ID: 1078749237

View in Genome Browser
Species Human (GRCh38)
Location 11:14144050-14144072
Sequence TTTTTCAAATGTAAAATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1381
Summary {0: 1, 1: 0, 2: 9, 3: 130, 4: 1241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078749237_1078749238 8 Left 1078749237 11:14144050-14144072 CCTTAGATTTTACATTTGAAAAA 0: 1
1: 0
2: 9
3: 130
4: 1241
Right 1078749238 11:14144081-14144103 AGAATATGAATTACCTCTGTTGG 0: 1
1: 0
2: 1
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078749237 Original CRISPR TTTTTCAAATGTAAAATCTA AGG (reversed) Intronic
900935813 1:5765765-5765787 TTTTTCAAATGGCAAATAAATGG + Intergenic
901364565 1:8735195-8735217 TTGTTACAATCTAAAATCTAAGG + Intronic
901588532 1:10318846-10318868 TTTTTCAAATTAACAACCTAAGG + Intronic
902166501 1:14576152-14576174 TTTTACAAATGTGACAACTAAGG - Intergenic
902429177 1:16349457-16349479 TTTGTAAAATGTAAAATAAAAGG - Intronic
902435181 1:16393826-16393848 TTTTTCAGATGAGAAAACTAAGG - Intronic
902727302 1:18345794-18345816 TTTTACAAATGTGAAAACTGAGG + Intronic
903256517 1:22105636-22105658 TTTTTCAAATGAGAAAACCAAGG - Intergenic
903339617 1:22645416-22645438 TTTTGCAAATGTCAAAGCTGGGG + Intronic
903391869 1:22970129-22970151 TCTTTCAGCTGTAGAATCTAGGG + Intergenic
903405233 1:23090249-23090271 TTTTTCAGATGTAGAAGCTAAGG - Intronic
903782337 1:25828997-25829019 TTTTAGAAATGTAAAAACTGAGG + Intronic
903795287 1:25923927-25923949 TTTTCCACATGTAAAATCCCTGG + Intergenic
903851225 1:26307332-26307354 TTTTACAGATATAAAAACTAAGG - Intronic
903911453 1:26729456-26729478 TTTTTCAAATGACAAAATTAGGG + Intronic
904516791 1:31062036-31062058 TTTTACAAATGAAAACACTAAGG + Intronic
905102356 1:35535524-35535546 TTTTACACATGAAAAAACTAAGG - Intronic
905526006 1:38640267-38640289 TTTTTCAGATGAAGAAACTAAGG + Intergenic
905841548 1:41184291-41184313 TTTTACAAATGAAGAATGTAGGG + Intronic
905906979 1:41625373-41625395 TTTTTTAAATGCATTATCTATGG - Intronic
905965509 1:42091864-42091886 TTTTTTAAATTTAAAATAAATGG + Intergenic
905984505 1:42266774-42266796 TTTTTGCTTTGTAAAATCTATGG - Intronic
906115501 1:43354007-43354029 TTTTACAGATGAAAAAACTAAGG - Intergenic
906871588 1:49487753-49487775 TTTTAAAAATGAAAAACCTATGG + Intronic
906925839 1:50115478-50115500 TTTTTCAAATGAAGAGTCCAAGG - Intronic
907002857 1:50879727-50879749 TGTTTGAAATGTAAATTCTCAGG + Intronic
907380012 1:54079304-54079326 TTTTACAAATGGAAAAACTGAGG + Intronic
907556912 1:55352107-55352129 TTTTGCAGATGAAAAACCTAAGG - Intergenic
907778946 1:57546511-57546533 TTTTACAGATGAAAAAACTAAGG - Intronic
907794826 1:57705988-57706010 TTTTTCAAATATATAATTTAAGG + Intronic
907887956 1:58611060-58611082 TTTTGCAAATGAAAAAACTGAGG - Intergenic
908065136 1:60394961-60394983 ATTTTCAAATGAACAATCTTTGG + Intergenic
908402218 1:63782166-63782188 TTTTTCAAATGACAGATTTATGG + Intronic
908529253 1:65018213-65018235 CTTTTCTAATATAAAATGTAAGG - Intergenic
908621435 1:65984846-65984868 TATTACATATGTAAAATCAAAGG - Intronic
908712327 1:67030430-67030452 TTTTACATATGTAGAAACTAAGG - Intronic
908773848 1:67620634-67620656 TTTTTCAAGTGTGAAAATTAAGG - Intergenic
908880120 1:68722624-68722646 TTTTCCAAATGTAGAAACTGAGG - Intergenic
908924925 1:69242535-69242557 GTATTCAAATCTAAAATCTTTGG - Intergenic
909199481 1:72671626-72671648 TTTTCCAAATGTAAGTGCTAGGG + Intergenic
910297841 1:85669396-85669418 TTTTTAAATTTTAAAAACTAAGG - Intronic
910345876 1:86237380-86237402 TTTTTAAAATGTTAATTCTGAGG - Intergenic
910361914 1:86421365-86421387 ATTATAAAATCTAAAATCTATGG + Intergenic
910651104 1:89568756-89568778 TTTTTTAACAGTAAAATCTAAGG + Intronic
910782896 1:90960472-90960494 GTCTTCAAATGTACACTCTATGG + Intronic
910869698 1:91821774-91821796 TTTTACAAATGAGAAAACTAAGG - Intronic
911315105 1:96346843-96346865 TCTTTCATATGTATAATCAAAGG + Intergenic
911329033 1:96504913-96504935 TTTTTCAAATCTACAATTTTTGG + Intergenic
911651598 1:100395175-100395197 TTTTACAAATGAGAAAACTAAGG - Intronic
911830439 1:102544193-102544215 TTTTTAATATGAAAAATCTGTGG - Intergenic
911860310 1:102939207-102939229 TGTTTAAAATGGAAAATCTTGGG + Intronic
912304414 1:108552158-108552180 TTTTTTAAATTTAAAAACAAAGG + Intergenic
912922044 1:113878237-113878259 TTTTACAAATGTAGAAACTAAGG + Intronic
913350876 1:117857622-117857644 TTTGTCAACTGTAAAATAGAGGG - Intergenic
913585952 1:120276008-120276030 TTTTTCAAATGGTAAATATTTGG + Intergenic
913622233 1:120622361-120622383 TTTTTCAAATGGTAAATATTTGG - Intergenic
914567956 1:148887866-148887888 TTTTTCAAATGGTAAATATTTGG + Intronic
914604868 1:149242382-149242404 TTTTTCAAATGGTAAATATTTGG - Intergenic
914987042 1:152469648-152469670 TTTTTAACCTGTAAAATATAAGG + Intergenic
915053256 1:153100089-153100111 TTTTTCATACACAAAATCTAGGG - Intronic
915261516 1:154679938-154679960 TTCTTAAAATGCAAAATCTCAGG - Intergenic
915452462 1:156015736-156015758 TTTTTTAAATCTAAAGTGTATGG + Intronic
915952601 1:160199514-160199536 TTTTAGAAATGTAAGATCTGAGG + Intronic
916216995 1:162404360-162404382 TTTTTCAAAAATATAATATATGG - Intronic
916371657 1:164103002-164103024 TTTTACAAATGAGAAATCTGAGG - Intergenic
916459892 1:165012826-165012848 TTTTTCATATGTAAAGTGAAAGG + Intergenic
916475502 1:165164880-165164902 TTTATCAACTGAAAAATCCAGGG - Intergenic
916486725 1:165266114-165266136 TCTATCAAATGTAAACTCCAAGG - Intronic
916702014 1:167306549-167306571 TTTTTCAAATGAGAAAATTAAGG + Intronic
916913412 1:169377917-169377939 TTTTTTAAAAGTAAATTCTTAGG + Intronic
916947259 1:169741461-169741483 ATTTTCTCATGTAAAAACTAAGG - Intronic
917388707 1:174507877-174507899 ATTTTTAAATGTAAAAACCATGG + Intronic
917447201 1:175116551-175116573 TTCTTCATCTGTAAAATCTGAGG - Intronic
917549840 1:176014588-176014610 TTTTTAAAAATTAAAATCTAAGG + Intronic
917825752 1:178818685-178818707 TTTTGCTAAAGTAAAATCTGTGG - Intronic
918075627 1:181169084-181169106 TTTTTCAAATATAACCTTTATGG + Intergenic
918367853 1:183827789-183827811 TTTTTAAACTTTACAATCTATGG + Intronic
918504640 1:185238443-185238465 TGTTACAAATGTAAAGTTTAAGG + Intronic
918716499 1:187794031-187794053 TTTTTAAAATATAAATTTTAAGG + Intergenic
918893787 1:190313723-190313745 TATTTCAAATGAGAAAACTAAGG + Intronic
918936320 1:190926843-190926865 TTTTCCAAATGCAAAAACTGAGG + Intergenic
918997187 1:191776917-191776939 TACTTCAAAAGTAAACTCTAAGG + Intergenic
919127979 1:193419367-193419389 TGTTAGAAATGGAAAATCTAGGG - Intergenic
919433708 1:197530823-197530845 TTTTACAAATGTAAACATTAAGG + Intronic
919496702 1:198281220-198281242 TTTTCCAAAAGTAAAAATTAGGG - Intronic
919571179 1:199250054-199250076 TTTTTAAAATATAAAATAAAAGG + Intergenic
919913441 1:202126101-202126123 TTTTTGAGATGTAAAATAGAAGG + Intronic
920130504 1:203728417-203728439 TTTTTGAAATGGAAAATCTCAGG - Intronic
920708487 1:208273190-208273212 TCTTTAAAATGTAAAAATTATGG - Intergenic
920988895 1:210916834-210916856 TTTTAAAAATGTAAAATACACGG - Intronic
921249482 1:213282930-213282952 TTTTACAAATGGAGAAACTAAGG + Intergenic
921522334 1:216171454-216171476 TTGCTCAAATGTTATATCTAGGG - Intronic
922054991 1:222033458-222033480 TTTTGCAGATGAAAAATCTAAGG + Intergenic
922138825 1:222860531-222860553 TTTTTAAAATTTAATATCTCAGG - Intergenic
922274927 1:224068666-224068688 TATATAATATGTAAAATCTAAGG - Intergenic
922284723 1:224160068-224160090 TTGTTCAAATCTTAAATCTTAGG + Exonic
922589880 1:226767037-226767059 GTATTCAAATGTATAATCAAGGG + Intergenic
923059071 1:230453794-230453816 TTTTTGAAATGCAATATCAAGGG + Intergenic
923212725 1:231819755-231819777 TTTTTTAAATGTATAAACGATGG + Intronic
923347112 1:233065522-233065544 TTTATAACATGTAAAATCCAGGG - Intronic
923403098 1:233634455-233634477 TTTCTCAGATGTGAAATCTGAGG + Intronic
923438722 1:233994998-233995020 TTTTACAAATGTAATATCTGAGG - Intronic
923918135 1:238531370-238531392 TTTTTCAAATCTATATTCTGAGG - Intergenic
924028065 1:239858503-239858525 TTTTCCAAATGAAAATACTATGG - Intronic
924068122 1:240247139-240247161 TTGTTCCTATGTAAAATCTTAGG + Intronic
924085583 1:240448426-240448448 TTTTTCAAATCTAATCTCCATGG + Intronic
924504117 1:244664869-244664891 TTTTTGCAAGGAAAAATCTAGGG - Intronic
924703361 1:246476446-246476468 TTTTGGAAATGTAAAATCTCAGG - Intronic
924797843 1:247305375-247305397 TTTTCCAAATAAAAAATGTAAGG + Intronic
1063087732 10:2834721-2834743 TTTGAAAAATGTAAAAACTATGG + Intergenic
1064389868 10:14932745-14932767 CTTTACAAATGTAAAACCTGAGG - Intronic
1064417538 10:15163607-15163629 TTTTTCTTATGGAAAATTTAGGG - Intronic
1064426046 10:15230236-15230258 TTTTTCCAAATTAAAGTCTACGG + Intronic
1064486997 10:15803542-15803564 TTTTGGAAATGGAAAATCTGAGG - Intronic
1064539207 10:16388846-16388868 TTTTTCAAACTTCAAGTCTATGG - Intergenic
1064557374 10:16560999-16561021 TTTCTAAAATGTAAATTTTAAGG - Intergenic
1064591460 10:16896423-16896445 TTTTCCAGATATAAAATGTATGG + Intronic
1064704865 10:18061306-18061328 TTTTAAAAATTTAAAAACTAAGG + Intergenic
1064818519 10:19295881-19295903 TGTTTAAAATGTAAATTCTTAGG - Intronic
1065813996 10:29468582-29468604 TTTTTTAAATTTAAAATTTGTGG + Intronic
1065844209 10:29731600-29731622 TTTTCCATATGTAAAACCTTAGG - Intronic
1065968289 10:30785875-30785897 TTTGTAAAATCTAAAATGTAAGG - Intergenic
1065982508 10:30914248-30914270 TTTTTAAAATGGAAAAATTATGG + Intronic
1066170970 10:32845340-32845362 TTTTTCACATCTAATATTTATGG + Intronic
1066194675 10:33087581-33087603 TTTTTTAAATGTAAAATACAGGG - Intergenic
1066573285 10:36797121-36797143 TTTTTCACATGTAAAGTGTATGG - Intergenic
1067222018 10:44351133-44351155 TTTTACAAATGAAGAAACTAAGG + Intergenic
1067749232 10:48959078-48959100 TTTTCCACCTGTAAAATTTAAGG - Intronic
1068326662 10:55498078-55498100 TTATTCAAATGTAAAATGACTGG + Intronic
1068634189 10:59330410-59330432 GTATTCAAATGTAAAATCAATGG + Intronic
1068899050 10:62243863-62243885 ATTTTCAAAAGTGAAAACTAAGG + Intronic
1068923010 10:62504844-62504866 TTTTCTAAATGAAAAAACTAAGG + Intronic
1069015323 10:63422884-63422906 ATTTTTAAATGTATAATTTAAGG + Intronic
1069087160 10:64154418-64154440 TTTTACAAATTGAAGATCTATGG - Intergenic
1069195292 10:65544044-65544066 TTTTTCAAATGACAAATAAAGGG - Intergenic
1069217644 10:65842127-65842149 GTTTTCTAATGTAAAAACTTTGG - Intergenic
1069717037 10:70527792-70527814 TTTTTAAAATTTAAGTTCTAGGG + Intronic
1069731481 10:70618152-70618174 TTTTTAAACTGTATAATCTAAGG - Intergenic
1069825244 10:71250797-71250819 CTTTTCTAATTTATAATCTATGG + Intronic
1069837994 10:71321192-71321214 TTTTTCAGATGGAAAAACTGAGG - Intronic
1070452592 10:76576854-76576876 TTTTCCAAATGAGAAAACTAAGG - Intergenic
1070631462 10:78087971-78087993 TTTTACAGATGGAAAAACTAAGG - Intergenic
1070701850 10:78608983-78609005 TTTTTTAAATGTAGATTCTTTGG + Intergenic
1071356845 10:84805562-84805584 TTTTACAAATGAAAAACCTGAGG + Intergenic
1071391108 10:85176115-85176137 TTATTCAAATTTTAAATCTTTGG - Intergenic
1071696693 10:87882245-87882267 TTTTTCAACTGGAAAATTCAAGG + Intronic
1071703910 10:87975962-87975984 ACTCTAAAATGTAAAATCTATGG - Intergenic
1071734593 10:88283947-88283969 TTTTTTAAATTTTAAATGTAGGG - Intronic
1071910413 10:90225647-90225669 TTTTTCAAATTTAAAATTTCTGG + Intergenic
1072045581 10:91651387-91651409 TTTTTTAAATGTACACTCTTTGG + Intergenic
1072153676 10:92704334-92704356 ATTTTCAAATGTAAATTTTATGG - Intergenic
1072244488 10:93530470-93530492 TTTTTCAGATGAGAAAACTAAGG + Intergenic
1072280230 10:93859306-93859328 TTCTTGAAAGGTAAAATCTTGGG + Intergenic
1072317857 10:94221207-94221229 TTGTTCAAATGTAGATTCCAAGG - Intronic
1072341172 10:94452122-94452144 GTATTTAAATGTAAAAACTATGG + Intronic
1072393187 10:95010504-95010526 CTATTTAAATGTAAATTCTAAGG - Intergenic
1072396232 10:95045111-95045133 CTATTTAAATGTAAATTCTAAGG + Intronic
1072524827 10:96262446-96262468 TTTTTCAGATGAAAAACCTGAGG + Intronic
1072754019 10:98005989-98006011 TTTATCAAATGAATAATCTTTGG + Intronic
1072820209 10:98549217-98549239 TTTTACAGATGAAAAATCTAAGG - Intronic
1072838986 10:98749068-98749090 TTTTTTAAATGCAAGATCCAAGG + Intronic
1072922942 10:99591941-99591963 TGCTTCAAAAGTAAAATCCAGGG - Intergenic
1073220133 10:101864871-101864893 TTTTTTAAATTTAAGTTCTAGGG - Intronic
1073521087 10:104130130-104130152 TTGTTCAAATGTAAAAACGCTGG - Exonic
1073575683 10:104620916-104620938 TTTTTCTAATGAGAAAACTAAGG - Intergenic
1073896551 10:108166835-108166857 TAATTAAAATGTAAACTCTAGGG + Intergenic
1074011367 10:109484587-109484609 TTATTCAGATGAAAAATATAGGG - Intergenic
1074337562 10:112593554-112593576 TTTTTCATATGGAAAGTTTAGGG + Intronic
1074376849 10:112947842-112947864 TTTATCATATGTAAATACTAAGG - Intergenic
1074396000 10:113098323-113098345 TTTTTCAAATCTACACTCAATGG + Intronic
1074434113 10:113419106-113419128 TTTTTTCAAGGTAAAGTCTATGG + Intergenic
1074487297 10:113898027-113898049 GTTTTAAAATGTTAAATTTATGG - Intronic
1074706879 10:116140937-116140959 TTCTTCAAATGTCAAATATGTGG - Intronic
1074964245 10:118474585-118474607 TGTTATAAATGTAAAATCTCAGG - Intergenic
1075316323 10:121456602-121456624 TTTTCAACATGTAAAATCTGGGG - Intergenic
1075396389 10:122130726-122130748 CTTTACAGATGTAAAAACTAAGG - Intronic
1075449748 10:122542472-122542494 AATTTAAAATGTAAAATTTAAGG - Intergenic
1075494554 10:122908688-122908710 TCTTTCACATTTGAAATCTATGG + Intergenic
1075578655 10:123599354-123599376 TTTTTCATATGGAAAAACTAAGG + Intergenic
1075685283 10:124360551-124360573 TTTTTAAAATGTAAAAAAAAAGG + Intergenic
1075869747 10:125762328-125762350 ATTTACAGATGTAAAACCTAAGG - Intronic
1076097220 10:127741102-127741124 CTTTTTAAATGTATAAGCTAAGG - Exonic
1076349433 10:129805715-129805737 TTTTTCAAAGGAAGAATCTGTGG + Intergenic
1077786033 11:5384344-5384366 TTTTCCAAGTGAAAAATCTAAGG - Intronic
1077877844 11:6322565-6322587 TTTTCCAAATCCAAATTCTATGG + Intergenic
1078037777 11:7825382-7825404 TATTTCAAAAGTAAAATCATGGG + Exonic
1078319460 11:10321035-10321057 TTTTTAAAATGCAAAATACAAGG + Intronic
1078656158 11:13242123-13242145 TGTTTAAAATGTAAAAACAATGG - Intergenic
1078749237 11:14144050-14144072 TTTTTCAAATGTAAAATCTAAGG - Intronic
1079417465 11:20252953-20252975 TTTTACAGATGAGAAATCTAAGG - Intergenic
1079686105 11:23362014-23362036 TTTTACAGAAGAAAAATCTAAGG - Intergenic
1079717658 11:23768867-23768889 TTATTCAAATGTTCAATTTATGG + Intergenic
1079759130 11:24306957-24306979 GTTTTCAATTGTAAAAGCTGAGG - Intergenic
1079954568 11:26846868-26846890 TTCTTCCAATGCAAAATCCATGG - Intergenic
1080159736 11:29159565-29159587 TTTTTCAACTGTGTAATCTTTGG - Intergenic
1080197934 11:29633290-29633312 TTTTACAAATGAAAACCCTAAGG + Intergenic
1080296993 11:30741653-30741675 TTTTTCAAATGTGAAAATCAAGG + Intergenic
1080654581 11:34248759-34248781 TATTTCAACTGCCAAATCTATGG + Intronic
1080782021 11:35438456-35438478 CTTTTCAAAAGAAAAAACTAAGG + Intronic
1080857194 11:36122396-36122418 TTTTTCAGATGGAAAATCTGAGG - Intronic
1081093518 11:38901739-38901761 TCTTTCAAATGTAATAACCAAGG + Intergenic
1081266156 11:41024792-41024814 TTTTACATATGGAAAGTCTATGG + Intronic
1081333032 11:41827464-41827486 TTCTTCAGATGTAAAACCTGAGG - Intergenic
1081399294 11:42624349-42624371 TTTATCAAATGCTAAGTCTAAGG + Intergenic
1081768044 11:45626101-45626123 TGTTTGAAATGTGAAATCTTGGG - Intergenic
1082250374 11:49972626-49972648 AATGTGAAATGTAAAATCTATGG + Intergenic
1082670007 11:56024366-56024388 ATTTTCAAAATTGAAATCTAGGG + Intergenic
1082921207 11:58496326-58496348 TTTTTCAGATGAGAAAACTAAGG - Intergenic
1082929879 11:58591474-58591496 CATTTCAAATGTACAATTTAGGG + Intronic
1083081493 11:60098844-60098866 ATTTTCAGATGTAAAACCTGAGG - Intergenic
1084608999 11:70188891-70188913 TTTTTCAAATATCAATTATATGG + Exonic
1084736039 11:71106293-71106315 ATTTTCAATTTTAAAATTTAAGG - Intronic
1085664876 11:78405653-78405675 TGTTTTATATGTAATATCTAAGG - Intronic
1086603270 11:88662167-88662189 TTCCTCAGATGTAAAAACTAGGG - Intronic
1086841830 11:91695284-91695306 TTTTTCAAATGAAGAAACTGAGG + Intergenic
1086952224 11:92902653-92902675 TTATCTAAATTTAAAATCTATGG - Intergenic
1087153866 11:94882378-94882400 TTTTTTAAAGGTAAAAAGTATGG - Intergenic
1087264551 11:96046001-96046023 TCTTTCAAAAGTAAATTCTGTGG - Intronic
1087566264 11:99862658-99862680 TTTTTCAAATGGTAAATCACTGG + Intronic
1087706105 11:101493635-101493657 TTTTGCACATGAAAAAACTAAGG + Intronic
1087760770 11:102102159-102102181 TGTTAGAAATGTAAAATCTCTGG - Intergenic
1087854119 11:103070175-103070197 TTTTTGAACTGTAAAATACAAGG + Intronic
1088080489 11:105906237-105906259 TTTTTCAAATGAGAAAATTATGG + Intronic
1088463975 11:110113347-110113369 TGTTTCAACTGTAATATGTAGGG - Intronic
1088591317 11:111405814-111405836 TTTTACAAGTGAAAAAACTAAGG - Intronic
1088719532 11:112579723-112579745 TTTTTTAAAAATAAAATATAGGG - Intergenic
1088825137 11:113487694-113487716 TTTTGCAAATCTATACTCTATGG - Intergenic
1088895524 11:114075433-114075455 TTTTTCCATTGTAAAATTAAGGG + Intronic
1089293609 11:117454486-117454508 ACTATCAAATGGAAAATCTAGGG - Intronic
1089536665 11:119164685-119164707 TTTTTAAAACGTAAATACTAGGG + Intergenic
1089873987 11:121702408-121702430 TCTTTCAAATGGAAAATATCAGG - Intergenic
1090049907 11:123368918-123368940 TCTTTCAAATATAAAGTGTAGGG - Intergenic
1090455659 11:126846931-126846953 TTATTCAAATGTTTAATTTATGG - Intronic
1090618432 11:128539205-128539227 TATATCAAATCTAAAACCTATGG + Intronic
1090918487 11:131187608-131187630 TTTTTCCAATAAAAAAACTAAGG - Intergenic
1090975908 11:131679723-131679745 TCTTTGAAATGTAAAATCTTGGG + Intronic
1091008322 11:131974700-131974722 TTTTTCAAGTGAAAAGACTAAGG - Intronic
1091032505 11:132203588-132203610 TTTTTCAAATGGAAATAATATGG - Intronic
1091066406 11:132517352-132517374 TCTTTCAAATGTACTATCAAGGG + Intronic
1091892415 12:4070217-4070239 TCTGTCAAAAGCAAAATCTATGG + Intergenic
1091905253 12:4181248-4181270 CTTTTAAACTGTAGAATCTATGG - Intergenic
1093285755 12:17259149-17259171 TTTTTTAAATGTAAAATGTATGG - Intergenic
1093349195 12:18076230-18076252 TTTTTCAACTGTAAATTTCAAGG - Intergenic
1093548735 12:20380786-20380808 TTTTTCAAATGAAAACCATATGG - Intronic
1093905586 12:24688403-24688425 TTTCTTAAGTGTAAAATCTTTGG + Intergenic
1094205330 12:27833596-27833618 TTTTTCAAATTGAACATCTGTGG + Intergenic
1094216605 12:27949168-27949190 TTTTTAAAAAGTAAAATCATGGG + Intergenic
1094553948 12:31479557-31479579 TTTGGAAAATGTAAAATCCAAGG + Intronic
1094601555 12:31913203-31913225 TTTTTTAAATGAAGATTCTAAGG + Intergenic
1094667062 12:32530753-32530775 TTTTACAAATGGATAATGTATGG + Intronic
1094677264 12:32633084-32633106 TTTGTAAAATGGAAAATCTTTGG + Intronic
1095054060 12:37579792-37579814 TTTATCAAATGTAAAAAATATGG - Intergenic
1095212364 12:39509378-39509400 TGCTTCAAATGGAGAATCTAAGG + Intergenic
1095260227 12:40089723-40089745 TATTTAAAATGTAAAATATATGG + Intronic
1095381375 12:41597683-41597705 CTTTTCAAATTTAAATACTAAGG + Intergenic
1095569646 12:43669865-43669887 TTTTTCAAATTTAAAAAAAAAGG + Intergenic
1095606623 12:44075536-44075558 TTTTACAAGTAAAAAATCTAAGG - Intronic
1095805753 12:46319140-46319162 TTTTTCTGATGTAGAATCAAGGG - Intergenic
1096167757 12:49437937-49437959 ATTTTTTTATGTAAAATCTAGGG - Intronic
1097089129 12:56491617-56491639 TTTTACAAATGGAGAAACTAAGG - Intergenic
1097138787 12:56881718-56881740 TTTTTAACATGTCAATTCTACGG - Intergenic
1097646308 12:62238527-62238549 TTTTACAAATGACAAATCTGAGG + Intronic
1097789066 12:63794779-63794801 TTTTTTAAATGAAAAATCATGGG - Intronic
1097825459 12:64170838-64170860 TTTTTTAAATGTACATGCTATGG + Intergenic
1098307092 12:69113174-69113196 TTTTTCAGATGAATAATCTGAGG - Intergenic
1098571522 12:71992849-71992871 TTCTTCATATGTAAAATGAAGGG + Intronic
1098581765 12:72108024-72108046 TATTTCAAATATAAAAATTATGG + Intronic
1099099422 12:78419613-78419635 TTTTACAAATGTAAATTCTATGG - Intergenic
1099123408 12:78721191-78721213 TTTTTCAAATGAAGAAACTGAGG + Intergenic
1099329109 12:81259275-81259297 TTTTTAAAAAATAAAATATATGG - Exonic
1099556397 12:84113340-84113362 TATTTCAAATATAAATTTTATGG - Intergenic
1099922277 12:88973603-88973625 TCTGTCAACTGTTAAATCTAAGG + Intergenic
1100197322 12:92261886-92261908 TTTTTCAGATGAAAAAACTGAGG + Intergenic
1100722887 12:97377428-97377450 TTTTTAAAATCTAAAATGTAGGG + Intergenic
1100738428 12:97564031-97564053 TTTCTCAGCTGTCAAATCTAAGG - Intergenic
1100767854 12:97887452-97887474 GTTTTCAGAGGTAAAAACTAAGG + Intergenic
1100870412 12:98904869-98904891 TTTCCCAAATGTAAAAACTGTGG + Intronic
1101054493 12:100898082-100898104 TTTTACAAATGGGAAATCTGAGG - Intronic
1101308061 12:103550657-103550679 TTTTTCAACTATAAAATTTTGGG - Intergenic
1101470025 12:104987054-104987076 TTTTCCAAATGCAAAAACTGAGG - Intronic
1102006547 12:109592647-109592669 TTTTACAGATGTAAAAACTGAGG + Intronic
1102066520 12:109980737-109980759 TATTAAAAATGAAAAATCTAAGG + Intronic
1102311423 12:111847584-111847606 TTTTTTAATTTTAAAAACTAAGG - Intronic
1102322297 12:111947054-111947076 TTGATTAAATGTAAAATCTTTGG - Intronic
1102354330 12:112220226-112220248 TTTTAAAAATCTAATATCTATGG + Intronic
1103618688 12:122172292-122172314 TTTTTCCAATGAATAATCTCAGG - Exonic
1104317177 12:127714032-127714054 TTTTACAAATGAGAAATCTGAGG + Intergenic
1104360821 12:128131449-128131471 TATTTCAAATGTATAATCCAAGG - Intergenic
1104585771 12:130047003-130047025 TTAATAAAAAGTAAAATCTAAGG - Intergenic
1105273343 13:18898804-18898826 TTTTTCAAATATTAAATCAATGG - Intergenic
1105664652 13:22540094-22540116 TTTCTCAACTGTAAATTTTATGG - Intergenic
1106097951 13:26666432-26666454 TTTTTCTACTGTAACATCCATGG - Intronic
1106147711 13:27065130-27065152 TTTTACAAAGGAAGAATCTAAGG - Intergenic
1106174834 13:27321376-27321398 TTTTTTAAATGGAAAATTTATGG - Intergenic
1106727118 13:32497373-32497395 TTTTTAAAAACTAAAATCTTGGG - Intronic
1106811672 13:33364509-33364531 TTTTTTAAATGTCCCATCTAGGG + Intergenic
1106844475 13:33723400-33723422 TTTTCCAGATGCAAAATCTGAGG + Intergenic
1106854451 13:33834054-33834076 TATTTCAGATGAAAAAACTAAGG - Intronic
1107250661 13:38357431-38357453 TTTTTGTAATGTATAATATAAGG + Intronic
1107250808 13:38359895-38359917 TTTTTAAAATGTAATCTCTTAGG + Intronic
1107278340 13:38703788-38703810 TTTTTAAATTGTTAAATCTTTGG + Intronic
1107334110 13:39334945-39334967 TTTTACAAATGAACAAACTAAGG + Intergenic
1107376894 13:39813322-39813344 TTTTTCATATGTAAGATGGAAGG + Intergenic
1108533773 13:51351195-51351217 TCTTCAAAATGTAAAATGTAGGG - Intronic
1108646183 13:52431223-52431245 TTTTTCAAATGTACAAAGAATGG + Intronic
1108670738 13:52685417-52685439 TGTTTCATATGTAGCATCTAGGG + Intronic
1108928927 13:55790167-55790189 ATTTTCAAAACTAAAATCTATGG + Intergenic
1108982277 13:56531146-56531168 TTTCTCAAACTTAAAATCCAAGG - Intergenic
1109119135 13:58431560-58431582 TTTTATAAATGAAAAATCAAGGG - Intergenic
1109324338 13:60849572-60849594 TTTTGCAAATGAAAAATTTGAGG + Intergenic
1109641397 13:65196232-65196254 TGTTTCAAATATTAAATATAGGG - Intergenic
1109648952 13:65299242-65299264 ATTTTCAGATGAAAAAACTAAGG - Intergenic
1109666216 13:65541922-65541944 TGTTTCAAGTGTAAAGTATATGG + Intergenic
1109843621 13:67953615-67953637 TATTTCTGCTGTAAAATCTAGGG + Intergenic
1110392095 13:74985708-74985730 CTTTTAAAATGTAAATTCTGTGG + Intergenic
1110756993 13:79186541-79186563 TATTTTAAATGGAATATCTAGGG - Intergenic
1110758315 13:79201784-79201806 TTTATCAACCGTGAAATCTAGGG + Intergenic
1110895264 13:80743119-80743141 TTTTTCACATATAAAATGAAGGG - Intergenic
1110999380 13:82159131-82159153 TTTTTTAAATGTTAAATTCAAGG - Intergenic
1111561699 13:89958419-89958441 TTTTTCACATGTAAGATATGAGG + Intergenic
1111561798 13:89960378-89960400 TTTCTCAAATCTAAGATCTGAGG + Intergenic
1111672850 13:91349514-91349536 TTTTTCAACTGTAAATTATTGGG + Intergenic
1111760873 13:92462521-92462543 TTTTGCAAATGTTAAATTTGAGG + Intronic
1111788507 13:92822237-92822259 TTTTTTCAAAGTAAAATTTATGG + Intronic
1112040437 13:95541835-95541857 TTTTACATATGAAAAATATAAGG - Intronic
1112209831 13:97364759-97364781 TTTTACAGATGAAAAATCTGAGG - Intronic
1112225082 13:97531888-97531910 TTTTTCAAATGCAAAGTAGATGG + Intergenic
1112548655 13:100397650-100397672 TTCTTGAAATGTTAAACCTATGG + Intronic
1112723046 13:102267866-102267888 TTATTCAAATGTATTATCTAAGG + Intronic
1112818846 13:103307207-103307229 TTTTTTAAATGAAAAACCTCAGG - Intergenic
1114145903 14:19978059-19978081 TTTATCATATGTAAAATGAAAGG - Intergenic
1114377430 14:22163232-22163254 TTGTTCATATGTAAAATGAAGGG + Intergenic
1114755313 14:25253322-25253344 TTTGTCAAATTTAAGATCGATGG + Intergenic
1115365171 14:32549719-32549741 TTTTTCAGATGAAGAAACTAAGG + Intronic
1115478024 14:33834966-33834988 TTTTTCAAATGAAAACTCAATGG - Intergenic
1115627129 14:35204978-35205000 TTTTACAAATGTAAAAACTGAGG + Intronic
1115654411 14:35429720-35429742 TTTTAAAAAGTTAAAATCTATGG - Intergenic
1115665978 14:35547500-35547522 TTTTTCACTTGTGAAATTTATGG + Intronic
1115697598 14:35917113-35917135 TGTTTCAGATGGGAAATCTACGG + Intronic
1115721744 14:36169218-36169240 TTTTTAAATTTTTAAATCTATGG + Intergenic
1115763222 14:36596759-36596781 TTTTACAGATGTAAAAGCTGAGG + Intergenic
1115801396 14:36997939-36997961 TTTTACAAATGAGACATCTAAGG + Intronic
1116157955 14:41232392-41232414 TTTTTCCATTGTAACATCTTAGG - Intergenic
1116221231 14:42090465-42090487 TATTTCAAATGTAAACTCAGAGG - Intergenic
1116422952 14:44754416-44754438 TTTTTCAATTGTAAAAACAGAGG + Intergenic
1116592135 14:46791258-46791280 TTTTTTTAATGAAAAATCTCTGG - Intergenic
1117148852 14:52864668-52864690 TCTTTCAAGTATAAAATATAAGG + Intronic
1117582914 14:57171014-57171036 TTTTACACATTTAGAATCTAGGG + Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1117899653 14:60518486-60518508 TTTTGCAGAAGTAAAAACTAAGG - Intergenic
1117918942 14:60707560-60707582 TTTTCCACATGTAGAATCTTAGG + Intergenic
1118205419 14:63718372-63718394 TTTTTCAAATAAAAGAGCTAAGG + Intronic
1118354219 14:64998791-64998813 TGTTTGAAATGTAAATTCTCAGG - Intronic
1118391462 14:65299303-65299325 TTTTTAAAAAGAAAAATCTCTGG + Intergenic
1118474141 14:66101460-66101482 TTTTGCATATCTGAAATCTATGG + Intergenic
1118663467 14:68040787-68040809 TTTTGAAAATGCAAAATCTCTGG + Intronic
1119096446 14:71836887-71836909 TTTTTAAAATGTAAAATTTTTGG + Intergenic
1119218265 14:72885699-72885721 TTTTTGGACTGTAAAATCTAGGG - Intronic
1119464148 14:74840935-74840957 TATTTCAAATGTGAAAGCAATGG - Intronic
1119594360 14:75920276-75920298 TTTTTTAAATTTAAGTTCTAGGG + Intronic
1119632161 14:76242534-76242556 TTATTCATCTGTAGAATCTAGGG + Intronic
1119708573 14:76804183-76804205 TTTTTCAGAGGTAAAATTTAGGG - Intronic
1119940206 14:78632608-78632630 TTTTTCAAATGATAAAACTAAGG - Intronic
1120093715 14:80364061-80364083 TTTTACAAATGAGAAAACTAGGG + Intronic
1120247385 14:82023204-82023226 GGATTCAAATGTAAAATCTTTGG - Intergenic
1120254986 14:82107173-82107195 TTTTGCAGATGTAAAAACTGAGG + Intergenic
1120310441 14:82820247-82820269 TTTTACAAATGAAGAAACTAAGG - Intergenic
1120324080 14:83003327-83003349 TTTTAAAAATCTTAAATCTATGG - Intergenic
1120514618 14:85455921-85455943 TTTTTCTACTGTAAAATCCCTGG + Intergenic
1120639705 14:86995973-86995995 TATTTCCATTGTAAAATTTAAGG - Intergenic
1121159225 14:91720299-91720321 TTTGTCAAATATAAAATTTCTGG - Intronic
1121321909 14:92996561-92996583 TTTTTTAAATTTAAGTTCTAGGG - Intronic
1121805918 14:96822648-96822670 TATAACAAATGTAAAATCTTTGG + Intronic
1121850340 14:97216431-97216453 TTTTCCAAATGTGAAACTTATGG + Intergenic
1121868715 14:97387358-97387380 TTTTTCACCTGAAAAATCTGGGG + Intergenic
1122028263 14:98893409-98893431 TTCTTCAACTGTAAAATAAACGG - Intergenic
1122556432 14:102583188-102583210 ATTTTCAAATGTACAATTCAGGG + Intergenic
1122724411 14:103740838-103740860 TTTTTCAAAAGAAAAAAATAGGG + Intronic
1202887946 14_KI270722v1_random:126316-126338 TTTTTGTAATGTAAAATGTGAGG - Intergenic
1123967013 15:25469214-25469236 TTTTTATAATGTAAAATTTGAGG + Intergenic
1124637883 15:31376494-31376516 TTTTCCAAAGCTAAAATCTGAGG + Exonic
1124985229 15:34602995-34603017 TTTTCCAAATGAATCATCTAAGG + Intergenic
1125217985 15:37299808-37299830 TTGTTCAAATTTATAATCAAAGG + Intergenic
1125448678 15:39785065-39785087 TTTTTCAAATGAAGAAACTGTGG - Intergenic
1125898451 15:43323064-43323086 CTGTTCAAATGTAAATTCAATGG + Intergenic
1125977470 15:43967599-43967621 TTTTTCAAATGTTGAAACTGAGG + Intronic
1126274762 15:46864134-46864156 TATTTAAAATCTAAAATATATGG + Intergenic
1126338676 15:47615460-47615482 TTTTTTAACTGTAAAAATTAAGG + Intronic
1126375754 15:47995333-47995355 TTTTTCCAATTTAAAATTTAGGG - Intergenic
1126531666 15:49717406-49717428 TTTTTCAAATGAAAAAAGGAAGG - Intergenic
1126587608 15:50304943-50304965 TTTTTCAAAGGAAAAATCTTAGG + Intronic
1126611017 15:50529560-50529582 TATTTCAGATCTAAGATCTAAGG - Intronic
1126750699 15:51873932-51873954 TTTTTCAAAAGCAAAAACTTGGG + Intronic
1126935564 15:53703498-53703520 ATTTTCAGATGTAACATCTGTGG - Intronic
1126981737 15:54251520-54251542 TTTTGGAAATGAAAAATTTAAGG - Intronic
1127366002 15:58291109-58291131 TTTTTCACATCTATAATCTTTGG + Intronic
1127592777 15:60443564-60443586 TTGTTAAAATGTAGAATCTGGGG + Intronic
1127594685 15:60467942-60467964 TTTTTAAAATGGAAAACGTAAGG - Intronic
1127746631 15:61983130-61983152 TTTTTTAATTATAAAATATAAGG + Intronic
1127825529 15:62699414-62699436 TGTTGCAAATGCAAAATCTCAGG - Intronic
1128158232 15:65405498-65405520 TTTTTCAAATGAGAAAACTGTGG - Intronic
1128440370 15:67701997-67702019 GTTTACAAATGTAAAAACTGAGG - Intronic
1128689189 15:69710329-69710351 TTCCTCAGATGTAAAATCAAAGG + Intergenic
1129027285 15:72589049-72589071 TTTTACAAAAGGGAAATCTATGG - Exonic
1129089076 15:73129884-73129906 TGTTTCACATGTAACATCCAGGG - Intronic
1129434742 15:75529603-75529625 TTTTTCAATTGAAAAATAAAGGG + Intronic
1129444151 15:75604661-75604683 TTTTTCAGATGGAAAATCTAAGG + Intronic
1129533121 15:76285523-76285545 TTTTTCAAATGTAAGAAGTTGGG - Intronic
1129646957 15:77444704-77444726 TGTGTCAAATGTGAATTCTATGG + Intronic
1130116058 15:81005133-81005155 TTTTTCAAATTTCAAATTCAGGG - Exonic
1130436500 15:83904783-83904805 TTTTTCATATACAAAAACTAAGG + Intronic
1130800324 15:87255880-87255902 TTTTTTAAATTTAAAATCACTGG + Intergenic
1130813831 15:87409726-87409748 TTTGTCACATGTAAGAACTAGGG + Intergenic
1130850251 15:87785620-87785642 TTTTTTAAATTTAAAAGCTTTGG + Intergenic
1130980296 15:88807665-88807687 TTTTTCAAAAGTTGAATCCAGGG + Intronic
1131699739 15:94921421-94921443 TTCCTCAAATGTAAAAGATAAGG - Intergenic
1131701952 15:94946774-94946796 TTTTTTAAATGTTAAATAAAAGG - Intergenic
1132330115 15:101006860-101006882 TTTTTCAAAATTAAAATGTGGGG + Intronic
1132377919 15:101343619-101343641 TTTTTCAATTTTCAAATGTATGG + Intronic
1133643427 16:7740038-7740060 TTTTTCACATGACAAATCTGAGG - Intergenic
1135122002 16:19774246-19774268 TTTTTCAGATGGAAAAACTGAGG - Intronic
1135537423 16:23304828-23304850 TTTTACAGATGTGAAAACTACGG - Intronic
1135843016 16:25893728-25893750 TTTTTCAAATGAAAATTGTGGGG + Intronic
1136224336 16:28848453-28848475 TTTTTCAAATGAAAACTCAGAGG + Intronic
1136649298 16:31653194-31653216 TATTTCAAAAGTAAAATTAATGG + Intergenic
1136986259 16:35108061-35108083 ATTTTCAAATGTGAAAACTCTGG + Intergenic
1137438667 16:48479900-48479922 CTGTTCCAATGTAAAATCCAGGG + Intergenic
1138062229 16:53903769-53903791 TTTTTCACAAGTGAGATCTATGG + Intronic
1138382958 16:56616573-56616595 TTTTTCCAATGGAAAAACTAAGG - Intergenic
1138744159 16:59343886-59343908 TTTTTCAAGTATAAAACCCATGG - Intergenic
1138872560 16:60909611-60909633 TTTTTCAGATGTGGAACCTAGGG - Intergenic
1138958342 16:61999223-61999245 TTTTTCATCTGTAAAATATTTGG - Intronic
1139068701 16:63352938-63352960 GTTTCCAAATGTAAAAGCTTAGG - Intergenic
1139148751 16:64354230-64354252 TTTTTCAGATTTCAAATATAAGG - Intergenic
1139699620 16:68699820-68699842 TTTTGTAAATGTAAAATCTGAGG - Exonic
1140024884 16:71277929-71277951 TTTTTCAAATGACAAATTCATGG + Intergenic
1140087137 16:71807541-71807563 TTTTTCAAACGTGAAAGTTAGGG + Intronic
1140169638 16:72590603-72590625 TTTTACAAAGGGAAAATTTAAGG - Intergenic
1140210330 16:72964469-72964491 TTTTACAACTGTGAATTCTAGGG + Intronic
1140355543 16:74302770-74302792 TTTTACAAATGAAAAGTTTAAGG + Intronic
1140547153 16:75821828-75821850 TTTTTAAAAGGTAAAATTAATGG + Intergenic
1140815854 16:78620180-78620202 TTTCTGAAATGAGAAATCTAAGG + Intronic
1141018198 16:80469809-80469831 TGTTCCAAATGCAAAATTTAAGG - Intergenic
1141029712 16:80577089-80577111 TTTTTCAAAAGAGAAATCTGAGG - Intergenic
1141069141 16:80937495-80937517 TTCTTCAAATCTAAACTCTAAGG + Intergenic
1141834696 16:86531105-86531127 TTTTTCAAATGTATATGCTTTGG - Exonic
1142606234 17:1082717-1082739 TTGTTCAAATATAGAATCTTGGG + Intronic
1142775837 17:2138253-2138275 TTTTTCAAATGTAAAGGTTAGGG + Intronic
1143001876 17:3799822-3799844 TTTTTGAAATATAAAATATTAGG + Intronic
1143043865 17:4060696-4060718 CTTTTAAAAAGTAAAATATAAGG - Intronic
1143044389 17:4065007-4065029 TTTTTTAACTTTAAATTCTAGGG - Intronic
1143375845 17:6466703-6466725 TGTATCAAATGTTAACTCTATGG - Intronic
1143709559 17:8724996-8725018 TGTTTCAAAGGTGAAAGCTAAGG + Intergenic
1143709676 17:8725668-8725690 TGTTTCAAAGGTGAAAGCTAAGG + Intergenic
1144196858 17:12902772-12902794 TTTTCCAAATGAAGAAGCTAAGG - Intronic
1144316185 17:14063712-14063734 GTTTTCAAAAGGAAAATTTAGGG - Intergenic
1145374598 17:22335853-22335875 TTCATCAAATGTAAAAACTATGG - Intergenic
1145734462 17:27217613-27217635 TATTCCAAATATAAAGTCTAGGG + Intergenic
1146495836 17:33321364-33321386 TTTTACAAATGTGAAACCTGAGG + Intronic
1146520613 17:33522702-33522724 ATTTTCAAAGTTATAATCTAGGG - Intronic
1146568470 17:33933474-33933496 TTTTTCAAATGAATAAGCTCAGG + Intronic
1147418572 17:40310729-40310751 TTTTACAAATGGAGAAACTAAGG - Intronic
1148374407 17:47129392-47129414 ATTTGCAAATGAAAAATATAAGG - Exonic
1149004509 17:51791046-51791068 TTTTACAAATGCAGAAACTAAGG - Intronic
1149228715 17:54506762-54506784 TTTTGAAAATGTTAAATATATGG - Intergenic
1149239681 17:54634665-54634687 ATTTTAAAATCTATAATCTATGG - Intergenic
1150033348 17:61765277-61765299 ATTTTTAAGTGAAAAATCTAGGG - Intronic
1150181007 17:63120945-63120967 AATTTCAAATGTAAACTCTTAGG + Intronic
1150670516 17:67192286-67192308 TTTTTCAATTGGAAAAAATATGG + Intronic
1150783703 17:68144644-68144666 TTTTTCAAATGGGGAAACTAAGG - Intergenic
1150843206 17:68628669-68628691 TTTTACAATTGAAGAATCTAAGG - Intergenic
1150846275 17:68661773-68661795 TTTTTTAAGTGCAAATTCTAGGG - Intergenic
1151516223 17:74597847-74597869 TTTTTCAAATGTATTATTTATGG - Intergenic
1151637840 17:75364439-75364461 TTTTACAGATGAAGAATCTAAGG + Intronic
1153162266 18:2220690-2220712 TTTTTCAAAAATAAAACCTGAGG - Intergenic
1153236035 18:2989127-2989149 TTCTTCATCTGTAAAATATAGGG - Intronic
1153373059 18:4342378-4342400 TTTTTAAAATGTAAGATATTTGG - Intronic
1153600193 18:6773510-6773532 TTATTCAGATGGAAAATCTGAGG + Intronic
1153757048 18:8294686-8294708 TTTTTGAAATGATAAATATAAGG + Intronic
1153865051 18:9259828-9259850 TTTTACAGATGTGAAAACTAAGG - Intronic
1153998253 18:10461026-10461048 TTTTTAAAATGTGATATCTTTGG + Intronic
1154079020 18:11235618-11235640 TTTTTCTATTGTAAGATGTAGGG - Intergenic
1154259402 18:12816789-12816811 TTTTTTAAATTTAAAAACTAGGG - Intronic
1154463035 18:14615671-14615693 TTTATCAGATGTAAAATGAAAGG - Intergenic
1154465106 18:14636368-14636390 TTTTTCAAATATTAAATCAATGG - Intergenic
1155028299 18:21962086-21962108 TGTTACAAATGCAAAATCTCAGG - Intergenic
1155030122 18:21977035-21977057 TTTTTCAACTGTTTTATCTATGG - Intergenic
1155264839 18:24081741-24081763 TTTTTTAAATGAAAAATTAATGG - Intronic
1155404578 18:25473787-25473809 TTCTTCAAATGTAATATGCAGGG - Intergenic
1155746050 18:29357379-29357401 TTTTGCTAATATAATATCTAAGG + Intergenic
1155781425 18:29841412-29841434 TCTTGCTAATGTAAAAACTATGG + Intergenic
1155813715 18:30275270-30275292 TTTTACAGATGAAAAATCTGAGG + Intergenic
1155840680 18:30638607-30638629 ATTTGCAAATGTACAATTTATGG + Intergenic
1155866287 18:30969402-30969424 TTTCTGAAATGTAATATCCAGGG + Intergenic
1155918267 18:31577395-31577417 TGTTAGAAATGTAAATTCTAGGG - Intergenic
1156148147 18:34211398-34211420 TTTTTCAAATCTAATATCAAAGG - Intronic
1156584451 18:38416189-38416211 TTTTACAAATGAAGAAACTAAGG - Intergenic
1156687938 18:39672584-39672606 TTTTTCCAATGGAAACTATATGG - Intergenic
1156929396 18:42623114-42623136 TTTTTCAATTAAAAAATTTAAGG - Intergenic
1157175908 18:45452026-45452048 TTTTTCAAATCAAAAATATGGGG + Intronic
1157902397 18:51532104-51532126 TTTTTCAGATGAAAAAACTGAGG + Intergenic
1158013538 18:52757070-52757092 TTTTCAAAAAGTTAAATCTATGG + Intronic
1158174232 18:54636118-54636140 TTTTTTAAATATAAATCCTATGG + Intergenic
1158287610 18:55901915-55901937 TTTTTCAACTGAAAAATATCAGG - Intergenic
1158574191 18:58622401-58622423 TTTTTCAGTTGTAAAATCAGGGG - Intronic
1158609832 18:58929067-58929089 TTTTTCAATTGTAAAATAAAAGG - Intronic
1159009473 18:63044921-63044943 TTTTTGAAATGAGAAAACTAAGG + Intergenic
1159056744 18:63473337-63473359 TTTTACAAATGTAAAGTGTTTGG + Intergenic
1159159362 18:64623505-64623527 TCTTTCAAATGGAGAATTTAAGG - Intergenic
1159265784 18:66076589-66076611 TTTTGCAAATGAAGAAACTAAGG - Intergenic
1159329827 18:66977784-66977806 CTTTTCAAATGGAAAAACTTTGG - Intergenic
1159658670 18:71064872-71064894 TTTCTCTAATGTACAATGTAGGG + Intergenic
1159672438 18:71238368-71238390 TTTTCAAAATGTAACTTCTATGG - Intergenic
1159678402 18:71315646-71315668 TTTTACAATTCTAAGATCTATGG - Intergenic
1159899401 18:74030716-74030738 TTTTTAAAATATCAAATTTATGG + Intergenic
1159973683 18:74684201-74684223 TTTTTCAAAAGGAAAAAGTAAGG + Intronic
1160195121 18:76747523-76747545 TTGATAAAATGTAAAATCTTTGG + Intergenic
1160276179 18:77438758-77438780 ATTTTCAAATGTAAGAAATACGG - Intergenic
1160301179 18:77680568-77680590 TTTTTTAAATTTAAGTTCTAGGG - Intergenic
1160363159 18:78301617-78301639 TTTTTTACATTTTAAATCTAAGG + Intergenic
1160574886 18:79847662-79847684 TTTTTCAAATGTAATCAATAAGG - Intergenic
1163244631 19:16085683-16085705 TTTTACAAATGAAGAAACTAAGG - Intronic
1163512994 19:17747343-17747365 TTTTACAAATGGGAAATCTGAGG - Intergenic
1163803488 19:19382442-19382464 TTTTTTTAATGTAAAAACTTAGG + Intergenic
1163877996 19:19891758-19891780 CTTTTCAAATGTATAATATGTGG + Exonic
1164166892 19:22687339-22687361 TATTTCTAATGTAAATTCTCTGG - Intergenic
1164186446 19:22873051-22873073 TATTTCAAAAGTAAAATTAATGG + Intergenic
1164223214 19:23215851-23215873 TATTTCAAAAGTAAAATTAATGG - Intergenic
1164387450 19:27786479-27786501 TTTTTTTATTTTAAAATCTATGG - Intergenic
1164419159 19:28072626-28072648 TTTTGCAAATGTAAATGCCATGG - Intergenic
1166028901 19:40110572-40110594 TTGATAAAATGTAAAATCTTTGG + Intergenic
1166643622 19:44514834-44514856 TTTTTAAATTTTAAAATTTAAGG + Intronic
1166842606 19:45707530-45707552 TTTTACAAATGAAAAATGCAAGG - Intergenic
1166914653 19:46186770-46186792 TTTTTCAATTGTACACTTTAGGG - Intergenic
1167228742 19:48268003-48268025 GTGTTCAAAAGTAAAATGTATGG - Intronic
1167923714 19:52806056-52806078 TTTTTCATATTTAAAATAAAAGG + Intronic
1168199880 19:54806685-54806707 ATTTTTAAGTGTAAAATCTAGGG + Intronic
1168517347 19:57018616-57018638 TTTTACAGATGAGAAATCTACGG + Intergenic
1202663350 1_KI270708v1_random:93152-93174 TTTTTGTAATGTAAAATGTGAGG - Intergenic
925094997 2:1191157-1191179 TTTTACAAATGTAAAAGTCATGG - Intronic
925496687 2:4458194-4458216 TTTTTCCCATGTAAAACATATGG - Intergenic
925905603 2:8538064-8538086 TTTTTAAGATGTAAAATTTTCGG - Intergenic
926365118 2:12125942-12125964 TTTTAAAAATGTAAACTCTCAGG - Intergenic
926538132 2:14139816-14139838 TCTATAAAATGTAAAATCTTAGG - Intergenic
926847472 2:17158317-17158339 TCTTTCAAATTTAAAATCTCTGG + Intergenic
926897976 2:17715660-17715682 TCTTCCAACTGTAAAATCTGTGG - Intronic
927014445 2:18943399-18943421 ATTTACTCATGTAAAATCTATGG - Intergenic
927313831 2:21659131-21659153 ATTGTGAAATGTAAATTCTAAGG - Intergenic
927335555 2:21919486-21919508 TTATTCAAATGTATAGTCAATGG + Intergenic
927427426 2:22996436-22996458 TATTTGAAATGTAAATTCTCAGG - Intergenic
927586142 2:24307112-24307134 CTTTTTAAATGCAAAATGTAGGG + Intronic
928235103 2:29532397-29532419 TTTTGCAGATGAAAAATCGAAGG - Intronic
929071877 2:38039220-38039242 TTTTACAAATGAGAAAACTATGG + Intronic
929097637 2:38279121-38279143 TTTTTAAAATGGAAAATTTGTGG - Intergenic
929193306 2:39160141-39160163 TTTTACAAATGAGAAATCTCAGG - Intergenic
929238887 2:39633377-39633399 TATTTCACATGTAAAGTATATGG + Intergenic
929282567 2:40097464-40097486 TTTTTCATGTGTAAAATTGATGG - Intronic
929465600 2:42141113-42141135 GTTTTAACATGTAGAATCTATGG + Intergenic
929970711 2:46572821-46572843 GTTCTCAAATTTAAAATATATGG + Intronic
930234101 2:48872616-48872638 TTTGTCAAAAGTAAGATTTAAGG - Intergenic
930310910 2:49738313-49738335 TTTTTCAAATGAGAAAACAAAGG + Intergenic
930345692 2:50178017-50178039 TTTCTCATATGTAAAATTTGAGG + Intronic
930346016 2:50181976-50181998 TTTTTCAACTTAAAAAACTAAGG + Intronic
930417898 2:51112772-51112794 TTTTTCAGTTGTAGTATCTAAGG - Intergenic
930797735 2:55410370-55410392 AGTTTCAAATTTAAAATCTGTGG - Intronic
930880710 2:56267041-56267063 TTTTTCTAATATACAATGTAGGG + Intronic
930924872 2:56804935-56804957 TTTTCCAAATTTAAATTCAATGG + Intergenic
931163120 2:59716170-59716192 TTTTGTAAATGTAAAAACGAAGG - Intergenic
931206769 2:60154511-60154533 TTTTACAGCTGTAAAAACTAAGG - Intergenic
931523254 2:63123453-63123475 TTTTTAAAATGTAATTCCTAAGG - Intronic
931593832 2:63917876-63917898 TTTTACAAATTTAGAAACTAAGG - Intronic
931947721 2:67329628-67329650 TTCTTGAAATGTGAATTCTAAGG + Intergenic
932194566 2:69772176-69772198 TTTTACAGATGTAAAAACTGAGG + Intronic
932407732 2:71524984-71525006 TTTTTGAAATGCAGAATCTTGGG + Intronic
932516705 2:72358561-72358583 TTTTACAAATGAAAAAAATAAGG + Intronic
932999308 2:76902093-76902115 TTTTTAAAATGTGAATTTTATGG + Intronic
933010846 2:77061299-77061321 TATTTCAAATTTTAAGTCTAGGG + Intronic
933031037 2:77328984-77329006 TTTCTCATCTGTAAAATATAAGG + Intronic
933046731 2:77547490-77547512 CTTTTAAAATTTAAAATATAAGG - Intronic
933097763 2:78209262-78209284 TTTTAAAAATTTTAAATCTAGGG - Intergenic
933125140 2:78595250-78595272 ATTTTCAAATCTAAAAACTGAGG + Intergenic
933521059 2:83374480-83374502 TTTTACAGATATAAAATCCAAGG + Intergenic
933889353 2:86752628-86752650 TTCTACAGATGAAAAATCTAAGG + Intronic
934079631 2:88456668-88456690 TTTTTAAAAAGTAAATTATAAGG - Intergenic
934630835 2:95919586-95919608 TATTACAAATGAAAAATCTCAGG + Intronic
934784586 2:96995894-96995916 TTTTTCAAATGAAGAAACTGAGG + Intronic
935080129 2:99784620-99784642 TTTCTCAACTTTAAAATCTTAGG + Intronic
935579041 2:104740075-104740097 TTTTTCAAATGTTCAAATTATGG - Intergenic
935591243 2:104847123-104847145 TTTTTCAAATTTAAATTCACAGG - Intergenic
935608222 2:104992139-104992161 TTTTTCAAATTGAAAGTCTGTGG + Intergenic
935811042 2:106797411-106797433 TTTGTCAAATGCAAAATCAATGG + Intergenic
936381867 2:111993528-111993550 CTTTTCAAATGGAAATTATAGGG - Intronic
936719774 2:115237141-115237163 TTTTCCAAATGAAAAATTTTTGG + Intronic
936951851 2:117985489-117985511 TTTTTTTAAAGTAAAAACTAAGG + Intronic
937064535 2:119007337-119007359 TTTCACAAATGTAAAAACTGAGG + Intergenic
937139110 2:119583479-119583501 TTTTTTACATAGAAAATCTAAGG + Intronic
937171860 2:119880167-119880189 TCTTACAAATGTAGAAACTAAGG + Intronic
937476771 2:122222116-122222138 TTTTACAGATGTAGAATCCAAGG - Intergenic
937494084 2:122399806-122399828 TTTTTCAAATAAAAAAACTGAGG - Intergenic
937592988 2:123637323-123637345 TGTATCAAATATAAAATGTAAGG + Intergenic
937644745 2:124254055-124254077 TTTTACAGATGTGAACTCTAAGG - Intronic
937776207 2:125778888-125778910 TTTTATAAATATAAAATCTGAGG - Intergenic
938598424 2:132812368-132812390 TTTTTCAAATGAGAAAACTGAGG + Intronic
938634986 2:133213976-133213998 TTTGGCTATTGTAAAATCTATGG - Intronic
938697824 2:133850404-133850426 TTTATCAAAGTTAAACTCTAGGG - Intergenic
938771150 2:134502100-134502122 TTTTTCAAAAGTAAAATTAAAGG + Intronic
938855946 2:135310681-135310703 TTTTTCATATGAAAAACCAAAGG + Intronic
939122433 2:138133862-138133884 TTTCTCTAATGTAAAATACAGGG - Intergenic
939277838 2:140023992-140024014 AATTTTAAAAGTAAAATCTAAGG - Intergenic
939281659 2:140073394-140073416 TTTTTAAAAGGTCAAATATATGG - Intergenic
939546442 2:143560404-143560426 TTTTACAGATGTAAAAACTGAGG + Intronic
939637937 2:144605949-144605971 TATTTTAAATTTAATATCTAAGG + Intergenic
940075326 2:149735179-149735201 TGTTTCAAGTGGAAAGTCTATGG + Intergenic
940176551 2:150883829-150883851 TTTTTAAATAGTAATATCTATGG - Intergenic
940182532 2:150951802-150951824 TTTTTAAATTGAAAAATATATGG - Intergenic
940192238 2:151054200-151054222 TTTTACAAATGCAAAAACTGAGG + Intergenic
940588819 2:155693066-155693088 TTTTTGAGATGGAAAATCCATGG - Intergenic
940595391 2:155785264-155785286 TTTTTCAAGTTTAAAACATAAGG + Intergenic
940834336 2:158504031-158504053 TTTGTGAACTATAAAATCTATGG - Intronic
940895286 2:159075751-159075773 TTTTTTAAATGAAAAAAATATGG - Intronic
941189758 2:162366602-162366624 TGTTTCAAATGTAAAGTATTAGG - Intronic
941414153 2:165198052-165198074 TTTTTAAAGTTTAAAATTTAGGG - Intronic
941447613 2:165622077-165622099 TTTTTTTAATGTGAAATATATGG - Intronic
941543771 2:166819394-166819416 TTTTATAGATGTAAAAACTAAGG - Intergenic
941830522 2:169953731-169953753 TTTTTAAAAAGTACACTCTATGG + Intronic
941862774 2:170301316-170301338 ATATTCAAATGTCAAATTTAGGG + Intronic
941929649 2:170927230-170927252 TTTTTTAAGTGGAAAATGTAAGG + Intergenic
942131755 2:172886881-172886903 TTTTTCAAATTAAATAGCTAGGG - Intronic
942437621 2:175998090-175998112 TTTTACAAATGAGAAATCTAAGG + Intronic
942455078 2:176132153-176132175 TTTTCTAAATGTAATATCTCGGG + Intronic
942472541 2:176276042-176276064 TTTTACAAATGAGAAATCTCAGG - Intronic
942666634 2:178326287-178326309 TTTTCCAAATGAAAAAACTTGGG + Intronic
942874567 2:180779021-180779043 TTTTACAAATATGAAAACTAAGG - Intergenic
942988610 2:182172424-182172446 TGTTACAAATGTAAAAACTATGG - Intronic
943225938 2:185176031-185176053 TTTTTCAAATGAAATATAAATGG - Intergenic
943554819 2:189389577-189389599 TTATTCCAATCTAAAATTTATGG - Intergenic
943611273 2:190037890-190037912 TTTTTACAATGAAAAATTTAGGG + Intronic
944061936 2:195578913-195578935 TTTTTTAAATATATAATTTATGG - Intronic
944206239 2:197161464-197161486 TTTTTCAAGTGTGGATTCTAGGG - Intronic
944335411 2:198527885-198527907 TTTTACAAATGAGAAAACTAAGG - Intronic
944749296 2:202691486-202691508 TTTTTTTAATTAAAAATCTAAGG - Intronic
945102315 2:206273616-206273638 TTTTTGGTATGTTAAATCTAAGG + Intergenic
945222887 2:207502730-207502752 TTTTTCAGATGAAGAAACTAAGG + Intergenic
945393121 2:209288612-209288634 TTTTGCTATTGTACAATCTATGG - Intergenic
945414160 2:209550130-209550152 TGTTTCTAATGTAAAATGCAAGG - Intronic
945435495 2:209812437-209812459 TTTTTTAATTAAAAAATCTACGG - Intronic
945473176 2:210250931-210250953 TTTTACAAATGTCAAAGCCAAGG + Intergenic
945583908 2:211632992-211633014 TGTTTCAAACGTAAATTCTGTGG - Intronic
945681243 2:212916759-212916781 TTTTTCTATTGTAAAATTTGGGG + Intergenic
945863324 2:215148630-215148652 TTTTACAGTTGTAAAATCAAAGG - Intergenic
945968514 2:216213517-216213539 TTGATAAAATGTAAAATCTTTGG + Intergenic
946047118 2:216830439-216830461 TTTTTCAAAAGTGAATTCTCAGG - Intergenic
946273451 2:218612964-218612986 TTTTTCATCTGTAAAATATAGGG + Intronic
946761930 2:223003188-223003210 TTATTTAACTGTAAAATCTGAGG + Intergenic
946891219 2:224279180-224279202 TTTATCACATGTAAAATAAAGGG - Intergenic
947255066 2:228154356-228154378 TTCTTCAAATATAAAAACTAAGG - Intronic
947558728 2:231125653-231125675 TTTCTCCAACGTAAAGTCTATGG - Intronic
1168890177 20:1290230-1290252 TTTTTAAAATGTACAATTCAGGG + Intronic
1168890233 20:1290930-1290952 TTTTTCAGGTTAAAAATCTATGG - Intronic
1169019649 20:2319899-2319921 TTCTTCATATGTGAAATATAAGG + Intronic
1169548491 20:6676073-6676095 ATTTTCAAAGGTAAACTTTAAGG - Intergenic
1169700673 20:8443339-8443361 TTTCTCAAATGTAAAATTATTGG + Intronic
1169831744 20:9833029-9833051 CTTTTTAAATATAAAATCAATGG - Intronic
1170008136 20:11691156-11691178 TTTTTCAAATGTGGAATTAAGGG - Intergenic
1170054896 20:12191335-12191357 TTTTTTAAATTTAAGTTCTAGGG + Intergenic
1170137841 20:13094718-13094740 TTGTTCAAATGAAAAATCTATGG + Intronic
1170235401 20:14098147-14098169 TTTTTCAAATATTAAAACTAAGG - Intronic
1170288520 20:14740246-14740268 TTTTACAGATGGAAAATCTGAGG + Intronic
1170675464 20:18476120-18476142 CTTTTAAAGTGTAAAATCTTTGG + Intronic
1170824983 20:19785985-19786007 TTTTTCACATGTATAAACCAAGG - Intergenic
1170913637 20:20600800-20600822 TGTTTTAAAAGTAAAATGTAGGG + Intronic
1170974343 20:21148330-21148352 TTTTTTAAATATAAAAACTCTGG + Intronic
1171528206 20:25832560-25832582 TTCGTCAAATGTAAAAACTATGG + Intronic
1171548620 20:26023318-26023340 TTCGTCAAATGTAAAAACTATGG - Intergenic
1171754952 20:29097776-29097798 TTTTTAAAATGTAAGGGCTAAGG - Intergenic
1171787699 20:29484781-29484803 TTTTTAAAATGTAAGGGCTAAGG + Intergenic
1171860255 20:30394599-30394621 TTTTTAAAATGTAAGGGCTAAGG - Intronic
1172491585 20:35343234-35343256 TTTTTCAGCTTGAAAATCTATGG - Intronic
1172924274 20:38517017-38517039 TTTCACATATGTTAAATCTAGGG + Intronic
1174582815 20:51584529-51584551 TTTTACAGATGAAAAATCTCAGG + Intergenic
1174705739 20:52654274-52654296 TTTTTCAAAACTAAAACCTGTGG + Intergenic
1174783342 20:53410640-53410662 TTATGAAAATGTAAAATCCATGG + Intronic
1174833188 20:53832690-53832712 TTTTACAGATGGAAAAACTAAGG - Intergenic
1174947741 20:55007063-55007085 TTTTTAAAATGCAAATTCTAGGG - Intergenic
1174987764 20:55474627-55474649 TTTTCCAGATTTAAAATCTATGG + Intergenic
1175704384 20:61165368-61165390 TTTTTCAAAGGTGGAATCTAAGG - Intergenic
1176670063 21:9725196-9725218 ATTTTCAAAAGTAGAATTTATGG + Intergenic
1176809434 21:13522018-13522040 TTTTTCAAATATTAAATCAATGG + Intergenic
1176811489 21:13542700-13542722 TTTATCATATGTAAAATGAAAGG + Intergenic
1177160367 21:17540866-17540888 TATTTCAAATATAAAATTGACGG - Intronic
1177176323 21:17704209-17704231 TATTTAAAATGTATAATCCAGGG + Intergenic
1177251742 21:18600364-18600386 TTTTTTAAATGGTAAATTTATGG + Intergenic
1177439835 21:21108142-21108164 TTTTTCAGATGTAAAGACTTTGG - Intronic
1177687942 21:24464800-24464822 TTAATCAAATATAAAATCTGAGG + Intergenic
1177932175 21:27298645-27298667 TTTTCCCAATGGAAAAACTATGG - Intergenic
1177936652 21:27355926-27355948 TTATTGAAATGAAAAAACTATGG - Intergenic
1178849244 21:36199448-36199470 TTTTTTAAATTTAAGTTCTAGGG + Intronic
1178851677 21:36217425-36217447 TTTTACAAATGGAAAGACTAAGG + Intronic
1179189442 21:39110235-39110257 TCTTTAAAATGTAGAAACTAGGG + Intergenic
1179242639 21:39605479-39605501 TTTTTCAAATGAAACGTGTATGG - Intronic
1180029484 21:45195448-45195470 CTTTTCAGATGTAACATCAAAGG - Intronic
1180261593 21:46673732-46673754 TTTTACATATTTAAAATATAGGG - Intergenic
1180296651 22:10944009-10944031 TTTTTAAAATGTAAGGGCTAAGG + Intergenic
1180330090 22:11470040-11470062 TTTTTGTAATGTAAAATGTGAGG - Intergenic
1180412005 22:12621884-12621906 TTTTTAAAATGTAAGGGCTAAGG - Intergenic
1180669770 22:17543921-17543943 TTTTACAGATGAAAAATCCAAGG + Intronic
1180725315 22:17942519-17942541 ATGATCATATGTAAAATCTAAGG + Intronic
1181120600 22:20665930-20665952 ATTTTCAAATATTAAATCAATGG + Intergenic
1181685762 22:24527038-24527060 TTTTACAGATGTAAAAACCAAGG - Intronic
1181869771 22:25888560-25888582 TTGTTAAAATGCAAATTCTAGGG - Intronic
1181908237 22:26216854-26216876 GTTTGCATATGGAAAATCTAAGG + Intronic
1182027163 22:27129174-27129196 TTTTTCAGATGAGAAAACTAAGG - Intergenic
1182179121 22:28326244-28326266 TTTTTCAAATGTCATATAAATGG - Intronic
1183016180 22:34989532-34989554 TTTTTCAAATGGGGAAGCTAAGG - Intergenic
1183215575 22:36477512-36477534 TTTTTCAGATGAAGAAACTAGGG - Intronic
1183830208 22:40414822-40414844 TTTTTTAAATGTACAATCAGAGG - Intronic
1184014356 22:41774688-41774710 TTTTTCAAATGAGAAAACTGGGG - Intronic
1184847118 22:47095456-47095478 TTTTTAAAATGTAGGAACTAAGG - Intronic
949107029 3:211702-211724 TTTTTGAAATATGAAAACTACGG - Intronic
949331505 3:2928575-2928597 CTTTTCAGATGTAGAATCTTAGG + Intronic
949468869 3:4372672-4372694 TGTTACAAATGTAAAAACTGAGG + Intronic
949557648 3:5171057-5171079 TTTTTCAAAAATCAAATCTATGG + Intronic
949591601 3:5500138-5500160 TTTTTTAAATATAAAAGCTCTGG - Intergenic
949729475 3:7091945-7091967 TTTTTCAAATGAGAAAATTAAGG - Intronic
949953146 3:9246097-9246119 TTTTTCTATTGTAAAATAGAAGG - Intronic
950176449 3:10878097-10878119 TTTTTGAAATGTAAATCCAATGG + Intronic
950587050 3:13900482-13900504 CTTTTAAAAAGTAAAATCCAGGG - Intergenic
950834602 3:15907100-15907122 ATTTTCAAAGGTAAAATCATAGG - Intergenic
951057609 3:18165659-18165681 ATTTTCAAATGTAAATACTAGGG - Intronic
951114960 3:18849435-18849457 TTCTTCAAGTATAAAATATATGG + Intergenic
951220015 3:20058904-20058926 TTTTAGAAATGTAGAATCTCAGG + Intronic
951646617 3:24899061-24899083 TTTTAGAAATGTAAATTCTCAGG + Intergenic
951873169 3:27389623-27389645 ATTTTCAAATGTAAAAGCAAAGG - Intronic
951952112 3:28211321-28211343 ATTTTCAAATGCATAATCTGAGG - Intergenic
951961388 3:28326082-28326104 TTTTTAAAAAGTAAATTTTAGGG + Intronic
952386862 3:32848177-32848199 TTTAACAAATTAAAAATCTAAGG - Intronic
952520680 3:34153670-34153692 TTTTTTATATGAAAAGTCTAGGG + Intergenic
952577382 3:34791461-34791483 TTTTTCTTATGTAGAATTTATGG + Intergenic
952686546 3:36156016-36156038 TTATTCATATGTTAAATCTTTGG - Intergenic
952691645 3:36213343-36213365 TTTTACAGATGTGAAAACTATGG - Intergenic
953206106 3:40830921-40830943 ATTTTCAAATATAAATTCTCAGG + Intergenic
953486340 3:43300617-43300639 ATTTTCAAATATAAAAACTCTGG - Intronic
953508403 3:43509347-43509369 TTTTTTAAATTTAAGTTCTAGGG - Intronic
954353186 3:50062585-50062607 TTTTACAAATGGGAAAACTATGG + Intronic
955039444 3:55300987-55301009 TTTTACAGATGGAAAATCAATGG - Intergenic
955459630 3:59167513-59167535 TTTCTCTAGTGTAAAATCTTTGG - Intergenic
955474741 3:59325305-59325327 TTTTACAAATGGAAAAACTAAGG - Intergenic
955632105 3:60985706-60985728 TATTTGAAATGCAAAATCTCAGG - Intronic
955758317 3:62249831-62249853 TCTTTTAAATGTAAGCTCTAGGG + Intronic
955813189 3:62813434-62813456 TTTTATATATGTAAAATGTAGGG - Intronic
955900754 3:63751510-63751532 TTTCTCATTTGTAAAATCAAGGG + Intergenic
955979954 3:64514742-64514764 TTTTACACATGAAAAAACTAAGG + Intergenic
956251938 3:67243563-67243585 TTTTTCAAATGAAAAGCCTGAGG + Intergenic
956422764 3:69101647-69101669 TTTCTCAAATGAAGAAGCTAAGG - Intronic
956496687 3:69834390-69834412 TCACTCAAATGTGAAATCTAAGG - Intronic
956518974 3:70082880-70082902 TTTCTCAGATGTAGAAACTAAGG + Intergenic
956891470 3:73618185-73618207 TTTTTCATCTGTAAAATGGAAGG + Intronic
956917322 3:73885759-73885781 TTTTTCAACTGGCAAATTTAGGG + Intergenic
957092477 3:75745231-75745253 TTTTTGTAATGTAAAATGTCAGG + Intronic
957294728 3:78322482-78322504 TTTTTCAGATGTAACAAATAGGG + Intergenic
957391549 3:79579305-79579327 CTTCACAAATGTCAAATCTAAGG - Intronic
957800481 3:85072980-85073002 TTTTTTAAATGTTTAACCTAGGG - Intronic
958047993 3:88308234-88308256 TTTTTCAAATGCCAAAAATATGG - Intergenic
958132333 3:89443857-89443879 TTGGTCAAATGTAAACTCTTTGG - Intronic
958426636 3:93986210-93986232 TTTTTCATCTCTAAAATATAAGG - Intronic
958668339 3:97169740-97169762 TTATTCAAATGAAAAAACTAAGG - Intronic
958726587 3:97913056-97913078 TTTTTCAAGTGAAAAATAGAAGG - Intronic
958998038 3:100928253-100928275 TTTTTTAAATATTAAATCTCTGG - Intronic
959211794 3:103393456-103393478 GTTTTCAAATATAAAATTTTAGG - Intergenic
959231509 3:103659383-103659405 TTTTTCAAATAGAAAAGATATGG - Intergenic
959331088 3:105006141-105006163 TTTTTGAAATGTAATTTCAAAGG - Intergenic
959427651 3:106212150-106212172 TTTTTCAGATGAAAAAACTTAGG + Intergenic
959461110 3:106627015-106627037 AATTTCAAAGGTAAAATCAAGGG + Intergenic
959744337 3:109759182-109759204 TTTTTCAAATGTTAAAGCATAGG + Intergenic
959864344 3:111249122-111249144 TTTTTAAATTGTTGAATCTAGGG - Intronic
959895744 3:111604019-111604041 TTTTACAAATGCAGAATCTCAGG - Intronic
959967384 3:112372443-112372465 TTCTTCATCTGTAAAATATAGGG - Intergenic
960025420 3:113003441-113003463 TTTTTTAAATGTTAAATATTTGG + Exonic
960124878 3:113987711-113987733 TTTTAAAAATGTAAACACTAGGG + Intronic
960329440 3:116340183-116340205 TTTCTAAAATGTAAAATAGAGGG + Intronic
960574905 3:119219804-119219826 TTGTTCAAATGTTATATTTAAGG - Intronic
960765011 3:121117145-121117167 TTTTTAAAATGTATATTATAAGG + Intronic
960826270 3:121788146-121788168 TTTTACAAAAGAAAAAACTAAGG + Intronic
961019656 3:123494710-123494732 TTTTTCTAAAATAAAATCTCAGG + Exonic
961102380 3:124211252-124211274 TTTTGCAGATGGAAAAACTAAGG + Intronic
962041955 3:131716779-131716801 TTTTTCAAATGAAGAAACTGAGG + Intronic
962092462 3:132259147-132259169 TTTTTCAAATGTATTAGCAAAGG + Intronic
962125893 3:132617370-132617392 TTTTTAAAAAGTAAAATGAAAGG - Intronic
962426613 3:135274360-135274382 TTTCACAAATGTAAAAACTGAGG + Intergenic
962506346 3:136050264-136050286 TTTTTTACATGTATAATATATGG - Intronic
963309296 3:143691096-143691118 TGTTATAAATGTAAAATCTCAGG - Intronic
963886070 3:150584354-150584376 TTTTATAAATGAAAAAACTAAGG + Intronic
963886436 3:150588015-150588037 TTTTCCAAAAGTAAATTATAAGG + Intronic
964372966 3:156020197-156020219 TGTTAGAAATGTAAAATCTCAGG + Intergenic
964464462 3:156975285-156975307 TTTTTTTAATGTAAAATAGAAGG - Intronic
964785937 3:160396582-160396604 TTTTTCTAATGTAAAAAGTGAGG + Intronic
965033102 3:163399143-163399165 TTTTTCAAATGAATAACCTTTGG + Intergenic
965087248 3:164114317-164114339 TTTAACAAATCTAAAATATATGG + Intergenic
965356682 3:167683310-167683332 TTTTTCAATTATAAAATAAAGGG - Exonic
965636013 3:170781657-170781679 TTTTTCAAATGAAGAAGCGAAGG + Intronic
965921188 3:173916057-173916079 TTTCACAAATGTAAAAACTGAGG - Intronic
965946802 3:174252595-174252617 TTTTTCAAATGAGAAAACTGAGG - Intronic
965994117 3:174858004-174858026 TTTTTCAAATTAAAAAGCAATGG + Intronic
966081126 3:176002628-176002650 TTTTTCAAACAGAAAACCTAGGG + Intergenic
966087216 3:176082811-176082833 TTTTCAAGATGTAAAAGCTAAGG - Intergenic
966405079 3:179588544-179588566 TTATTCAAATTCAAAAACTACGG + Exonic
966708046 3:182938773-182938795 TATCTCAAAAGTAAAATCTCTGG + Exonic
967523470 3:190464097-190464119 TCTTTCATAAGTAAAATCTCTGG + Intergenic
967541792 3:190677032-190677054 TGTTTCAAATATAATATCTTTGG + Intergenic
967543977 3:190701902-190701924 TTCTTCAAATTTCAAGTCTATGG + Intergenic
967566086 3:190974469-190974491 ATTTTTAAATATAATATCTATGG - Intergenic
967578827 3:191127430-191127452 TTTTTGAAATGCAATATCTGTGG - Intergenic
968129748 3:196185938-196185960 TTTTAAAAATGTAAAAATTATGG + Intergenic
969175688 4:5397224-5397246 TTATGCATTTGTAAAATCTATGG + Intronic
969249674 4:5958747-5958769 GTTTTTAAATGTAAAATATATGG + Exonic
969966194 4:10998897-10998919 TTTTGCAAATGCAAATTTTAAGG + Intergenic
970717133 4:18939544-18939566 TTCTTCAAATGTAGAAACTGAGG - Intergenic
970731481 4:19108739-19108761 TTTTTAAAATGTAACATTCAAGG - Intergenic
970893025 4:21069013-21069035 TTTTTTAGATGTACAATCTCAGG - Intronic
971091519 4:23351411-23351433 TTTTACAAATGGGAAAACTAAGG + Intergenic
971242849 4:24904098-24904120 TTTTTGAAAAGTAAAAATTAAGG - Intronic
971461226 4:26899959-26899981 TTTTACAAATGCAAAATGTGAGG - Intronic
971612146 4:28739271-28739293 TTTTTTAAATGTAAAACTTAAGG + Intergenic
971785124 4:31092043-31092065 TTCTCAAAATGTAAAATATATGG - Intronic
972019733 4:34296621-34296643 ATTTTCAAATATAAATTCTTAGG - Intergenic
972194713 4:36639552-36639574 TTTTTTCAATGTAACATTTAGGG + Intergenic
972649163 4:40999648-40999670 TTTTTAAAATGCAGAATCTCAGG + Intronic
972703983 4:41522874-41522896 TTTTTAAAAGGTTAAATTTATGG + Intronic
972743542 4:41911122-41911144 TTTTACAAATGGACAAACTAAGG - Intergenic
972764408 4:42138851-42138873 TTTTTCACATTTAGTATCTATGG + Intronic
972823138 4:42725219-42725241 TTATTCAGATGAAAAATCTGAGG + Intergenic
972867069 4:43245826-43245848 TTTTTCAAATGTTAATTTTTGGG + Intergenic
972981892 4:44714274-44714296 ATTTTTAAAAATAAAATCTAGGG - Intronic
972986904 4:44775809-44775831 TTATTCCAATGTTAAATTTATGG - Intergenic
973053471 4:45624743-45624765 TAATTAAAAAGTAAAATCTATGG - Intergenic
973053636 4:45627354-45627376 TATTTCAAATGTAAAATGTATGG - Intergenic
973315939 4:48760041-48760063 TTTTATATATGTAGAATCTAAGG + Intronic
973794311 4:54408319-54408341 TTTTTCACATGTAAATTGTCTGG - Intergenic
974538353 4:63198457-63198479 AATTACAAATGAAAAATCTATGG - Intergenic
974600177 4:64069150-64069172 TTTTACAGTTGTAAAAGCTAAGG - Intergenic
974770806 4:66409822-66409844 TTTTCCTGATGTAAAATTTAAGG + Intergenic
974927566 4:68319272-68319294 TTTTTAAAATGTAAACTTAAGGG + Intronic
975056421 4:69937315-69937337 TATTTTAAATTTAAATTCTATGG + Intronic
975164107 4:71158227-71158249 TTTATCATATTTAATATCTATGG - Intergenic
975362771 4:73490641-73490663 GTTTTATAATGTGAAATCTAAGG + Intronic
975383862 4:73732502-73732524 TTTTACAAATGAAAAACCTGAGG + Intergenic
975428705 4:74261443-74261465 CTTTTCAAATATATAATCAAAGG + Intronic
975444718 4:74449326-74449348 TTTTTCCAATGTATAAACCAAGG + Intronic
975494142 4:75019641-75019663 TTTTTCAAATCTAAGGTTTATGG - Intronic
976187448 4:82456643-82456665 TATTTCAGATGTAAAATGAACGG + Intronic
976541628 4:86284209-86284231 TTTTACAAATAAAAAAACTAAGG + Intronic
976544055 4:86313182-86313204 TTTTTCAAATGCAGATTCAATGG - Intronic
976693888 4:87897843-87897865 TTTTTCAGATGAGAAAACTAAGG - Intergenic
976822486 4:89222169-89222191 TTTTTTAAATGAAAGAGCTAGGG + Intergenic
976861046 4:89666837-89666859 TTTTTCAAAAATAAAATGTGGGG + Intergenic
976894261 4:90089362-90089384 TTTTTAAAATTTAAAAAGTAAGG + Intergenic
976980681 4:91222901-91222923 TTTTTCATAGGTACACTCTAAGG - Intronic
977123901 4:93139716-93139738 TGTTTCAAAAGTACAGTCTAGGG - Intronic
977230123 4:94441676-94441698 TTTTCCAAATGGAAACTCTTAGG - Intergenic
977297125 4:95223175-95223197 TTTTTGAAATGAAAAACCTATGG + Intronic
978161061 4:105548923-105548945 TTCTTCATTTGTAAAATATAAGG - Intergenic
978193908 4:105948427-105948449 TTTTTCATCTGTAAAATTGAGGG + Intronic
978277573 4:106970135-106970157 TTTTATAAATGTAAAAACTCAGG - Intronic
978547414 4:109886444-109886466 TTTGTAAAATGGAACATCTAGGG + Intergenic
978647705 4:110958522-110958544 TTTTTCATATGTACTATTTAAGG - Intergenic
978790215 4:112655335-112655357 TTTTTAAAATGAAAAATAAAAGG - Intronic
978930067 4:114299173-114299195 TTTTTCAAAAGTCAAATCATGGG + Intergenic
978936799 4:114387711-114387733 TTTTATAAATGAAGAATCTAAGG + Intergenic
979004276 4:115270266-115270288 ATTTTTAAATGCAAAATTTATGG + Intergenic
979101625 4:116623924-116623946 ATTTTCTAATGTAAATTTTATGG - Intergenic
979114428 4:116804253-116804275 TTTATAAACTGTAAAATGTAAGG + Intergenic
979383282 4:120033935-120033957 ATTTTCTAATGTAAAAATTATGG + Intergenic
979743821 4:124183880-124183902 TTTTTCAATGATATAATCTAAGG - Intergenic
979840028 4:125426714-125426736 TTTATCAAATTTCAATTCTATGG - Intronic
980145993 4:128984965-128984987 TATTTAAAAAGTAAAATATATGG - Intronic
980220436 4:129906542-129906564 TTTTTCAAATGAAAAACTAAAGG - Intergenic
980490359 4:133517256-133517278 CTTCTTAAATGGAAAATCTAAGG - Intergenic
981357833 4:143811638-143811660 TTATTCAAATGTAAAAAGAATGG + Intergenic
981926511 4:150146284-150146306 TTTTAGAAATGCAAAATCTCAGG + Intronic
981933626 4:150216134-150216156 TTCTTCAAATTTGAAATTTAAGG - Intronic
982317255 4:154044270-154044292 TTCTTCAAATGTAAAGTCCTGGG + Intergenic
982366848 4:154588350-154588372 ATTTTTAAATTTAAAATATAGGG - Intronic
982675946 4:158375957-158375979 ACTTTAAAATGTGAAATCTAGGG - Intronic
982769620 4:159385009-159385031 TGTTTAATATGTAAAGTCTAGGG - Intergenic
982856896 4:160394790-160394812 TTTTTTAAAGGTAAAATGCAAGG + Intergenic
982958155 4:161798109-161798131 TATTTCAGATGAAAAATTTATGG + Intronic
982986050 4:162207736-162207758 TTTTGGAAACTTAAAATCTATGG + Intergenic
983024799 4:162722187-162722209 TTTTTCATATCTAAAGTCTAAGG - Intergenic
983350390 4:166579474-166579496 CTCTTCAAATATAAAATCAAAGG - Intergenic
983373142 4:166890029-166890051 TTATTCCAATGTAAGACCTATGG - Intronic
983436968 4:167728588-167728610 TATTTCAAAGATAAAATTTATGG + Intergenic
983477202 4:168228850-168228872 GTTTTCAGATGTGAAATCTGAGG - Intronic
983783984 4:171709157-171709179 TTTTTTAAATGTTAAAGATATGG + Intergenic
983918859 4:173322846-173322868 TTTTTAAAATTTAAAAACAAAGG + Exonic
983967189 4:173826996-173827018 CTTTTCAAATGTAACATTTTAGG - Intergenic
984345350 4:178515714-178515736 TTTTTCACATATAAACTATATGG + Intergenic
984404730 4:179313413-179313435 TTTATCAAATATAATATTTATGG - Intergenic
984550236 4:181150584-181150606 TTTTTCAAATGAGAAAACTGAGG - Intergenic
984683519 4:182639481-182639503 TTTTTTAAAAGAAAAATCTTAGG + Intronic
984711883 4:182892694-182892716 TTTTGCAAATGTAACAACTTTGG - Intronic
984880212 4:184404138-184404160 TTTTTCAACTGTAAAATGGTAGG - Intronic
985048736 4:185969321-185969343 TTTTTCAAAAATAACTTCTATGG - Intergenic
985166681 4:187102878-187102900 TTTTTCAAATGAGAAAAATATGG + Intergenic
985168660 4:187125048-187125070 TTTGTCTAATTTAAAATATATGG - Intergenic
985273196 4:188213987-188214009 TTTTTCAACTGGAAACTCTGAGG - Intergenic
985404720 4:189626344-189626366 ATTTTCAAAAGTAGAATTTATGG - Intergenic
985500105 5:238079-238101 TTTCTCAGATGTAAAGTATAGGG - Intronic
985737289 5:1591629-1591651 TTTCTCAGATGTAAAGTATAGGG + Intergenic
985892574 5:2726997-2727019 TTTTTCATTTGTAGAATCCAAGG + Intergenic
986117713 5:4795618-4795640 TTTCTCTAATGTAAAATATGAGG - Intergenic
986117848 5:4797738-4797760 TTTATCAAATTTAATGTCTATGG + Intergenic
986204731 5:5612739-5612761 TTCGTAAACTGTAAAATCTAGGG - Intergenic
986309104 5:6538252-6538274 TTTTTCAAGGGTCAAATGTAGGG - Intergenic
986460199 5:7962458-7962480 TCTTTCAAAAATAAAATCTATGG + Intergenic
986509066 5:8484100-8484122 TTTTTCAAATTTATAATCCCTGG + Intergenic
986872206 5:12062212-12062234 TTTTACAAAAGTAAAATATTTGG - Intergenic
987249936 5:16089367-16089389 TTATTCAAATATAATCTCTAGGG - Intronic
987264632 5:16240137-16240159 TTTTTAAAATGTGACATATATGG + Intergenic
987285661 5:16454178-16454200 TATTTCAAATAAAAAAACTATGG + Intronic
987443812 5:17991143-17991165 TTTTTCAATTTTAGAAGCTAAGG - Intergenic
987693930 5:21304008-21304030 TTTTTTAAATGGAAAATGTGAGG + Intergenic
987844355 5:23262560-23262582 TTTTTAAAAAGTAAAATATTAGG - Intergenic
987857939 5:23445290-23445312 TGTTTAAACTGTGAAATCTATGG + Intergenic
987982653 5:25106841-25106863 TGTTTGAAATGTAAAATTTTGGG - Intergenic
989131693 5:38113458-38113480 ATTGTCAAATGTAAAAAGTAAGG + Intergenic
989321721 5:40142712-40142734 ATTGTCAAGTGTAAAATCAAAGG + Intergenic
989502651 5:42186848-42186870 TTTTGGAAATAAAAAATCTAAGG - Intergenic
989702221 5:44282687-44282709 TTTTTGATATGTAGAATCTAAGG + Intergenic
989780284 5:45256417-45256439 TATTTCTAATGTAACATCAATGG - Intergenic
989800380 5:45531157-45531179 TGTTTCACATGAATAATCTATGG + Intronic
990118318 5:52416726-52416748 TTTTCAAAATGTATAATGTAGGG - Intergenic
990141162 5:52706045-52706067 TTTTTCAAAAGCAAATTGTAGGG + Intergenic
990192652 5:53277614-53277636 TTTTTTACAAGTAAAATCCATGG + Intergenic
990208246 5:53453428-53453450 TTTTTCAAATGCAAATACTCTGG - Intergenic
990420693 5:55630282-55630304 TTTTGCAAATGTAAATTAAAGGG + Intronic
990989060 5:61667590-61667612 TTATTCAAATGAAAACTCTTGGG - Intronic
991471207 5:66970822-66970844 TTTTACAGATGTTAAAACTAAGG + Intronic
991746323 5:69745523-69745545 TTTTTTAAATGGAAAATGTGAGG - Intergenic
991751382 5:69809718-69809740 TTTTTTAAATGGAAAATGTGAGG + Intergenic
991797925 5:70325476-70325498 TTTTTTAAATGGAAAATGTGAGG - Intergenic
991825701 5:70620837-70620859 TTTTTTAAATGGAAAATGTGAGG - Intergenic
991830670 5:70684612-70684634 TTTTTTAAATGGAAAATGTGAGG + Intergenic
991890266 5:71324795-71324817 TTTTTTAAATGGAAAATGTGAGG - Intergenic
992604852 5:78444894-78444916 TTTTGCAAATGGAAAATCTCAGG + Intronic
992749907 5:79852315-79852337 TTTTTTAAAAATAAAGTCTATGG - Intergenic
992914783 5:81437573-81437595 TTTTTCAGATTTAAAAACTCAGG - Intronic
992949746 5:81847128-81847150 TTTTTTAAAAGAAAAATTTAGGG - Intergenic
993198194 5:84777436-84777458 TTTTTCACATGAATATTCTATGG + Intergenic
993238979 5:85354885-85354907 TTTTTAAAATGCAAAACCTCTGG - Intergenic
993571470 5:89544872-89544894 TTATTCAAATGGAAAAACTAAGG + Intergenic
993607555 5:90012359-90012381 CTTTTTAAATTTAAGATCTATGG - Intergenic
993932844 5:93962850-93962872 TATTCCAAATTTAAAATCAAAGG + Intronic
994010363 5:94895296-94895318 TTTAAAAAATGTAAAATGTATGG - Intronic
994246026 5:97477573-97477595 TTTTTTTAATATAAAATCTTTGG + Intergenic
994387785 5:99152333-99152355 TTTTTTTACTGTAAATTCTAGGG - Intergenic
994467818 5:100161265-100161287 TTATTCCAATGTTAAATTTATGG + Intergenic
994946964 5:106407055-106407077 TTTTTCCAATGTAGACTTTAGGG - Intergenic
995159364 5:108959951-108959973 TGTTTTAAAGGTAAAATCTTTGG + Intronic
995266272 5:110165144-110165166 TTTTTCAAATGTCACATAAATGG + Intergenic
995406712 5:111806121-111806143 TTTTTCAAAATAAAAAGCTAGGG + Intronic
995768018 5:115639844-115639866 TCTTTCAATTGTCACATCTAAGG - Intergenic
995967058 5:117920186-117920208 TTTTTCACAGGTAAAAGTTAGGG + Intergenic
995986469 5:118181472-118181494 TTTTTCAAATATATCTTCTATGG - Intergenic
996000720 5:118359993-118360015 TTTTGCAACTGTAAACTATAGGG - Intergenic
996354508 5:122580977-122580999 TTTTTCCATTGAAAAATCAAAGG - Intergenic
996422726 5:123279858-123279880 TTTTTCAAATGAGAAAGCTGAGG + Intergenic
996535811 5:124576441-124576463 TAAATCAAATGTAACATCTAAGG - Intergenic
996834283 5:127773921-127773943 TTTTTCAAATGGAAAATAAAAGG - Intergenic
996957671 5:129204156-129204178 GTTTTCATATATAATATCTAGGG + Intergenic
997021395 5:130006996-130007018 TTTTAGAAATGTACAATCTCTGG - Intronic
997062025 5:130517921-130517943 TTTGTCAAATATCAAATGTAAGG + Intergenic
997120640 5:131169461-131169483 TTATTCAACTGTAAAGTGTAAGG - Intronic
997131505 5:131281520-131281542 TTTTTCAACAGCAAAATGTATGG - Intronic
997433216 5:133855944-133855966 TTTTAAAAATGTAAAAGCTTGGG + Intergenic
997539251 5:134648312-134648334 TGTTTCAGATGTAAATTATAAGG - Intronic
998123521 5:139599399-139599421 TTTTTCAAAAAAAAAATTTAAGG - Intronic
998161932 5:139817914-139817936 TTTTTCACATGAAGAAACTATGG + Intronic
998380149 5:141718665-141718687 TTTTACAAATGGAAAAAGTAAGG + Intergenic
998405294 5:141870805-141870827 TTATTCAAATCCAAAATCTTTGG + Intronic
998696930 5:144651600-144651622 TTTTTCAGATTTAGAATCCAGGG + Intergenic
999112355 5:149132935-149132957 TTTTTCAAATGAAGAAACTGAGG - Intergenic
999204678 5:149839640-149839662 TTTTCCAGATGAAAAATCTGAGG - Intronic
999339726 5:150759588-150759610 TTTTTCTAATGTGTAAACTAAGG + Intergenic
999407289 5:151317560-151317582 TTTTTAATATGTAACTTCTAGGG - Intronic
999438737 5:151584706-151584728 TTTTACAAATGAAAAAACTGAGG + Intergenic
999462165 5:151766907-151766929 TTTTACAGATGTAGAAACTATGG - Intronic
999694022 5:154172486-154172508 TTTTACAAATATGAAAACTAAGG - Intronic
999736788 5:154518831-154518853 TTTTTAAAATGTAAATTTCATGG + Intergenic
999915108 5:156249992-156250014 TCTGTAACATGTAAAATCTATGG - Intronic
1000310124 5:160034696-160034718 TTTTTGAAATGAAGAAACTAAGG + Intronic
1000452068 5:161401620-161401642 TTTTTCTAATGTAAAATTAATGG - Intronic
1000489426 5:161891969-161891991 ATTTTTAAAAGTGAAATCTAAGG + Intronic
1000532694 5:162443787-162443809 TTTTACAAATGAAAAAACTGAGG + Intergenic
1000570376 5:162905357-162905379 TTTTCCAAATGAAAAACCTGAGG + Intergenic
1000821249 5:165986987-165987009 TTTTGCAAATGGAAAGTTTATGG + Intergenic
1000883129 5:166720016-166720038 TTTTGGAAATGTAGAATCTTAGG - Intergenic
1000893876 5:166831448-166831470 TCTTTCAATTGTAAATTATAAGG - Intergenic
1001017090 5:168151562-168151584 TTTTGCAAATGGAGAAACTAAGG + Intronic
1001205076 5:169754791-169754813 TTTTACCAATGTGAAAACTATGG - Intronic
1001456329 5:171863104-171863126 GTTTTAAAATGTAATTTCTAAGG - Exonic
1001528911 5:172448733-172448755 TTTTACAAATGTAAAAACTAAGG + Intronic
1001872054 5:175165164-175165186 TTTTACAGATGTAAAAGCCAAGG + Intergenic
1001970391 5:175950632-175950654 TTTTACAAATGAAAAAACTAAGG + Intronic
1002247046 5:177893129-177893151 TTTTACAAATGAAAAAACTAAGG - Intergenic
1003083361 6:3040586-3040608 TTTTTCTAATTTAAACTCAATGG + Intergenic
1003477322 6:6495658-6495680 TGTTAGAAATGTAAAGTCTAGGG - Intergenic
1003511971 6:6789311-6789333 TTTTACAGCTGTAAAAACTAAGG - Intergenic
1003742452 6:8957441-8957463 TTTTTCAAATGCAAACATTATGG + Intergenic
1004153417 6:13143540-13143562 TTTTTAAAATGCAGAATCTCAGG - Intronic
1004443272 6:15674104-15674126 TTTTTCAAATGTCCACTTTATGG - Intergenic
1005127917 6:22470207-22470229 TGTTACAAATGTAAATTCTGGGG + Intergenic
1005367748 6:25096315-25096337 TTGTTCAAATGTACTATCTGTGG + Intergenic
1005525467 6:26643249-26643271 TTTTTCAGATGTCAATTCTGAGG + Intronic
1005556981 6:26995912-26995934 TTTTTTAAATGGAAAATGTGAGG - Intergenic
1005783109 6:29214532-29214554 TTTTCCAAATACAAAATCTAAGG + Intergenic
1006255010 6:32825430-32825452 TTTTTTAAATTAAAAATATATGG - Intronic
1006918809 6:37614264-37614286 TTTTACAGATGCAAAAACTAAGG - Intergenic
1006928165 6:37670506-37670528 TTTTGCAAATGAGAAAACTAAGG - Intronic
1007122344 6:39393366-39393388 TTTTTCAGATGTCAAAACTGAGG - Intronic
1007299364 6:40855323-40855345 TTTTACAAATGTAAAAACTGAGG + Intergenic
1007535706 6:42586666-42586688 TTTTTAAAATGGTAACTCTAGGG + Intronic
1008001042 6:46360100-46360122 TTGTTAAAATGAAAATTCTAGGG + Intronic
1008164140 6:48115048-48115070 ATTTTAAAATGTGAATTCTAGGG - Intergenic
1008217005 6:48804604-48804626 TTTTTTAAATCTAAAATCGAAGG - Intergenic
1008259126 6:49343424-49343446 ATTTTAAAATGTTAAATTTATGG - Intergenic
1008341241 6:50367210-50367232 TTTTGCAAATGCAAAGTCTGAGG + Intergenic
1008386705 6:50899998-50900020 TTTTTCCAATGAGAAAACTAAGG - Intergenic
1008405181 6:51111231-51111253 TTTTGCAAATGAAGGATCTAAGG + Intergenic
1008490323 6:52079616-52079638 TTTTACAAATGAACAATCTGAGG - Intronic
1008563167 6:52741764-52741786 TTTTTAAACTATAAAATCTAAGG - Intergenic
1008699147 6:54078205-54078227 TTTTATAAATGTAAAATTTTAGG - Intronic
1008703104 6:54125289-54125311 TTTTACTAATTTAAAATCAATGG - Intronic
1008827960 6:55721504-55721526 TTTTTGAAATATAATATTTAAGG - Intergenic
1008837553 6:55854019-55854041 ATTTTCAAATGTGAAAACTCTGG + Intronic
1008910306 6:56725069-56725091 TTTTACAAATGAGAAAACTAAGG + Intronic
1008912343 6:56748992-56749014 TTTTTCTAATTTACAATATAGGG - Intronic
1009288609 6:61855397-61855419 TTTTACAGATGGAAAAGCTAAGG - Intronic
1009444196 6:63721150-63721172 ATTTTCAACTGCAAAATTTATGG - Exonic
1009698323 6:67140323-67140345 TATTTCAACAGTAAAATTTATGG + Intergenic
1009716465 6:67404104-67404126 CTTTTAAAATGTAAAATTTCAGG + Intergenic
1009887192 6:69638082-69638104 TTTTTCAAAGGACAAATCCAAGG - Intergenic
1010038079 6:71348840-71348862 TTTATAAAATGTAAAAACTGAGG + Intergenic
1010386045 6:75281639-75281661 TTTTTCAAGTATAAAATCACTGG - Intronic
1010478128 6:76315061-76315083 TTTTGCAAATGAGAAAACTAAGG + Intergenic
1010612798 6:77975515-77975537 GTTTTCAAAAGTAAAATATTAGG - Intergenic
1010886036 6:81242010-81242032 TTTTTTAAATGAAAAGCCTAGGG - Intergenic
1010971773 6:82270514-82270536 TTTCTCAAATTTTAAATATATGG - Intergenic
1011009732 6:82690184-82690206 TTTTCCAAATGTAAAAAACAGGG - Intergenic
1011091465 6:83606499-83606521 TTTTATAAATGCAAAATCTCAGG + Intronic
1011350846 6:86422098-86422120 TTTTGCAAATGAAGAATCCAGGG - Intergenic
1011431198 6:87288768-87288790 TATTTCAAAGGTAAAAACTTTGG - Intronic
1011818194 6:91218273-91218295 AATTTCAAATGTGAAATGTAGGG - Intergenic
1011940745 6:92840005-92840027 TTTTACTAATGTAAAAACTATGG + Intergenic
1011973130 6:93254419-93254441 TTTTTATAATATAAATTCTATGG - Intronic
1012025298 6:93982315-93982337 GTTTTGAAGTGTAATATCTAGGG + Intergenic
1012164598 6:95932668-95932690 TTTTAAAAATGTTAAATCTATGG - Intergenic
1012185679 6:96212946-96212968 TTTTACAGATTAAAAATCTATGG - Exonic
1012295724 6:97520228-97520250 ATTTTCAAATATACAATATATGG - Intergenic
1012389305 6:98719162-98719184 TTTTTGTATTGTACAATCTATGG + Intergenic
1012664546 6:101950955-101950977 TTTATTAAAAATAAAATCTATGG - Intronic
1012841520 6:104334265-104334287 TTTTTTAAATGTTGAATTTAAGG - Intergenic
1013021186 6:106221383-106221405 TTTATCAAATGTCAAAACTGAGG + Intronic
1013110051 6:107057727-107057749 TTTGTAAAATTTAAAATATATGG - Intergenic
1013266808 6:108508116-108508138 TTTTACAAATGGGAAAACTAAGG + Intronic
1013453984 6:110313190-110313212 ATTTTGAAATATAAAATTTATGG - Intronic
1013468625 6:110440451-110440473 TTTTTCAAATGGAAAATACAAGG + Intronic
1013715336 6:112954368-112954390 TTTTGCATATGTAATATCCACGG - Intergenic
1013760949 6:113516821-113516843 TTTTAAAAATGTAAATTCTTGGG + Intergenic
1013837392 6:114348730-114348752 TTTTTAATATTTTAAATCTAGGG + Intergenic
1014165711 6:118222186-118222208 TTTTTAAAATGCAGAATCTCAGG - Intronic
1014371887 6:120619978-120620000 TTTTTCAATTATAAAATGCAGGG - Intergenic
1014477869 6:121896610-121896632 TTTTTCATCTGTAAAATGAAAGG + Intergenic
1014639028 6:123885610-123885632 TGTCTCAAATTTAAAATTTAGGG - Intronic
1014810384 6:125878960-125878982 CATTCCAAATGTCAAATCTAAGG - Intronic
1014941820 6:127449695-127449717 TTATTAAAATGTACTATCTAGGG - Intronic
1015192434 6:130486460-130486482 TTTTTCAAATGTCAAAACCAAGG - Intergenic
1015286484 6:131491150-131491172 TGTTGGAAATGTAAAATCAAAGG + Intergenic
1015370329 6:132443696-132443718 TTTTACAGATGAGAAATCTAAGG - Intergenic
1015370844 6:132450599-132450621 TTTTTCAATTTTAAAATTTCTGG - Exonic
1015461406 6:133495809-133495831 TGTTCCAAATGCAAAACCTATGG - Intronic
1015646394 6:135393835-135393857 GTTTTCAAATGAAGAGTCTAAGG + Intronic
1015667075 6:135644000-135644022 TTTTGCAAATAGAAAATCAATGG + Intergenic
1015681400 6:135812542-135812564 TTTCTCAAATGTTAAATATCAGG - Intergenic
1016275746 6:142350354-142350376 TTTTTGAAATGTAAAAGCCAAGG - Intronic
1016432021 6:143995676-143995698 TGTTTCAAATCTGAAATATAAGG + Intronic
1016435674 6:144034711-144034733 TTTTTCAATCTTAAAAGCTAGGG - Intronic
1016547985 6:145245664-145245686 TTTTTCAAATGCAAAAGCTAGGG + Intergenic
1016564318 6:145436010-145436032 TTTTACAAATGTAAAATGACAGG + Intergenic
1016959463 6:149657821-149657843 TTTTTTAAATGTAAAATTGTTGG - Intergenic
1017243888 6:152200875-152200897 TTCTTCAGTTGTAAAATCTAAGG - Intronic
1017314093 6:153009120-153009142 TTTACCAAATGTAAAAGATAAGG - Exonic
1017428810 6:154350194-154350216 TGATCCAAATATAAAATCTAAGG - Intronic
1017611474 6:156190939-156190961 ATTGTCAAATGAAAAAGCTAAGG - Intergenic
1017738844 6:157386878-157386900 TTTTTAAAATAAAAAATCTTTGG + Intronic
1018260637 6:161967150-161967172 TATGTCAAATGTAAACTCAAAGG + Intronic
1018442480 6:163825849-163825871 TTTTTCAAATATAAAAATCAAGG + Intergenic
1018711707 6:166501985-166502007 TTTTACAAATATAAAATGTATGG + Intronic
1019263569 7:97898-97920 TTTTGCAAATGGAAAGTCTGCGG - Intergenic
1020109998 7:5442705-5442727 TTTTTTAAATGAAAAATAAAAGG + Intronic
1020347442 7:7181442-7181464 TTTTTCAGATGACAAAACTAAGG - Intronic
1020778407 7:12486596-12486618 TTTTAAAAATGTAAAATCAATGG - Intergenic
1020829566 7:13077209-13077231 TCTTAGAAATATAAAATCTAAGG + Intergenic
1020868333 7:13593669-13593691 TTTTTTAATTCTAATATCTATGG + Intergenic
1021161166 7:17274512-17274534 TTTTTCAAATGAAGAAACTGAGG + Intergenic
1021449654 7:20771469-20771491 TTACTGAAATGGAAAATCTATGG + Intronic
1021715602 7:23459312-23459334 TTTTTTAAATGTAAAAATGAGGG + Intronic
1022229602 7:28401425-28401447 TTTTTATAATGTAAGTTCTAGGG + Intronic
1022251248 7:28610605-28610627 TTCTTCAAATGAAAAATGGATGG + Intronic
1022411022 7:30138421-30138443 TTTTACAGATGTAGAAACTATGG - Intronic
1022452967 7:30532997-30533019 TTACTCAAATATAAAATCCACGG + Intronic
1022614185 7:31911739-31911761 TTTTACAAATGGAAAAACTGAGG + Intronic
1023455439 7:40333764-40333786 TTTTTTAAATTTAAGTTCTAGGG + Intronic
1023587575 7:41747017-41747039 TTTGTCAAATGTCAAATCCCAGG + Intergenic
1023636280 7:42214069-42214091 TTTTTCAATTGCAAACTCCAAGG + Intronic
1023871174 7:44263712-44263734 TATTTGAAATGTAAAATTTCTGG - Intronic
1024331210 7:48157112-48157134 TTTTACAAATGCAAAAACTAAGG - Intergenic
1024404199 7:48959386-48959408 TCATTCAAATGTAAGATCAATGG - Intergenic
1024411303 7:49045390-49045412 TATTCCAAATGAAAAAACTAAGG - Intergenic
1024430786 7:49285764-49285786 TTTTTCAGATGAACAGTCTAGGG + Intergenic
1024614021 7:51092413-51092435 TTTTTAAAAAGTTAAATGTAAGG - Intronic
1024772688 7:52743220-52743242 TTTTTAAAATGTAAACTTCAAGG - Intergenic
1024844195 7:53622523-53622545 TTCTTCCCATGGAAAATCTATGG + Intergenic
1024964387 7:55009282-55009304 TTTTACAAATGTAAAATGACAGG + Intergenic
1025266869 7:57469011-57469033 CATTTCAAATGTAAAAACGATGG + Exonic
1025297444 7:57787348-57787370 TTCATCAAATGTAAAAACTATGG - Intergenic
1025721102 7:64015315-64015337 CATTTCAAATGTAAAAAATATGG + Intergenic
1025748235 7:64266180-64266202 CATTTCAAATGTAAAAAATATGG + Exonic
1026211100 7:68306079-68306101 ATTTTAAAATGTAAAATTAAGGG - Intergenic
1026331008 7:69352492-69352514 TTTTTGAAATGAGAAATCTGGGG + Intergenic
1026667225 7:72352508-72352530 TTTTTTACTTGTAAAATCTTGGG - Intronic
1026977014 7:74505218-74505240 CTTTACAAATGAAAAATCTCGGG + Intronic
1028154528 7:87414749-87414771 TATTACAAATGAAAAATCTATGG - Intronic
1028169034 7:87573572-87573594 GCTTTCAAATATAAAATCTGGGG - Intronic
1028402933 7:90443953-90443975 TTTTACAAATGAAGAAACTAAGG + Intronic
1028522174 7:91743452-91743474 TTTGTCAAATTTAAATTTTAAGG + Intronic
1028759098 7:94475033-94475055 TCTTTCAAATGTAACAGCTAAGG - Intergenic
1028797162 7:94916314-94916336 TGTTAGAAATGTAAAATCTAAGG - Intronic
1028851302 7:95541208-95541230 TTTTACAAATGAAAAAACTGAGG - Intergenic
1029865822 7:103627272-103627294 TTTTTTAAATGTAAAACCTTTGG - Intronic
1030097667 7:105915241-105915263 TTTTTCAAATATAAGTTCCATGG - Intronic
1030316520 7:108120729-108120751 TTATTCACATGTAACATCAACGG - Intronic
1030498195 7:110326482-110326504 TTTTTCATCTGTAAAAAATATGG - Intergenic
1030505287 7:110414309-110414331 TTTTTTAAATGAAAATTCCACGG + Intergenic
1030588903 7:111455350-111455372 TTATTCAAATGTAAAAAGAATGG - Intronic
1030655579 7:112163706-112163728 TTTTACAAATGAAGAAACTAAGG + Intronic
1030730068 7:112977170-112977192 TTTTTCAAATCTAATTTCTGAGG + Intergenic
1030772720 7:113494714-113494736 TTTTTCAAATCTAATTTCTGAGG + Intergenic
1030845623 7:114405961-114405983 TTTTTCAACTACAAATTCTATGG - Intronic
1030877469 7:114832933-114832955 TTATTCAAATGTGAAATATATGG - Intergenic
1031045058 7:116878492-116878514 GTTTTCAAAGGTAAAAACTAAGG - Intronic
1031262703 7:119542201-119542223 TTTATAAAATGTAAAAAATAGGG + Intergenic
1031327452 7:120419324-120419346 TTTTTTAAATGCAAAAGCAATGG - Intronic
1031375460 7:121019442-121019464 TTTTTAACATGTAAAATCCTGGG - Intronic
1031809955 7:126354434-126354456 TTTTTAAAATTTAATATATAAGG - Intergenic
1032007909 7:128318822-128318844 TTTTTCAGTTGTAAGATCTGTGG - Intronic
1032104547 7:129015827-129015849 TGTTTCAAAAATAAAATATAAGG + Intronic
1032210857 7:129912791-129912813 TTTCTCAAATGGAAAAACTGAGG - Intronic
1032666302 7:134039983-134040005 TTTGTGTAATGTGAAATCTAAGG - Intronic
1032737651 7:134707347-134707369 TGTTTCAAGTGTAATATTTAAGG + Intergenic
1033248574 7:139739272-139739294 TTTTTAAAATGTGAACTTTATGG - Intronic
1033335140 7:140445875-140445897 TTTTGCAAATGAAAAAACTAAGG - Intergenic
1033572743 7:142648633-142648655 TTTTTCAATTGTTAACTTTATGG - Intergenic
1033602896 7:142901449-142901471 TTTTTCAAAGGAGAAATTTAGGG + Intergenic
1033706346 7:143888904-143888926 TTTTTCAAATGTACAAAACATGG - Intronic
1033863340 7:145658201-145658223 ATTCCAAAATGTAAAATCTAGGG - Intergenic
1033996829 7:147360621-147360643 TTTTTCAAAAGAAATATTTATGG - Intronic
1033999534 7:147395042-147395064 TTTTTAATTTATAAAATCTAAGG - Intronic
1034007144 7:147485258-147485280 TTTTTCAAAGGTGAAAACTAAGG + Intronic
1034008640 7:147503985-147504007 TTTTTCAGATGAAAAAGCTGAGG + Intronic
1034053587 7:148010531-148010553 TTTTTTAATGGTATAATCTAAGG + Intronic
1035481249 7:159187883-159187905 TTTTTTAAATGTAATATAAATGG + Intergenic
1035644602 8:1209394-1209416 TTTTTGGAATTTAAAATGTAGGG - Intergenic
1036200825 8:6770500-6770522 TTTGTCAACTGTAAAATATTAGG - Intergenic
1036828156 8:11995911-11995933 TTTTTCAAATGAAGAAACTAAGG + Intronic
1036958721 8:13220140-13220162 ATTTTAAAATGTACAATCCAAGG - Intronic
1037009723 8:13825577-13825599 ACTTTAAAAAGTAAAATCTAAGG + Intergenic
1037054552 8:14423132-14423154 TTTTTTAAAAGTAAACTCTGGGG + Intronic
1037531994 8:19785758-19785780 TTTTGCAGATGAAAAAACTAAGG - Intergenic
1037656732 8:20890078-20890100 TTTTTCAGATGGAAAAACTAAGG + Intergenic
1038033716 8:23668029-23668051 ATTTTCAGATGAAAAAGCTAAGG - Intergenic
1038033723 8:23668176-23668198 ATTTTCAGATGAAAAAGCTAAGG + Intergenic
1038129347 8:24712233-24712255 TTTTACAGATGAAAAAACTAAGG - Intergenic
1038554913 8:28503631-28503653 TATTTCAAATTTAGAAACTATGG + Intronic
1039130897 8:34262951-34262973 CTTTTCAGATGAAAGATCTAAGG - Intergenic
1039161559 8:34627248-34627270 TATTTTGAAGGTAAAATCTATGG - Intergenic
1039281608 8:35991421-35991443 TAATTCAAATGAACAATCTAAGG - Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1039525437 8:38210611-38210633 TTTTTCAAGTATAAAATCAAAGG - Exonic
1039930053 8:41978375-41978397 TTTTTCAAAGGAAGAAACTAAGG - Intronic
1040354838 8:46607790-46607812 TTTTTCAAAATGAAAATCTGGGG + Intergenic
1041393681 8:57370316-57370338 TTTTTCCAATGTTCAATGTATGG - Intergenic
1041409630 8:57539130-57539152 TTTTACAAATGCAAAAACTGAGG + Intergenic
1041567836 8:59300622-59300644 TTTATCATCTGTAAAATTTAAGG - Intergenic
1041754228 8:61295786-61295808 TTTTTCAAATGAGGAAACTAAGG - Intronic
1041778324 8:61549351-61549373 TTTTACAAATGTTGAAACTAAGG + Intronic
1041933515 8:63312055-63312077 GTTTCTAAATGTAAAATCTACGG - Intergenic
1041966780 8:63687295-63687317 TATTTCAAATGAAAAATAAATGG - Intergenic
1042279804 8:67043760-67043782 TTTATCATTTCTAAAATCTAAGG - Intronic
1042293037 8:67189545-67189567 TTTTCCAAATGTATACTGTATGG - Intronic
1042535910 8:69859125-69859147 GTTTTCAAGTTTAAAATCAAAGG + Intergenic
1042584679 8:70322670-70322692 TTTTACAAATGAAGAAACTAAGG - Intronic
1042669371 8:71244941-71244963 TTTTTAAAATTTAAAATCTAGGG + Intronic
1043090721 8:75899662-75899684 TTTTTCAAATATAAAAATCAGGG + Intergenic
1043206324 8:77447384-77447406 TTTTTTTAATTTAAAACCTATGG + Intergenic
1043470259 8:80555125-80555147 TTTTTGAAAAATAAAACCTACGG - Intergenic
1043718975 8:83520584-83520606 TTTCTCAAATGAAAAATGTAGGG + Intergenic
1043744952 8:83862789-83862811 TTTTTCAAATGTCAAATGATAGG + Intergenic
1043808880 8:84709545-84709567 TTTTTTTAAAGTAAAATATATGG - Intronic
1043813457 8:84771566-84771588 TTTGTAAAATGTAAATTCAATGG + Intronic
1043835867 8:85045046-85045068 TTTTTAAAAGGCAAACTCTAGGG + Intergenic
1043855215 8:85257419-85257441 TTTTTAAAAAGTCAAATTTAAGG + Intronic
1043955631 8:86356452-86356474 TTTTTTTACTGTAAAATCTTTGG + Intronic
1044154781 8:88831079-88831101 TTTTGCAAAAGTAAGATCTTAGG + Intergenic
1044158657 8:88884268-88884290 TTTTAGAAATGTGAACTCTAAGG - Intergenic
1044266707 8:90190482-90190504 TTTATCAACTGTAATCTCTAAGG + Intergenic
1044305031 8:90629446-90629468 TTACTCAAATGTAAAGTCAAAGG + Intronic
1044422767 8:92017147-92017169 TTCTGCAAATGAAAAATCAAGGG - Intronic
1044480117 8:92676126-92676148 TTTTTCAAACTTAAAATGTTAGG - Intergenic
1044829367 8:96231277-96231299 TTTTTAAAATGTCAAATCTGTGG + Intronic
1045320210 8:101076830-101076852 TTTTTCAATTGAGAAAACTAAGG + Intergenic
1045730807 8:105238733-105238755 TTGTTAAAATGCAAAATCTTGGG - Intronic
1045901684 8:107289023-107289045 TTTTTCATGAATAAAATCTAAGG + Intronic
1046023628 8:108696318-108696340 TATTGCAAATGAAAAATCTGAGG + Intronic
1046082433 8:109387498-109387520 TTTTTCATCTGTAAAATTGAAGG + Intronic
1046108617 8:109694386-109694408 TAATTCAAATCTAAAATCTAGGG - Intergenic
1046198877 8:110895768-110895790 TTTTATAAATATAAAATTTAGGG - Intergenic
1046289865 8:112144274-112144296 TTTTTCAAAGGAAAAAACTGAGG + Intergenic
1046415012 8:113902050-113902072 TTTTTCAGATGAAGAATCTGAGG + Intergenic
1046539397 8:115559722-115559744 TTTTTAAAAAATAAAATCTTTGG - Intronic
1046551175 8:115719137-115719159 TTTTTGCAATGTAAAATGCATGG - Intronic
1046659501 8:116933942-116933964 TTTTACAGATGGAAAAACTAAGG - Intergenic
1046869171 8:119185785-119185807 ATTTTTAAATGTACAATATAAGG + Intronic
1046907588 8:119590331-119590353 TTTTTCAGATGAAAAAACTGAGG + Intronic
1047176381 8:122544914-122544936 TTTTGCAGATGTAAAAACTGAGG - Intergenic
1047677692 8:127221086-127221108 TTTTGCAAGTGTAAAAACTGGGG + Intergenic
1047832132 8:128645579-128645601 TTATTAAAATGTAAAATGTTGGG - Intergenic
1048179343 8:132180909-132180931 TTTTTCAGATGGATAATCTTGGG - Intronic
1048387318 8:133924253-133924275 TTTTACAGATTTAAATTCTAAGG + Intergenic
1048511934 8:135070789-135070811 TTTTACAAATGAAAAAACTGAGG - Intergenic
1048678909 8:136816476-136816498 TTTTTCAAATAAAAAAACTGAGG + Intergenic
1048825084 8:138416671-138416693 TTGCTCAAAAGTAAAATCTTTGG - Intronic
1049952762 9:661136-661158 TTTTTTAAATTTAAGTTCTAGGG + Intronic
1050014094 9:1215044-1215066 TTTTTAATATAAAAAATCTAGGG - Intergenic
1050150447 9:2614515-2614537 TTTTTCAGATGAAAAAACTAAGG + Intergenic
1050226377 9:3461737-3461759 ATTTTCATATGTCATATCTATGG + Intronic
1050230484 9:3519605-3519627 TTTTTCAAATGAGAAAACTGAGG + Intronic
1050301956 9:4268194-4268216 TTTTACAAATGAAAAAACTAAGG - Intronic
1050690109 9:8217642-8217664 ATTTTCAAATGGAAAAGCTGAGG + Intergenic
1050854135 9:10329970-10329992 TATTTGAAATGTAAAATCACTGG + Intronic
1050891455 9:10829701-10829723 TTTTACAAATGGAAAAACTGAGG - Intergenic
1050953082 9:11622099-11622121 TTTTTCAAATTGGCAATCTATGG - Intergenic
1051014322 9:12457407-12457429 TTTTTCATATGAGAAAACTAAGG - Intergenic
1051189995 9:14501491-14501513 TTTTACAGATGAAAAAGCTAAGG - Intergenic
1051212575 9:14760131-14760153 TTTCACAAATGAAGAATCTAAGG + Intronic
1051351096 9:16198547-16198569 TTTTACAGATGAAAAATCTAAGG + Intergenic
1051385439 9:16503154-16503176 TTTTTAAAGTGTAATATATATGG + Intronic
1051450337 9:17190718-17190740 CTTTTCAAGTCTAAAATCAAAGG - Intronic
1051734166 9:20181231-20181253 TTTTTCAGATGAGAAAACTAAGG - Intergenic
1051951618 9:22641390-22641412 TTTTTCAGATGTAAAAGAAATGG + Intergenic
1052294836 9:26885485-26885507 ATTTTTAAATGTAAAATTGATGG - Intronic
1052322269 9:27180920-27180942 TTTTTAAAATGTAAATTCAGTGG + Intronic
1052474831 9:28945621-28945643 TGTTTAAAATGTAAATTCTTAGG + Intergenic
1052496981 9:29239633-29239655 TTTTTAACATGTAAATTCTCAGG + Intergenic
1052558451 9:30051132-30051154 ATTATCAAATGTAGAACCTAGGG + Intergenic
1052602494 9:30653282-30653304 TTTTTCACATGAGAAATCGAGGG - Intergenic
1052621887 9:30922520-30922542 ATTTTGAAATTTAAAAACTAAGG - Intergenic
1053201474 9:36154548-36154570 TTTTTCAAAGATATATTCTAGGG + Intronic
1053380242 9:37643577-37643599 TTTTTAAAATCAAAAATGTAAGG - Intronic
1053747438 9:41213759-41213781 TTTTTTAAATGTAAGGGCTAAGG - Intergenic
1053796167 9:41728687-41728709 TTCATCAAATGTAAAAACTATGG + Intergenic
1054149014 9:61586182-61586204 TTCATCAAATGTAAAAACTATGG - Intergenic
1054184573 9:61940757-61940779 TTCATCAAATGTAAAAACTATGG + Intergenic
1054338943 9:63836763-63836785 TTTTTAAAATGTAAGGGCTAAGG + Intergenic
1054468780 9:65517293-65517315 TTCATCAAATGTAAAAACTATGG - Intergenic
1054479848 9:65651609-65651631 TTTTTAAAATGTAAGGGCTAAGG + Intergenic
1054653933 9:67647739-67647761 TTCATCAAATGTAAAAACTATGG - Intergenic
1055028865 9:71751652-71751674 TTTTTAAAATGTAAAATCCAGGG - Intronic
1055048091 9:71951714-71951736 TTTTTCAAAAGTAAAAAACAAGG - Intronic
1055188635 9:73490092-73490114 TTTTTCATATGTAAGATATCTGG - Intergenic
1055385585 9:75758725-75758747 TTTTTCATATGTAAAATAAAAGG - Intergenic
1055675701 9:78658039-78658061 TTTTTCAAATGTGAGACTTAAGG - Intergenic
1055722284 9:79188820-79188842 GTTTTCAAATGACAAATCTGAGG + Intergenic
1055893932 9:81153822-81153844 TTTTTTAACTGTAAAATGTGTGG - Intergenic
1055910405 9:81344364-81344386 TCTTTCCAATGCAAAATGTAAGG - Intergenic
1056156045 9:83838645-83838667 CTTTTCAAATTTTAAATCTTGGG - Intronic
1056162850 9:83914545-83914567 TTTCACAAATGTAAAATATATGG - Intronic
1056354492 9:85784918-85784940 CTTTTCAAATTTTAAATCTTGGG + Intergenic
1056357500 9:85816987-85817009 TTTCACAAATGTAAAATATATGG + Intergenic
1056881950 9:90403058-90403080 TTTTTCAACAATACAATCTATGG - Intergenic
1056888763 9:90469788-90469810 TTTTTAAAATGTAAGATGAAGGG - Intergenic
1057960819 9:99455036-99455058 TTTTACAAATGCAAATTCTTGGG - Intergenic
1058276556 9:103049057-103049079 TTTTTGAAATGTAAGGTCTCTGG - Intergenic
1058286192 9:103182036-103182058 TCTTTCAAACGTAAAATCAATGG - Intergenic
1058460029 9:105174090-105174112 TTTTACAAATGCAGAAACTAAGG - Intergenic
1058611674 9:106783831-106783853 TTTTACAAATGAAACAACTAAGG + Intergenic
1058616626 9:106835546-106835568 TTTTTAAAATATCAAATATATGG - Intergenic
1058703215 9:107618098-107618120 TTTTACAAATGAAAAAACTGAGG - Intergenic
1059023666 9:110602239-110602261 CTTCTCAAATGAGAAATCTAGGG - Intergenic
1059330389 9:113531782-113531804 TTTTTCAGATGAGAAAACTAAGG - Intronic
1059442085 9:114314023-114314045 TTTTTAAAATATAAAATCCTGGG - Intergenic
1059613973 9:115929179-115929201 TTTTCCATATGGAAAATCTGAGG + Intergenic
1059688473 9:116660822-116660844 TTTTACAAATGAACAAACTAAGG - Intronic
1059856265 9:118401052-118401074 TTTTTTAAATGTTAAAACTGAGG - Intergenic
1059856692 9:118406424-118406446 TTTTTCACATGTAAATTCAACGG + Intergenic
1059896327 9:118870043-118870065 ATTTTCAAATGAAGAAACTAAGG + Intergenic
1060095966 9:120790806-120790828 TTTTTTAAATTTAAGTTCTAGGG - Intronic
1060445621 9:123684724-123684746 TTTTTCAAATGTTCCATCAATGG + Intronic
1061445112 9:130633154-130633176 TTTGCCACATGTAAAATCAAGGG + Intronic
1061445915 9:130637230-130637252 TATTTCAAATGTATAAGCTCTGG + Exonic
1062148675 9:135006190-135006212 TATTTCAAAAGTAAAATAGATGG + Intergenic
1202783570 9_KI270718v1_random:24530-24552 TTTTTAAAATGTAAGGGCTAAGG - Intergenic
1202803517 9_KI270720v1_random:25148-25170 TTTTTAAAATGTAAGGGCTAAGG + Intergenic
1203448303 Un_GL000219v1:82258-82280 TTTTTAAAATGTAAGGGCTAAGG + Intergenic
1186022304 X:5269979-5270001 TTTTTAAAATGAAAAATGAATGG - Intergenic
1186069336 X:5801302-5801324 TTTTTGAACTGTAAAATCCTTGG + Intergenic
1186169930 X:6866235-6866257 TTTTTTTAATTTAAAATTTATGG + Intergenic
1186564162 X:10644550-10644572 TTTTTCATATGAAAAAGCAAGGG + Intronic
1186655651 X:11609142-11609164 GTTTGTAAATGTAAAAACTAAGG - Intronic
1186887184 X:13925592-13925614 TTTTTTAAAGGTAAAATGTAAGG - Intronic
1186972141 X:14858716-14858738 TTTTACAAATGAAAAAACTGAGG + Intronic
1186987591 X:15033500-15033522 TTTTCCAAAAGTAAAGCCTAAGG - Intergenic
1187472950 X:19585722-19585744 TTTTAAAAATGTAAATTCTCAGG + Intronic
1187664809 X:21594570-21594592 ATGTTCAGATGTAAAATATAGGG - Intronic
1187782061 X:22838127-22838149 TTTTTTAGATGTAGAAACTATGG + Intergenic
1187811596 X:23184580-23184602 TATTTAAAATGTGAAATATAAGG + Intergenic
1187926322 X:24253676-24253698 CGTTTCAAATGCAAAATCTCAGG + Intergenic
1187995259 X:24919490-24919512 TTTTACAAATGGAAAAACTGAGG - Intronic
1188125588 X:26364503-26364525 TTTCTCAAAGGTAAATACTAGGG + Intergenic
1188235894 X:27730706-27730728 TTTTTCAAAAATAAAATATGTGG - Intronic
1188373078 X:29392805-29392827 TATTTCAAATGAAAAGTATAAGG + Intronic
1188423533 X:30018038-30018060 TTTTACAAATGTAGAATCTGAGG + Intergenic
1188428221 X:30074278-30074300 TTTTTCATGTGTAAAATGCATGG - Intergenic
1188691748 X:33138040-33138062 TTTTTCAGATGAAGAAACTAAGG + Intronic
1189242869 X:39539344-39539366 TTTTTCAAAAGTAAAAGTTAAGG + Intergenic
1189501308 X:41562008-41562030 TTTTACAAATGTGAAAACTGAGG - Intronic
1189726944 X:43976715-43976737 TTTTACAAATGGAAAAACTGAGG + Intergenic
1189828917 X:44950327-44950349 TTTTTCATATGGAAAATCACAGG + Intronic
1190378987 X:49819745-49819767 TCTTTAAAATGTCAAAGCTAGGG - Intergenic
1190438105 X:50448022-50448044 TTTGTTAAATGTAAAATAAATGG + Intronic
1191697047 X:64000860-64000882 TTTTACAGATGGAAAAGCTAAGG + Intergenic
1192088731 X:68129980-68130002 TTCTTCAATTATAAAATCCAGGG + Intronic
1192601269 X:72466988-72467010 TTTTGCAAATGTAATATGAATGG - Intronic
1192867411 X:75149802-75149824 TTTTTCAAATGTTAGTTCAAAGG - Intronic
1193809894 X:86039031-86039053 TTTTTCAAATGTGAAGCCTGAGG - Intronic
1193984559 X:88224380-88224402 TTTTTTATATGTAAAATGTAGGG + Intