACAGTGCTTGGCACGTGAGGG + Intergenic
912719153 1:112005098-112005120 CCACTTTGCTTGGATGATAAGGG + Intergenic
912739952 1:112185105-112185127 CAACAGTGCTTGGCATATAGTGG + Intergenic
912929074 1:113940090-113940112 CCACTGTGCCTGGCCCATACTGG + Intronic
912979920 1:114362165-114362187 CCACTGTGACTGGCCCATGATGG - Intergenic
913001464 1:114584660-114584682 CCACAGTGCATGGCACATGGTGG + Exonic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
913409175 1:118532054-118532076 GCACTGTTCTTGGTACATTAAGG + Intergenic
914400056 1:147310663-147310685 CCACTGTGCCTGGCCAACAATGG - Intergenic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
914898810 1:151700381-151700403 CTACAGTGTCTGGCACATAACGG - Intergenic
914963338 1:152227120-152227142 GCACTGTGCTTGTCATAAAAAGG - Intergenic
915185419 1:154100883-154100905 CCACTGTGCCTGGCCCAAGATGG - Intronic
915625852 1:157113653-157113675 TCTCAGTGCCTGGCACATAATGG + Intergenic
916370926 1:164093177-164093199 CCTCTGGGCTTGTCACAGAAGGG + Intergenic
916489742 1:165291223-165291245 GCACTGTCCTGGGCACAGAAAGG + Intronic
916767664 1:167877359-167877381 GCACTGTGCTTGGCATACATAGG - Intronic
916859987 1:168793213-168793235 CCACTGTGCCTTGCACATGTAGG - Intergenic
917203786 1:172546619-172546641 CCACTGTGCCTGGCCTATACAGG - Intronic
917977084 1:180246885-180246907 GCACGGTGCCTGGCACACAAGGG - Intronic
918116930 1:181505903-181505925 CCACTGTACTTGGCACACAGTGG - Intronic
919070622 1:192751091-192751113 CCACCGCGCTTGGCCAATAAAGG + Intergenic
919102225 1:193108836-193108858 CTACAGTGCTTGGCACATAGTGG - Intergenic
919660083 1:200235885-200235907 CCACTGTTCTAGGCACATGAGGG - Intergenic
919742099 1:200987235-200987257 CCAAATTGCATGGCACATAAAGG + Intronic
919827522 1:201514007-201514029 GCCCAGTGCTTGGCACATAGTGG - Intergenic
920057741 1:203205186-203205208 CCCCTGTGCTTGGCCAAGAAAGG + Intergenic
920166221 1:204037955-204037977 CCATTGTGCTTGGCTCACCAGGG - Intergenic
920218097 1:204375736-204375758 CCCCTTAGCTTAGCACATAAGGG + Intronic
920330158 1:205201643-205201665 CCATAGTGCTTTGTACATAATGG - Intronic
920442774 1:205992412-205992434 ACACTGTGCCTGGCACATAGTGG + Intronic
921075874 1:211699612-211699634 GCACAGTGCCTGGCACATCAAGG - Intergenic
921207394 1:212859947-212859969 GCACAGTTCCTGGCACATAAGGG + Intronic
921348946 1:214215911-214215933 CCACATTTCTTGGCACATAGTGG + Intergenic
922296592 1:224255154-224255176 CCAATGTGCCTGGCCCAAAATGG + Intronic
922641193 1:227233644-227233666 CCACCGTGCCTGGCCCAAAATGG - Intronic
922956897 1:229610562-229610584 TCACTGTGCTGGGCACTTAGTGG + Intronic
923304947 1:232679870-232679892 CAACTGTGCTAGGCACTTAAGGG + Intergenic
923496481 1:234530118-234530140 AAACTGTGCCTGGCACTTAATGG + Intergenic
924118193 1:240768326-240768348 GCACAGTGCTTGATACATAATGG - Intergenic
924758077 1:246959711-246959733 CCACCGTGCCTGGCCCAAAATGG + Intronic
924761049 1:246986353-246986375 CCACCGTGCCTGGCACCAAAAGG + Exonic
1062864779 10:842998-843020 CCGTTGTGATTGGCACATACTGG + Exonic
1063075594 10:2713299-2713321 CCTCCTTCCTTGGCACATAATGG + Intergenic
1063081577 10:2772772-2772794 CCACAGATCTTGGCACATGAAGG - Intergenic
1063356730 10:5407537-5407559 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1063680010 10:8177997-8178019 CCACTGTGCCTGGCTAATAAAGG + Intergenic
1064613502 10:17128364-17128386 CCACTGTGCTTAGCACCGTATGG - Intronic
1065384053 10:25116289-25116311 CCAATGTGTTGGGAACATAATGG - Intergenic
1065953645 10:30674508-30674530 CCACTGTGCCTGGCCCATTTTGG + Intergenic
1066314879 10:34234741-34234763 TCACTGTGCTGGGTACATAGTGG - Intronic
1066491847 10:35901719-35901741 GCACTGTGCTTTGCACTTTATGG + Intergenic
1068448926 10:57162034-57162056 CCACTGTGCCTGGCCAATGAGGG - Intergenic
1069479945 10:68772603-68772625 CCACTGTGCCTGGCTTAAAATGG - Intronic
1070565948 10:77603975-77603997 CAACGGTGCCTGACACATAAAGG + Intronic
1070976986 10:80613492-80613514 CCATAGGGCTTGGCACAGAATGG + Intronic
1072107017 10:92284012-92284034 CCACTGTGCCCGGCCCAGAATGG + Intronic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072213191 10:93265484-93265506 CCACCGTGCCTGGCCTATAACGG + Intergenic
1072449063 10:95524814-95524836 GCATAGTGCCTGGCACATAATGG + Intronic
1072650871 10:97294284-97294306 CCACAGTTTCTGGCACATAATGG + Intergenic
1072671272 10:97431490-97431512 CCACTGTGCTTGGCAAGCTAAGG - Intronic
1072820552 10:98552381-98552403 GAACTGTGCCTGGCACATATAGG + Intronic
1074343097 10:112653636-112653658 CCACTGTGCTAAGCACTTAATGG - Intronic
1075815222 10:125259872-125259894 GCACTGTGCTGGGCACAGAGAGG + Intergenic
1075933125 10:126316258-126316280 GCACAGGGCCTGGCACATAAAGG + Intronic
1077430159 11:2512327-2512349 CCACTGGGATTGGCAGAAAAGGG + Intronic
1077704228 11:4468566-4468588 CCACAGTGTTTGGCACAGAAAGG - Intergenic
1078109373 11:8380270-8380292 CCACTGTGCCTGGCCAATAATGG - Intergenic
1078362464 11:10679984-10680006 CCACTGTGCCTGGCCCAGAGTGG - Intronic
1078405090 11:11063547-11063569 CCACTGTGCTGGGTACTCAATGG + Intergenic
1078675354 11:13407492-13407514 GCACAGTGCTGGGCATATAATGG + Intronic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1080648715 11:34206070-34206092 CCACTGTGCCTGGCCCTTATAGG - Intronic
1080820925 11:35805652-35805674 GCACTGGGCTGGGCACATAGAGG - Intronic
1080821762 11:35813934-35813956 CTACAGTGCTTTGCATATAATGG + Exonic
1081569739 11:44282304-44282326 CCACTGTGATAGGCACATAGTGG - Intronic
1082275696 11:50219084-50219106 CCACTGTGCCTGGCCCACAGAGG - Intergenic
1082847700 11:57739900-57739922 GCACGGTGATTGGCACATAATGG + Intronic
1083275188 11:61593026-61593048 CCACCGTGCCTGGCCCACAATGG + Intergenic
1083937291 11:65876565-65876587 CCACTGTGGCTGGCACAGAGTGG - Intergenic
1084025280 11:66444454-66444476 CCACTGTGCCTGGCCCAGATAGG - Intronic
1084718442 11:70888924-70888946 CCACTGTGCTAGGCACGTGGTGG - Intronic
1085149753 11:74240851-74240873 GCATAGTGCTTAGCACATAATGG - Intronic
1085226011 11:74921825-74921847 GCACAGTGCTTGGCACACAGTGG + Intronic
1085831262 11:79903358-79903380 CCACAGTGCTTGGCCCACACTGG + Intergenic
1086034594 11:82401428-82401450 CTACAGTTCTTGGCACATATAGG - Intergenic
1086377880 11:86219740-86219762 CCTCTTTTCTTCGCACATAATGG + Intergenic
1087174119 11:95080489-95080511 ACACAGTTCTTGGCACATCATGG - Intergenic
1087467775 11:98530882-98530904 CCACTGTACCTGGCCCATATTGG + Intergenic
1087707758 11:101514225-101514247 GCACTGTGCTAGGCACATTGGGG + Intronic
1088079899 11:105899319-105899341 CAACAGTGCTTGACACATAGTGG - Intronic
1088855946 11:113753691-113753713 CCACTGTGCCTGGCAATTTATGG + Intronic
1089343876 11:117777899-117777921 CAGCTTTGCTTGGCAGATAAGGG - Intronic
1089365091 11:117916566-117916588 CCACTGTGCTGGGCTCATAGTGG + Intronic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1089633861 11:119799954-119799976 ACACTGTGCTTGGTGCATGAGGG + Intergenic
1089680366 11:120115877-120115899 CCACAGTGCTTGGCACAAGTGGG - Intronic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1090199528 11:124844357-124844379 CCACTGTGCCTGGCCCAGAGAGG + Intergenic
1090346218 11:126073349-126073371 GTACTGTGCTTGACTCATAATGG + Intergenic
1090584704 11:128198784-128198806 CCACTGTGCCTGGCCCCCAATGG - Intergenic
1091323214 11:134665969-134665991 CAAATGTGTCTGGCACATAATGG - Intergenic
1091717964 12:2793604-2793626 GCACAGTGCCGGGCACATAACGG + Intergenic
1092286015 12:7129738-7129760 CCACTGGGCTTGGTTCATCATGG + Intronic
1092984756 12:13835008-13835030 GCTCTGTCCTTGGCACATGAAGG - Intronic
1094365375 12:29674311-29674333 CCACAGTGCCCAGCACATAAAGG + Intronic
1094450374 12:30577446-30577468 GCACTGTGCCTGGGAAATAAGGG + Intergenic
1094601604 12:31913710-31913732 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1094674085 12:32601202-32601224 GCACTGTGCTAGGCACATAGTGG - Intronic
1095510713 12:42949026-42949048 GCACAATGCTTGGCAGATAAGGG + Intergenic
1095598967 12:43993329-43993351 GCACAGTGCCTGGCACATAATGG + Intronic
1096267020 12:50131807-50131829 CCACTGTGCCTGGCTCATGGTGG - Intronic
1097003298 12:55896656-55896678 CCACTGAGCCTGGCCAATAATGG + Intergenic
1097021858 12:56026400-56026422 CCACTGCGCCTGGCCCAGAATGG - Intronic
1097202511 12:57291364-57291386 CCACTGTGCCTGGCAAAAGATGG - Intronic
1097260868 12:57719443-57719465 GCACTCTGCCTGGCACACAATGG + Intronic
1097400479 12:59122479-59122501 GCACAGTGCCTTGCACATAATGG + Intergenic
1097583144 12:61482757-61482779 CCACTGTGCCTGGCCACTAATGG - Intergenic
1097585478 12:61510658-61510680 ACACAGTGCTTGGCACATATGGG + Intergenic
1097689097 12:62717124-62717146 CCACTGTGCTTGGCCTAAACTGG + Intronic
1097809774 12:64005907-64005929 CCACTGTGCCTATCACATAAAGG - Intronic
1097934882 12:65236252-65236274 CCACTGTGCCTGGCTCGTAGAGG - Intronic
1098286708 12:68914371-68914393 GCACAGTGCATGGCACATAAAGG + Intronic
1098373644 12:69787824-69787846 CCTATGTGCTAGGCACATATAGG + Intronic
1099334068 12:81330883-81330905 ACACAGTGCCTGGCTCATAAAGG + Intronic
1099733683 12:86538892-86538914 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1100242539 12:92724214-92724236 ACACTGGGATTGACACATAATGG - Intronic
1100573317 12:95863560-95863582 TCACAGTGCCAGGCACATAATGG - Intronic
1100658736 12:96674795-96674817 GCACTGTGCCTGGCACCAAAGGG - Intronic
1100668111 12:96777634-96777656 CCACTGCGCCTGGCCCATCAAGG + Intronic
1100725077 12:97399880-97399902 TCAATGTGCTTTGCACATAATGG - Intergenic
1100872287 12:98922784-98922806 CCACTGTGCCTGGCTCTTAAGGG + Intronic
1101054274 12:100896110-100896132 CCACTGTGGTGGGCTGATAATGG + Intronic
1101098947 12:101372431-101372453 ACGCAGTGCTTGGCACATAGAGG + Intronic
1101396717 12:104355308-104355330 CCGCTGTGCTCTGGACATAAAGG - Intergenic
1102105033 12:110314000-110314022 CCACTGTGCCCGGCCGATAATGG + Intronic
1102353868 12:112215918-112215940 CCACTGTGCCTGGCCCAATAAGG + Intronic
1103450327 12:121024327-121024349 CCACTGTGCCTGGCCCAGATAGG - Intronic
1103518414 12:121522142-121522164 CCACTGTGCCTGGCACAAGGTGG - Intronic
1103740360 12:123086974-123086996 CCACTGTGATTAGCACCCAAGGG + Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1104156600 12:126139008-126139030 CCATAGTGCATGGCAGATAATGG - Intergenic
1104323057 12:127770351-127770373 GCCCTGTGCCTGACACATAACGG + Intergenic
1105882445 13:24616203-24616225 CCACTGTGCATGTCCCAGAAAGG + Intergenic
1106302476 13:28481599-28481621 GTACAGTGCCTGGCACATAATGG - Intronic
1106345707 13:28875060-28875082 GCACAGTACTTGGTACATAATGG + Intronic
1106345713 13:28875185-28875207 GCACAGTACTTGGTACATAATGG + Intronic
1106345719 13:28875308-28875330 GCACAGTACTTGGTACATAATGG + Intronic
1106389791 13:29323960-29323982 GCACTGTGCCCGGCACACAAAGG + Intronic
1107179660 13:37444104-37444126 CCACTGTGCCTGGTCCATAGTGG + Intergenic
1107184635 13:37504674-37504696 CCACTGTGCCTGGCAAAGGAAGG - Intergenic
1107332288 13:39314148-39314170 CCACTATGCCTGGCCAATAAAGG - Intergenic
1107528815 13:41262047-41262069 CCACTGTGCTCGGCACATTTTGG - Intronic
1107531936 13:41290678-41290700 CCACTGTGCTTGGCCTGTAATGG + Intergenic
1107928986 13:45290857-45290879 CCCCTGTGCCTGGCACACAGTGG - Intergenic
1108293699 13:48990035-48990057 CCACCGTGCCTGGCCCATAAAGG + Intronic
1108401508 13:50049390-50049412 GCACTGTGCTGGGCACAGAATGG - Intergenic
1109257623 13:60102399-60102421 TCACCGTGCATGGAACATAATGG + Intronic
1109468453 13:62771018-62771040 TCTCTGTGCTTGGCACCTATTGG + Intergenic
1110559359 13:76893990-76894012 CCACAATGTCTGGCACATAACGG + Intergenic
1111836745 13:93397632-93397654 GCACAGTACCTGGCACATAAAGG - Intronic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1112354365 13:98661594-98661616 TCACAATGCTTGGCCCATAAAGG + Intergenic
1112962016 13:105138606-105138628 CCACTGCGCCTGGCCCATAAAGG - Intergenic
1113697792 13:112359485-112359507 CCACTCTGCTTGTCACACAGTGG + Intergenic
1113818358 13:113191967-113191989 CCACTGTGCTTGGCTCATCGAGG - Intronic
1115520807 14:34231363-34231385 GCACAGTGCTGGGCACATAATGG + Intronic
1116492177 14:45517656-45517678 CCACTGCGCCTGGCCCAGAAAGG + Intergenic
1116856768 14:49959499-49959521 GCATTTTGTTTGGCACATAAAGG + Intergenic
1116951118 14:50879439-50879461 GCACAATGTTTGGCACATAAAGG + Intronic
1117273402 14:54167873-54167895 CTACTGTCCTTGGCATAAAATGG + Intergenic
1117326650 14:54675038-54675060 CCACTGTGGTTGGCTCAGTAGGG + Intronic
1117772549 14:59149645-59149667 CTGCTGTGTCTGGCACATAATGG - Intergenic
1119655719 14:76415308-76415330 CCACTGTACTCAGCACATAGAGG - Intronic
1121083284 14:91126103-91126125 CCAATTTGCTGGGCACGTAATGG + Intronic
1121138385 14:91519259-91519281 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121968872 14:98338147-98338169 CCACTGAGCTTGGCCCATCCTGG - Intergenic
1121976186 14:98406056-98406078 ACACTTTGCCTGGCATATAATGG - Intergenic
1122401899 14:101472325-101472347 CCACTGGGCTTGGCTCAGAATGG - Intergenic
1122686327 14:103509397-103509419 CCACTGTGCCTGGCCTTTAATGG - Intergenic
1122750910 14:103932269-103932291 GCACGGTGCCTGGCACATAGTGG + Intronic
1123003381 14:105308819-105308841 CCACTGTGCTGGGTCCCTAAGGG - Exonic
1123003567 14:105310241-105310263 CCACTGTGCCTGGCTCACTAGGG - Exonic
1123415732 15:20093759-20093781 CCACAGGGACTGGCACATAATGG + Intergenic
1123432664 15:20231846-20231868 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1123525071 15:21100873-21100895 CCACAGGGACTGGCACATAATGG + Intergenic
1123829264 15:24117248-24117270 CCTCTGTGCCTGGGACATTATGG - Intergenic
1123859272 15:24446975-24446997 CCTCTGTGCCTGGGACATTATGG - Intergenic
1124929565 15:34106143-34106165 CCACTGTGCCCGGCCCAGAAAGG - Exonic
1125383469 15:39112318-39112340 ACATAGTACTTGGCACATAATGG - Intergenic
1125768026 15:42147901-42147923 CCACTGTGCCTGGCTGAAAATGG - Intronic
1126347727 15:47714879-47714901 CCACAGTGCCTGGCATTTAATGG - Intronic
1126746816 15:51834541-51834563 CCACTGTGCCTGGCCGAGAAAGG - Intronic
1126810267 15:52395542-52395564 GAACTGTGCCTGGCACATTATGG + Intronic
1127631326 15:60829935-60829957 GCACTGTGCTTGGCATACAGTGG + Intronic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1128989246 15:72245073-72245095 CCACTGTGCCTGGCCCATGGGGG - Intronic
1129510033 15:76114981-76115003 CCACTGTGCCTGGCCAACAAGGG - Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1129856507 15:78829025-78829047 GCAAGGTGGTTGGCACATAATGG + Intronic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1130268320 15:82429942-82429964 CCAATGGGCTTGGAACATTAAGG + Intergenic
1130340351 15:82995866-82995888 GCACTAAGCTAGGCACATAATGG + Intronic
1130522898 15:84677240-84677262 CTACTGAGCTTGACACGTAATGG - Intronic
1131036485 15:89225895-89225917 CCACTGTGCTGGGCACAGACAGG - Intergenic
1131818631 15:96248550-96248572 GCACTGTGCTTGGCACACTGTGG - Intergenic
1131940604 15:97560645-97560667 CCACAGTGCTTGGAGCACAATGG - Intergenic
1132533317 16:464606-464628 CCACTGTGCCTGGCCCATAATGG - Intronic
1133193176 16:4149689-4149711 CCACCGTGCTTGGCCCAAAGCGG - Intergenic
1133893069 16:9900067-9900089 GCAGAGTGCTTGGCACATTATGG + Intronic
1134004070 16:10805800-10805822 GAACTGTGCTTGGCACACAAAGG + Intronic
1134241602 16:12510867-12510889 CCACGGTGCTTGGCACAGGCTGG - Intronic
1134383945 16:13754472-13754494 CTACTGTGCTTCGTACTTAATGG - Intergenic
1134406387 16:13962777-13962799 CCACTGTGCCTGGCCTAAAATGG - Intergenic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134596043 16:15496823-15496845 CCACTGTGCCAGGCCCACAAGGG + Intronic
1135141320 16:19924506-19924528 CCACTATGCCTGGCTCATAATGG + Intergenic
1136048071 16:27631249-27631271 CCACTGTGCCTGGCCCATGGGGG - Intronic
1136048156 16:27631764-27631786 GAACTGTGCCTGGCACATAGTGG - Intronic
1136272950 16:29159221-29159243 CCACTGTGCACGGTACATAGCGG - Intergenic
1137037487 16:35578763-35578785 GCACTGTGCCTGGCACAGTAGGG + Intergenic
1137932678 16:52603677-52603699 TCACTGTGCCTGGCCCAAAATGG + Intergenic
1138048430 16:53750524-53750546 CCACTGTGCTCGGCCAATAATGG + Intronic
1138785308 16:59838682-59838704 CCACTGGGATAGACACATAAAGG + Intergenic
1138858507 16:60725422-60725444 CAACTGTGTTTGGCACTTAATGG - Intergenic
1139258538 16:65568057-65568079 CCACTGTGCCTGGCTAACAATGG - Intergenic
1139619022 16:68122058-68122080 CCACTTTGCTTACCACATCATGG + Exonic
1139740493 16:69031298-69031320 TCACAGTGCTTGGCACATAGTGG + Intronic
1140310837 16:73847012-73847034 CCACTGTGCCTGGCCCCTTAAGG - Intergenic
1140989109 16:80191052-80191074 GCACAGTGCTTGGTACATGATGG + Intergenic
1141792631 16:86246919-86246941 CAACGGTGCTTGGCACATGTAGG - Intergenic
1141986111 16:87581153-87581175 CCAATGAGATTGGGACATAATGG - Intergenic
1142053643 16:87977520-87977542 CAAATGTGCTTGACACATCAAGG - Intronic
1142437531 16:90071414-90071436 CCACTGTGCCTGGCCCAGAGTGG + Intronic
1143236989 17:5411274-5411296 CCACCGTGCTTGGCCAATATTGG - Intronic
1143250488 17:5519733-5519755 CCACTGCGCCTGGCCCATAATGG + Intronic
1143948393 17:10614260-10614282 GAACAGTGCTTGGCACATAGAGG + Intergenic
1144306674 17:13974800-13974822 CCACAATGCTTGACATATAAAGG - Intergenic
1144438900 17:15263830-15263852 GCAAAGTGCTTGGCATATAACGG - Intronic
1144628457 17:16857538-16857560 ACACTGTGCCTGGCACATGGTGG + Intergenic
1145160045 17:20568109-20568131 ACACTGTGCCTGGCACATGGTGG + Intergenic
1145373999 17:22330763-22330785 CCACTGTGCCTGGCCAATAGAGG + Intergenic
1145889975 17:28407473-28407495 GCACAGTGCCTGGCACGTAAGGG - Intergenic
1146061584 17:29610466-29610488 CCTCAATGCCTGGCACATAAAGG + Intronic
1146133972 17:30302170-30302192 CCACTGCGCTTGGCCCATATAGG + Intergenic
1146435366 17:32841177-32841199 CCACTGTGCCTGGCCTACAATGG - Intronic
1146466825 17:33092827-33092849 CTACTGTGCTAGGGACATTAGGG - Intronic
1146568465 17:33933385-33933407 CCGCAGTGCCTGGCACATACTGG + Intronic
1147687931 17:42298446-42298468 CCACCGAGCCTGGCACATGATGG + Intronic
1147814330 17:43197862-43197884 CCACTGTGCCCGGCCTATAAAGG - Intronic
1148121000 17:45211171-45211193 CCACTGTGCCTGGCCTAGAATGG + Intergenic
1148492126 17:48029996-48030018 CCACTGTGCCTGGCCTAAAAGGG - Intronic
1148522008 17:48286005-48286027 GTACAGTGCTTAGCACATAAAGG + Intronic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1149109193 17:53006600-53006622 GCACAGTGTTTGACACATAAAGG + Intergenic
1149399375 17:56279076-56279098 GCACTGTGCATGGCACAGAGAGG - Intronic
1149505430 17:57190062-57190084 CCACTGTGCCTGGCCAATTATGG + Intergenic
1149981162 17:61312482-61312504 CCACTGTGGCTGGCACAAACAGG + Intronic
1150288478 17:63967438-63967460 CCACCGTGCCTGGCACTTTAGGG + Intronic
1150526594 17:65929710-65929732 TCACAGTGCCTGGCACATACAGG + Intronic
1151177426 17:72300330-72300352 CCACTCTGCCTGGCCCAAAATGG - Intergenic
1151209468 17:72533575-72533597 CCACTGTGCCTGGCCCAAAATGG - Intergenic
1151524071 17:74651767-74651789 CCACTGTGCCTGGCCAGTAATGG + Intergenic
1151660972 17:75517721-75517743 ACACTGTGCCTGGCACCTTATGG - Intronic
1151693045 17:75698903-75698925 CCACTGTGCCTGGCCCACAATGG - Intronic
1152604843 17:81284068-81284090 CCACTGTGCCAGGCCCATCATGG - Intronic
1153208387 18:2730455-2730477 CCACCGTGCCTGGCCCACAAAGG + Intronic
1153302223 18:3601371-3601393 CCACTGCGCCTGGCCCAGAATGG + Intronic
1155078867 18:22387910-22387932 CCCCCTTCCTTGGCACATAATGG + Intergenic
1156746459 18:40397645-40397667 CCATTGTGCCTGGCACATTCTGG - Intergenic
1157185523 18:45537106-45537128 ACAATGTGCCTGGCAAATAATGG - Intronic
1157296017 18:46444758-46444780 CCACTGTGCCTGGCTCATTTTGG + Intronic
1157775563 18:50393090-50393112 CCTCTGTACTAGGCACATAATGG + Exonic
1157813184 18:50712137-50712159 CCACTGTGCCCGACACTTAAAGG - Intronic
1157828192 18:50831448-50831470 GCACAGTACTTGGCACATGATGG + Intergenic
1158028999 18:52939591-52939613 GCAAAGTGCCTGGCACATAATGG - Intronic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1158450422 18:57559038-57559060 GCACTGGGCTTAGGACATAATGG + Intronic
1158545355 18:58391739-58391761 TCAGTATGTTTGGCACATAAAGG + Intronic
1158585910 18:58734574-58734596 CCACTGTGCCTGGCCCCTGAGGG + Intronic
1158861646 18:61598330-61598352 TCCCTGTGCTTGGCAGAGAAAGG - Intergenic
1159992563 18:74926893-74926915 CCACGGTGTTAGGCAGATAAAGG - Intronic
1160033247 18:75280397-75280419 ACACTGTGTCTGGCACATAATGG + Intronic
1160589637 18:79936118-79936140 CCACTGCTGTTGGCACATGAAGG + Intronic
1161286332 19:3470233-3470255 CCCCTGTGCCTGGCACAGAGTGG - Intergenic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1162054582 19:8055001-8055023 CCACTGTGCCTGGCTGATAGTGG - Intronic
1162885944 19:13697186-13697208 TCACTGTGCTTGGCCCCTGAGGG - Intergenic
1164778144 19:30870819-30870841 CCATTTTTCTTGGCACATTATGG - Intergenic
1165726051 19:38113707-38113729 GCACAGAGCTTGGCACATAGTGG + Intronic
1166057564 19:40301870-40301892 CCACTGTGCCTGGCCCAGATTGG - Intergenic
1166348094 19:42179307-42179329 CCCCTGTGCCAGGCACATTATGG + Intronic
1166534463 19:43563591-43563613 AGACTGTTCTTGGCACAGAAGGG - Intronic
1167044547 19:47042018-47042040 CCACTGTGCCTGGCCTAGAAGGG - Intronic
1167291088 19:48625618-48625640 GCACCGTGATTGGCACATAAAGG + Intronic
1167540366 19:50082750-50082772 CCACTGCGCCTGGCCCAAAACGG - Intergenic
1167629752 19:50618284-50618306 TCACTGTGCCTGGCCCATAATGG + Intergenic
1167899616 19:52609777-52609799 CCACTGTGCCTGGTCCAAAAAGG - Intronic
1168297720 19:55385600-55385622 TCACTGTGATTGGCATATGATGG - Intronic
925153414 2:1632882-1632904 GCACTGTGCCTGGCACATGGTGG + Exonic
929533259 2:42765137-42765159 CCACTGTGCCTGGGACACAGAGG - Intergenic
930102686 2:47615495-47615517 CCACTGTGCAGGGCACATGGTGG - Intergenic
931396174 2:61889852-61889874 GCACTGTGCTTAGCAGATAACGG - Intronic
932319408 2:70810329-70810351 CCACTGTGCCTGGCCTAAAATGG - Intronic
932609710 2:73189830-73189852 CCACGGTGCTTAGCACATATTGG - Intergenic
932886456 2:75553541-75553563 GAACTGTGCCTGGCACATGAAGG + Intronic
933975111 2:87503270-87503292 CCACCGTGCTAGGTACACAAAGG + Intergenic
933998937 2:87690258-87690280 AAACTGTGCCTGGCACTTAAGGG + Intergenic
934088122 2:88527178-88527200 CCACTGTGCCTGGCCTACAAGGG - Intronic
934697180 2:96408262-96408284 CCACTGTGCCTGGCCCGAAATGG + Intergenic
934964918 2:98712872-98712894 CCACTGTGCCTGGCCCAAAAGGG - Intronic
936074333 2:109392101-109392123 CCACTGTGCCTAGCCCAAAAAGG + Intronic
936294909 2:111260625-111260647 AAACTGTGCCTGGCACTTAAGGG - Intergenic
936318715 2:111447544-111447566 CCACCGTGCTAGGTACACAAAGG - Intergenic
936500902 2:113065503-113065525 GCATAATGCTTGGCACATAATGG + Intergenic
937082155 2:119147835-119147857 CCACGGTGCTGGGCACACAGTGG + Intergenic
937463931 2:122112664-122112686 GCACAGTGCTTGGCTCAGAATGG + Intergenic
937577796 2:123445154-123445176 CCTCAATGCTTGGCACAAAAGGG - Intergenic
937840198 2:126517734-126517756 CCATTGTCATTGGTACATAATGG - Intergenic
937892595 2:126950099-126950121 CCACTGTGCTTGGCCGAGACAGG - Intergenic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
939021202 2:136960424-136960446 CCACTGTGCTTGGCCTGGAATGG + Intronic
939438018 2:142203796-142203818 CCACTGCGCCTGGCCCAAAAAGG - Intergenic
939561359 2:143736089-143736111 CCACTGCGCCTGACACATATAGG - Intronic
939991723 2:148882314-148882336 CCACTGGGCTTAGCACACAACGG - Intronic
940043494 2:149385418-149385440 CCAATGTCTTTGGCACATCATGG - Intronic
940353177 2:152711689-152711711 GCACAGTTCTTGGCACATCATGG - Intronic
941145594 2:161840577-161840599 CCATTGCACTTGGCACATAATGG - Intronic
941362657 2:164571631-164571653 GCTCAGTGCCTGGCACATAATGG - Intronic
942923730 2:181408131-181408153 CTTCTGTGCTTGACACATAGTGG + Intergenic
942938661 2:181590107-181590129 CCACTGCACCTGGCCCATAATGG + Intronic
942947838 2:181688745-181688767 GCACAGTGCCTGGCACATAATGG - Intergenic
943613082 2:190057900-190057922 CCAGATTGCCTGGCACATAATGG + Intronic
944150029 2:196548040-196548062 CCACTGCGCCTGGCCCATAGTGG - Intronic
944253113 2:197597887-197597909 CCATTGTGCTTGCCACAAGAAGG + Intronic
944553858 2:200869076-200869098 CCACTGTGCCTGGCCCATCAAGG + Intergenic
944832162 2:203543757-203543779 CCACCGTGCCTGGCCCAAAAGGG - Intergenic
945005436 2:205400087-205400109 CCAGTGTCATTGGCACTTAAAGG - Intronic
945618238 2:212100572-212100594 GCACTGTTCTTGGCACAGAGTGG - Intronic
945800205 2:214419669-214419691 CCACTGTCTTTGGCCCATAGTGG - Intronic
946387035 2:219389540-219389562 CCACTGCGCCAGGCCCATAATGG - Intronic
946667266 2:222064089-222064111 CCACAGTGTCTGGCACATAGAGG - Intergenic
947587630 2:231366408-231366430 CCACCGTGCCTGGCCCGTAATGG - Intronic
1169012443 20:2261682-2261704 CCACTGTGCTTGTCAAATGAGGG - Intergenic
1169859945 20:10140873-10140895 CCACTGTACTTGGCAGACAGAGG - Intergenic
1169881980 20:10356873-10356895 CCTCTGTGGTTGCCACAGAAGGG - Intergenic
1170224569 20:13977581-13977603 CCACTTTTTTTTGCACATAAGGG - Intronic
1170517656 20:17148662-17148684 CCACTGTGGTTAGCAGAAAAAGG - Intergenic
1171406691 20:24916544-24916566 CCACAGTGCTGGGCACAGCAAGG + Intergenic
1171445244 20:25198043-25198065 ACACAGGGCATGGCACATAAAGG + Intronic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172494863 20:35373389-35373411 CCACTGTGCCTGGCCCATTCTGG - Intronic
1172990471 20:39032457-39032479 CCACTGTGCCTGGCCCAGATTGG + Intronic
1173235229 20:41239294-41239316 CCACCGTGCCTGGCCAATAAGGG + Intronic
1173611710 20:44373075-44373097 CCACTGCGCTTTGCACATAAAGG + Intronic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1174327510 20:49791055-49791077 CCACCGTGCCTGGCCCACAAAGG + Intergenic
1174852848 20:54012693-54012715 GCACTGGGCCTGACACATAAAGG - Intronic
1175496511 20:59418240-59418262 GCACAGTGCTTGGCATATAGTGG - Intergenic
1175615056 20:60390716-60390738 CAACTGTGCCTGGCACATAAAGG - Intergenic
1176412264 21:6455416-6455438 CAAGGGTGCTTGACACATAAGGG - Intergenic
1176727059 21:10446480-10446502 CCACTGTGCCTGGCATAGATGGG + Intergenic
1177571910 21:22898078-22898100 CCAAAGTGTTTGGCACATAATGG + Intergenic
1178885975 21:36484997-36485019 CCACTGTACTGGGCTGATAAGGG + Intronic
1179471516 21:41613777-41613799 CGTCTGTGCTTGGCACAGCATGG + Intergenic
1179637026 21:42719345-42719367 CCACTGTACTTGGCCTAGAATGG - Intronic
1179687758 21:43063738-43063760 CAAGGGTGCTTGACACATAAGGG - Intronic
1179939771 21:44629812-44629834 CCCCAGTGCCTGGCTCATAAGGG + Intronic
1179985369 21:44918021-44918043 CCATTCTGCTTGGCACAAACTGG - Intronic
1180069937 21:45431219-45431241 CCTCTGTCCTTGGCCCAGAAGGG - Intronic
1180246591 21:46552402-46552424 CCACTGTGCTAGGAACATTCAGG + Intronic
1180287327 22:10760564-10760586 CCACTGTGCCTGGCATAGATGGG - Intergenic
1180712595 22:17849620-17849642 CCACTGTGCCTGGCCCAGAATGG + Intronic
1180971304 22:19817199-19817221 CCACTGTGCCTGGCCCCTAATGG - Intronic
1181832953 22:25577460-25577482 CCACCGTGCCTGGCCCGTAAAGG + Intronic
1181898362 22:26131138-26131160 GCACAGTGCCTGGCACATAAAGG + Intergenic
1182149299 22:28017326-28017348 CCATGGTGCCTGGCACATCACGG - Intronic
1182544353 22:31065720-31065742 CCACAGGGACTGGCACATAATGG - Intronic
1182889837 22:33808466-33808488 CCAAGGTGCTTGGCACAAATAGG + Intronic
1183060426 22:35333331-35333353 CCACAGTGCTTGGGGCAGAAAGG + Intronic
1183523122 22:38307975-38307997 CCACTGTGCCTGGCCCAGGAGGG + Intronic
1183592424 22:38787689-38787711 CCACAGTGGTTTGCACATAGTGG - Intronic
1183637629 22:39074359-39074381 CCACTGCGCCTGGCACAAATGGG - Intronic
1183722731 22:39571872-39571894 GCACAGTGCTTGGCACATCGTGG + Intronic
1183748599 22:39706267-39706289 CCAGTGTGCGTGGCCCATCAGGG - Intergenic
1183788774 22:40047846-40047868 GCACAGTGCTTGGCACATAGTGG + Intronic
1183918751 22:41146452-41146474 CCACTGTGCCTGGCCTATAATGG + Intronic
1184063597 22:42101834-42101856 CCACTGTGCCTGGCCCATTAAGG + Intergenic
1184632748 22:45796784-45796806 CCACTGTGCCTGGCCTATACTGG + Intronic
949547418 3:5083878-5083900 CCACTGTGCCTGGCCCAAATGGG - Intergenic
949650398 3:6151602-6151624 GCACAGTGCTGGGCACATAGTGG + Intergenic
949779329 3:7668355-7668377 CCACTGTGGGTGGCAAATAGAGG - Intronic
949848831 3:8400454-8400476 CCACTGTGCTGGGAAAATTAGGG - Intergenic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
951095901 3:18630765-18630787 CCAAAATGCTTGGCACTTAATGG + Intergenic
951593540 3:24292640-24292662 GCACTGTGCCTGGCAAATAGTGG + Intronic
951882089 3:27489380-27489402 CCAGAGTGCCTGGCACATAGTGG + Intergenic
952329202 3:32348387-32348409 CCACTGTGCTGGGTACTTAGAGG + Intronic
952666110 3:35906271-35906293 GCACAGTGCTTGGCACATGGAGG + Intergenic
952911152 3:38187871-38187893 CCACTGTACCTGGCCTATAAAGG + Intronic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954483043 3:50819672-50819694 CCACTGTGCCTGGCTCACCATGG - Intronic
954533144 3:51338062-51338084 CCAATGTCCTTGGCACAAAAGGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955145770 3:56317658-56317680 CCCCAGTGCCTGGCACATAGGGG - Intronic
955152668 3:56383527-56383549 TCACAGTGCCTGGCACATAGTGG + Intronic
955444133 3:58991013-58991035 CAACTTTACTTGGCACATAGTGG + Intronic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
955672058 3:61412370-61412392 CCACTGTGACTGGCACAGAATGG - Intergenic
955817093 3:62855230-62855252 GCACTGTGCTTGGCCTAAAATGG + Intronic
956052650 3:65265169-65265191 TCACAGTGCCTGCCACATAAAGG + Intergenic
956127538 3:66025249-66025271 CCACTGTGCCTGGCCAATCATGG - Intronic
956340227 3:68214256-68214278 CAAGTGTGCTTGGCAAATTAAGG - Intronic
956742477 3:72286198-72286220 CCACTGTGCTTGCCAGATGATGG + Intergenic
956971191 3:74528407-74528429 TAAATGTGCCTGGCACATAATGG - Intergenic
957467465 3:80612659-80612681 CGAGAGTTCTTGGCACATAATGG + Intergenic
957483012 3:80822798-80822820 GCACTGTGCTTTGCACAGAGTGG + Intergenic
958100769 3:89006546-89006568 CCCATGTCCTTGGAACATAATGG - Intergenic
958928275 3:100182238-100182260 ACACAGTGCTTGGCACAGAGTGG - Intergenic
959914134 3:111796798-111796820 CCACTGTGCCTGGCCCAAGAGGG + Intronic
960207955 3:114925811-114925833 CCACTGTGCCTGGCCAATTATGG + Intronic
960260824 3:115566292-115566314 ACACAGTTCTTGGCACATAAAGG + Intergenic
960427332 3:117525042-117525064 TCAGTGGGCTTGGCACAGAAAGG - Intergenic
960559617 3:119069213-119069235 CCACTGTGCCTGGCCAACAATGG + Intronic
960671459 3:120158631-120158653 TCACAGTGCCTGGCACATAGTGG + Intergenic
960696044 3:120397484-120397506 CAACAGTGCCTGGCACAAAATGG + Intronic
961134613 3:124498260-124498282 GCACAGAGCTTGGCACATGATGG - Intronic
961545163 3:127628546-127628568 CTACAGTGCTTGGCATATTAAGG + Intergenic
961967542 3:130921367-130921389 CCACTGTGCCTGGCCCAAAAGGG + Intronic
962167026 3:133060090-133060112 ACACAGTGCCTGGCACAAAAGGG - Intronic
962204708 3:133425329-133425351 GCACTGTGCTGGGCACGTGATGG + Intronic
962496691 3:135946981-135947003 CCACTGTGCCTGGCCAATGAAGG - Intergenic
962986856 3:140544131-140544153 GCACTGTGCCTGGCACATAGCGG - Intronic
963145066 3:141985239-141985261 CCACTGTGCTTGGCCAAAATAGG - Intronic
963715317 3:148796210-148796232 CCACTGTGCCTGGCCCTTACTGG - Intronic
964502996 3:157369014-157369036 GCACAGTGCTTGGCACACACAGG + Intronic
965444118 3:168753247-168753269 CCCCAGTGCTTGGAACATAATGG - Intergenic
965667530 3:171111132-171111154 CCACTGTGCCTGGCTCATTGTGG - Intronic
965932289 3:174059687-174059709 GCACAGAGCTTGCCACATAATGG - Intronic
966784708 3:183612582-183612604 GCTCTGTGCCTGGCACATAGTGG - Intergenic
967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG + Intronic
967688227 3:192442338-192442360 GCACTGGGCTTGGCACAGTATGG + Intronic
967903714 3:194484319-194484341 GCACTTTTCCTGGCACATAATGG + Intronic
968218363 3:196913934-196913956 CCACTGTGCCTGGCCAAGAAAGG + Intronic
968498041 4:929242-929264 ACACTGCGCATGGCACACAAGGG + Intronic
969296323 4:6272236-6272258 GCACAGTGCTTGGCACAAGATGG + Intronic
969543828 4:7811085-7811107 CTCCAGTGCTGGGCACATAACGG - Intronic
970649536 4:18161038-18161060 CCACTGTGCCCGGCCCAAAAAGG + Intergenic
970722646 4:19006011-19006033 CCACTGTGCCTGGCCTGTAAAGG + Intergenic
970938675 4:21605765-21605787 CCACTGTGCCTGGCGTACAATGG + Intronic
972645998 4:40967863-40967885 GCACAGTGCCTGGGACATAATGG + Intronic
973738874 4:53900693-53900715 ACACAGAGCTTGGCACATCATGG + Intronic
973812359 4:54583923-54583945 GCACAGTGCTTGGCACACAGTGG + Intergenic
973934297 4:55827536-55827558 ACACAGTGCTTGGTACAAAAAGG + Intergenic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974075578 4:57165455-57165477 CCACTGTGCTTGGCCTATGAAGG + Intergenic
974432285 4:61814991-61815013 GGTCTGCGCTTGGCACATAATGG + Intronic
975172524 4:71248300-71248322 CCACTGTGTCTGGTACACAAAGG - Intronic
975873817 4:78812254-78812276 CCACTGTGCCTGGCCTTTAATGG + Intronic
975907658 4:79233782-79233804 CCACTGTGGTTGGCTCATGATGG + Intronic
975965040 4:79963015-79963037 CAACTGTGATGGGAACATAATGG + Intronic
976513467 4:85936925-85936947 CCACAGTGCCTGGCACACAATGG + Intronic
977174872 4:93807799-93807821 ATACAGTGCTTGGCACATAGTGG - Intergenic
977528169 4:98168952-98168974 CCACTGTGTTAGGCACAGCATGG + Intergenic
977696031 4:99967475-99967497 CCACTGTGCCTGGCCCACATTGG + Intergenic
979073644 4:116242644-116242666 ATACTGTGCTTTGCATATAATGG - Intergenic
981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG + Intergenic
981826912 4:148953641-148953663 TGACTGTGCTTGGCAGAGAAGGG - Intergenic
982781368 4:159494537-159494559 CCACTGTGCCTGGATCATGATGG - Intergenic
982790315 4:159584572-159584594 CCACTGCGCCTGGCACACATGGG + Intergenic
983920365 4:173337454-173337476 CCACGGTGCTTGACCCAGAAAGG + Intergenic
985654412 5:1122363-1122385 CCACTGCGCTTGGCACCTCAAGG + Intergenic
986363197 5:7002210-7002232 CCACTGTGCCCGGCCAATAAAGG - Intergenic
987269081 5:16286708-16286730 CCTCAATGCTTGGAACATAATGG - Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
989678039 5:43995814-43995836 ACACAGTGCTTGGCCCATAGTGG + Intergenic
991134417 5:63164537-63164559 ACACTATGCTTTGCAAATAAGGG + Intergenic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
992561149 5:77954199-77954221 CCACTGTGCCCGGCCTATAAAGG + Intergenic
995363875 5:111331940-111331962 GCACTGTGCTAGGCACTTTATGG - Intronic
996284825 5:121777115-121777137 GAACTGTGCTTGGCAAATAGGGG + Intergenic
997443742 5:133926584-133926606 CCACTGTTCCTGGCACAGCAGGG + Intergenic
997945336 5:138195306-138195328 CCACTGCGCCTGGCCCATAAAGG - Intronic
998198904 5:140102038-140102060 CCACTGCACCTGGCCCATAAAGG + Intergenic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
998599454 5:143570210-143570232 GCACAGTGCTTGACACATAGGGG + Intergenic
999193064 5:149763070-149763092 CCACTGTGCCTGGCTCACCAAGG + Intronic
999321885 5:150620342-150620364 GCACAGGGCTTAGCACATAAAGG - Intronic
999462167 5:151766982-151767004 GCACTGTGACTGTCACATAATGG + Intronic
999696023 5:154189825-154189847 GCACAGTGTTTGGCACATAGTGG + Intronic
1000065045 5:157687005-157687027 CCACTGCGCTTGGCCTCTAAGGG + Intergenic
1000365444 5:160486486-160486508 GCACAGTGCTTGGCACATAGTGG - Intergenic
1001133072 5:169080339-169080361 GCACAGTGCTTGGCACATAAAGG - Intronic
1001145291 5:169178471-169178493 ACACAGAGCTTGGCACAGAATGG + Intronic
1001251274 5:170148847-170148869 CCACTGTAAGTGCCACATAATGG + Intergenic
1001427068 5:171629639-171629661 TCATTGTGCCTGGCACATAGTGG + Intergenic
1001557001 5:172643363-172643385 CCTCTGTGCTTGGCATGTGATGG + Intronic
1001930300 5:175668194-175668216 CCACAGTGCTTGGCCCACACTGG - Intronic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1002966963 6:1976396-1976418 ACCCAGTGCCTGGCACATAACGG + Intronic
1003430755 6:6035384-6035406 GCACAGTGCTTGGCACAAAGAGG + Intergenic
1003458512 6:6307142-6307164 GCACTATGCCTGGCACATAGTGG + Intronic
1003491881 6:6629546-6629568 CCACTGTGGGTGGCACATTGTGG + Intronic
1003696834 6:8415496-8415518 CCACTCTGCCTGGGACAGAAGGG - Intronic
1004384202 6:15158406-15158428 CCACGGTGCCTGGCCCAAAATGG + Intergenic
1004621996 6:17338997-17339019 CCACCGTGCCTGGCCCATATTGG - Intergenic
1004859568 6:19788438-19788460 GCACTATGCTAGGCCCATAATGG + Intergenic
1005569818 6:27133882-27133904 CCACTGTGCCGGGCACGTAGCGG - Exonic
1005836302 6:29712010-29712032 CCACTGTGGTAGGGACATAATGG - Intergenic
1005865627 6:29933962-29933984 CCACTGTGATAGGGACATAATGG - Intergenic
1005907103 6:30272267-30272289 CTTCTGTGTCTGGCACATAAAGG + Intergenic
1006032557 6:31187873-31187895 CTCCAGTTCTTGGCACATAATGG - Intergenic
1007118725 6:39362859-39362881 CCACTGTGCCTGGCCCTGAAGGG - Intronic
1007209610 6:40181897-40181919 GCACAGTTCTTGGCACATCATGG - Intergenic
1007257568 6:40539516-40539538 CGACTGTGTCTGGCACATAGTGG - Intronic
1007357135 6:41329169-41329191 CCACTGTGCCTGGCCAAAAAGGG - Intergenic
1007379841 6:41481569-41481591 CCACTGTGCTGGGCCTAGAATGG - Intergenic
1007546587 6:42698955-42698977 CCCCATTGCTTGGCACATATTGG + Intronic
1007717488 6:43865660-43865682 CAACTGTGCTTGGAAAATCAGGG + Intergenic
1008541084 6:52546912-52546934 CAACAGCGCTTGGCACATAGTGG + Intronic
1008545583 6:52580331-52580353 CCACTGTGCCTGGCAAGAAATGG + Intergenic
1008684942 6:53914945-53914967 TCAGAGTGCCTGGCACATAATGG + Intronic
1008951365 6:57163393-57163415 GCACAGTGTTTGGCACAAAATGG + Intronic
1009596734 6:65745824-65745846 CCACTTTGCTTGTCTCCTAAGGG - Intergenic
1010240674 6:73612762-73612784 CCACTGTGCCTGGCCTAGAAAGG - Intronic
1010254357 6:73740876-73740898 CCACTGTGCCTGGCCAAGAAAGG + Intronic
1010422786 6:75693110-75693132 CCACTGTGCCTGGCCTACAATGG - Intronic
1010966079 6:82210536-82210558 CCACTATGCCTGGCCAATAAAGG - Intronic
1011583973 6:88904283-88904305 CCACTGTGCTTGGCCTTTAAAGG - Intronic
1011595671 6:89013718-89013740 CCACTGTGCCCGGCTAATAATGG - Intergenic
1011690271 6:89860555-89860577 CCACTGTGCCTGGCCTATATTGG - Intronic
1012664364 6:101948760-101948782 CCACTGTGCCTGGCCTAAAAAGG + Intronic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1013604456 6:111734857-111734879 GCACAGTGCCTGTCACATAAAGG - Intronic
1013885317 6:114958174-114958196 CCACTGTGCTTGGCCTAAATTGG - Intergenic
1014032829 6:116726087-116726109 GCACAGTGCCTGACACATAATGG + Intronic
1014750994 6:125256059-125256081 CCACCGTGCCTGGCCCCTAATGG - Intronic
1015066215 6:129032146-129032168 CCACAGGGCTGGACACATAAAGG - Intronic
1015257119 6:131190964-131190986 ATACTGTGCTTGGCACATACAGG + Intronic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1015950720 6:138549950-138549972 CCACTGTGCCCGGCCCACAAGGG - Intronic
1015954047 6:138582182-138582204 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1016013918 6:139165043-139165065 GCACAGTACCTGGCACATAAAGG - Intronic
1017113671 6:150955785-150955807 CCACTGTGCTTGGCCTCTAGTGG + Intronic
1017316724 6:153039462-153039484 GCCCTCTGCTTGGCACATCATGG - Intronic
1017662782 6:156690190-156690212 CCAAAGTGCTTGGCACATCCTGG + Intergenic
1018645352 6:165942877-165942899 CCACTGTGATTGGTAAATTAGGG + Intronic
1018649399 6:165979618-165979640 CCAGTGTACCTGGCACCTAATGG - Intronic
1019023621 6:168940088-168940110 CCACTGTGCATGACCCATCAAGG - Intergenic
1020060472 7:5147944-5147966 CCACTGTGCCTGGCCCCAAAAGG - Intergenic
1020423325 7:8035283-8035305 GCACTGTGCTTGGCTCTTCAAGG + Intronic
1020827284 7:13045302-13045324 GCACCGTGCCTGGCACATATTGG - Intergenic
1022057461 7:26753729-26753751 TCACAGTGCCTGGCACATAGTGG - Intronic
1022119686 7:27295959-27295981 GCACAGAGCTTGGCACATCATGG - Intergenic
1022671888 7:32463394-32463416 GCACTGTGTTTGACACATACAGG + Intergenic
1022823209 7:33981596-33981618 CTTCTGTGCTTGGCTCATAATGG + Intronic
1023071501 7:36439417-36439439 GCACAGTGATTGGCATATAAAGG - Intronic
1023083453 7:36546891-36546913 GCACAGTGCTTGGCACATCGTGG + Intronic
1023088934 7:36600128-36600150 TCTCAGTGCCTGGCACATAAGGG - Intronic
1025276638 7:57587792-57587814 TCACTGTGCCTGGCAAATTATGG - Intergenic
1025699663 7:63805936-63805958 CCATTGTGGTAGGTACATAATGG + Intergenic
1026617122 7:71915444-71915466 CCACTGTGCCTGGCCCAGATTGG - Intronic
1026942614 7:74296212-74296234 CCACCGTGCTGGGCACAGCAGGG - Intronic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1027148123 7:75713038-75713060 CCACAGGGCTTTGCACATAAGGG - Intronic
1028102674 7:86840099-86840121 GCACTGTGCTAGGCACAGAGGGG + Intronic
1028256702 7:88608122-88608144 CCACCGCGCTTGGCCTATAATGG - Intergenic
1028449412 7:90963999-90964021 CCACTGTGCCTGGCCGACAAAGG + Intronic
1029312946 7:99684453-99684475 CCACTGTGCTTGGTCAAAAAAGG + Intergenic
1029522702 7:101074100-101074122 CCACTGTGCCTGGCCTAGAATGG - Intergenic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029923413 7:104290432-104290454 GCACAATGCTTGGCACATAATGG - Intergenic
1030217933 7:107065764-107065786 TCACAGTGCCTGGCAGATAAAGG - Intronic
1030688708 7:112511301-112511323 GCTCTGTCCTTGGCATATAAAGG - Intergenic
1030947090 7:115737064-115737086 CCACTGTGCTTGGCCTATAGTGG + Intergenic
1031071435 7:117166600-117166622 CCACTGCGCCTGGCCCATAAAGG - Intronic
1031832737 7:126647102-126647124 CCACTGTGCTTGGCTCCTAAAGG - Intronic
1032164805 7:129537222-129537244 CCACTGTGCCCGGCAGAGAATGG - Intergenic
1032415615 7:131733206-131733228 CCCCTGTGCCTGGCACACAAGGG - Intergenic
1032568766 7:132976473-132976495 CCATAGTGCCTGGCACATAGAGG + Intronic
1032712546 7:134473369-134473391 CCACTGTGCCTGGCTAATCATGG + Intergenic
1032727241 7:134601933-134601955 CCCCTGTTATTGCCACATAAAGG - Intergenic
1033183337 7:139202076-139202098 CCACTGTGCCTGGCTGGTAAAGG - Intergenic
1033907471 7:146223042-146223064 CAACAGTGCCTGGCACATATAGG - Intronic
1035144192 7:156796932-156796954 GAATAGTGCTTGGCACATAAGGG - Intronic
1036956247 8:13191217-13191239 CCACTGTGCCTGGCCAATAAGGG - Intronic
1037239674 8:16762414-16762436 CCATTGTTCTGGCCACATAAGGG + Intergenic
1037330301 8:17737344-17737366 GCACTGTGCTTGGCGCACACAGG + Intronic
1037463072 8:19132519-19132541 CCACCGTGCTTGGCCTGTAATGG + Intergenic
1038603562 8:28974099-28974121 CCACTGTGCCCAGCTCATAATGG + Intronic
1038628932 8:29222057-29222079 CCACTGTGCCTGGCATATATAGG - Intronic
1040045081 8:42954670-42954692 CTACAGTGCTTGGTACATACTGG - Intronic
1040720533 8:50316809-50316831 GCACAGTGCTTGGGACATAGTGG - Intronic
1040862922 8:52019186-52019208 CCTCTTTGCTTGGCACAACATGG + Intergenic
1040996380 8:53407137-53407159 GCACTGTGCATGGCATAGAAAGG + Intergenic
1041135762 8:54757093-54757115 CCTCGGTGCTTGGGATATAATGG + Intergenic
1041619010 8:59943409-59943431 CAACTCTGCCTGGCACATAGAGG - Intergenic
1042140243 8:65670980-65671002 CCACTGTGCCTGGCAGAATATGG + Intronic
1042175774 8:66035937-66035959 CCACAATACTTGGCACCTAATGG - Intronic
1042258369 8:66830141-66830163 CCACTGTGCCTGGCCAAAAATGG + Intronic
1042618764 8:70679851-70679873 GCTCAGTGCTTGGCACATAGTGG + Intronic
1042664238 8:71188926-71188948 GCACTGGGCTGGGCACATAGTGG + Intergenic
1043525209 8:81089280-81089302 CCACTGCGCCTGGCCCATCAGGG - Intronic
1044545101 8:93450513-93450535 GCACAGTGTTTGCCACATAATGG - Intergenic
1044574816 8:93756786-93756808 CCACTGTGCCTGGCCTATACAGG - Intronic
1045003571 8:97898632-97898654 CCACAGTGCCTGGCACATGGTGG - Intronic
1045261693 8:100581006-100581028 CCACTGTACCTGGCCCTTAAAGG - Intronic
1045379290 8:101607170-101607192 GAACTGTGCTTGGCACACAATGG - Intronic
1045928374 8:107597096-107597118 CCACTGAGCCAGGCACATGAGGG + Intergenic
1046131099 8:109969557-109969579 CCACCGTGCCCGGCCCATAATGG - Intronic
1046402921 8:113730621-113730643 CCACTGCGCCTGGCCCATACTGG + Intergenic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047534850 8:125710075-125710097 ACCCTGTGCCTGGCACATAGTGG + Intergenic
1047537236 8:125731219-125731241 GCATGGTTCTTGGCACATAATGG - Intergenic
1047625468 8:126651762-126651784 CCACTGCGCCTGGCCCATGATGG + Intergenic
1047852535 8:128874109-128874131 GCACTGTGCTTGGCACATAACGG - Intergenic
1048561983 8:135549244-135549266 GCACTGTGCATGGCACACAGAGG - Intronic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1049295190 8:141829414-141829436 CCACCGTGCTTGGCCCATGAGGG - Intergenic
1049447318 8:142637291-142637313 CCACTGTTGTTGGCACGTCAGGG - Intergenic
1050220181 9:3379087-3379109 GCACTATGTCTGGCACATAATGG - Intronic
1051146924 9:14036808-14036830 CCACTGTGCATGGCCCATGATGG - Intergenic
1051903980 9:22074148-22074170 CCACTGTGCTTGGCACCTAGAGG + Intergenic
1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG + Intergenic
1052340792 9:27362423-27362445 GTACTGTGCTTGGCACTCAATGG + Intronic
1052787349 9:32841653-32841675 ACACAGTGCCTGGCACATACAGG + Intergenic
1053140632 9:35680513-35680535 CCACTGTGCCTGGCCCCAAACGG + Intronic
1055564979 9:77559329-77559351 TCACTGTGCTTGCCAAATATGGG + Intronic
1056470025 9:86896721-86896743 CCAGTGTGCATGGCAATTAATGG - Intergenic
1056895382 9:90542645-90542667 CCACTGTGCCCGGCCCATTAAGG - Intergenic
1057013720 9:91631958-91631980 CCACTATGCCTGGCATCTAATGG - Intronic
1057411480 9:94819858-94819880 CCACTGTGCTCAGCCCAAAAGGG + Intronic
1057424629 9:94938265-94938287 CCACAGTGCTTGGCACTGAGAGG + Intronic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1058008955 9:99953278-99953300 GCACAATGCTTGGCACATAATGG + Intronic
1058572225 9:106358973-106358995 CCTCTGGGCTTGGCACAAGATGG + Intergenic
1058778621 9:108310568-108310590 CCAGAGTGCCTGGCACAGAAGGG + Intergenic
1059021566 9:110581709-110581731 CCACGGTGCTTTGCACATAAAGG - Intergenic
1060208552 9:121696970-121696992 CCACTGTGTCTAGCACATAATGG + Intronic
1060294480 9:122333882-122333904 CCACTGTGCCTGGCCAACAATGG - Intergenic
1060336267 9:122726064-122726086 CCACAGTGCCTGGCCCAAAACGG - Intergenic
1060465427 9:123900316-123900338 GCACTGTATGTGGCACATAACGG - Intronic
1060649948 9:125317030-125317052 CCACTGCGCCTGGCCCATCAAGG - Intronic
1061469427 9:130812075-130812097 CCACTCTGCCTGGCCCTTAATGG - Intronic
1061864272 9:133484556-133484578 CCATAGTGCTGGGCACACAAAGG + Intergenic
1185494007 X:540558-540580 CCACTGTGCCTGGCCCATGCAGG + Intergenic
1185866364 X:3627749-3627771 CCACTGTGCCTGGCCAAAAAGGG + Intronic
1186551794 X:10513794-10513816 CCACTGTGCCTGGCCAACAATGG + Intronic
1186633519 X:11377205-11377227 GCATAGTGCTTGGCACAAAATGG + Intronic
1187167829 X:16821424-16821446 CCACTGTGCCTGGCCCGTGAGGG + Intronic
1187544444 X:20234001-20234023 CCAATGTGCCTGGCACATAATGG - Intronic
1188076018 X:25776045-25776067 CCACCGTGCCTGGCTCATTAAGG - Intergenic
1188553556 X:31386632-31386654 ACACAGTGCTTGGCACATAATGG + Intronic
1188602954 X:31991893-31991915 GAACAGTGCTTGGAACATAATGG - Intronic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189131708 X:38505624-38505646 GCACAGTGCTTGCCACATAGTGG + Intronic
1189193218 X:39129541-39129563 GCATAGTGCTTGGCACATAATGG + Intergenic
1189481931 X:41398657-41398679 CCACTGTGCCTGGCTGAAAATGG + Intergenic
1189521140 X:41769659-41769681 CCACTGTGCCTGGCCCAAAGAGG - Intronic
1189586739 X:42469544-42469566 CAATAGTGCTTGACACATAATGG - Intergenic
1190809664 X:53871052-53871074 CCACAGTGCCTGGCCCAGAATGG - Intergenic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1194786827 X:98095980-98096002 CCACTGTGCTAGGCACTTATGGG + Intergenic
1195090565 X:101454571-101454593 CCACTGCGCCTGGCTCATCATGG + Intronic
1195164827 X:102208961-102208983 TCACTGTGCCTAGAACATAATGG - Intergenic
1195194031 X:102478130-102478152 TCACTGTGCCTAGAACATAATGG + Intergenic
1196262884 X:113606037-113606059 GTACTGTGCATGGCACATAGCGG - Intergenic
1196306855 X:114113018-114113040 GCACTGTGCTTGGAACATACTGG + Intergenic
1197703217 X:129615619-129615641 GCACTGTGCCTGGCACACAATGG - Intergenic
1197961909 X:132016293-132016315 AAACTCTGCTTAGCACATAAAGG - Intergenic
1197990354 X:132310862-132310884 CCACTGTGCCTGGCCAATGATGG - Intergenic
1198812665 X:140551390-140551412 ACACAATGCTTGGCACACAATGG - Intergenic
1200068478 X:153516541-153516563 CCACTGTGCTAGGGACCAAAAGG - Intergenic
1200181593 X:154154249-154154271 CCATTGTGCCTGGCCTATAATGG + Intronic
1200187241 X:154191363-154191385 CCATTGTGCCTGGCCTATAATGG + Intergenic
1200192890 X:154228503-154228525 CCATTGTGCCTGGCCTATAATGG + Intronic
1200198645 X:154266307-154266329 CCATTGTGCCTGGCCTATAATGG + Intronic
1200793432 Y:7319085-7319107 GGACATTGCTTGGCACATAAGGG + Intergenic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic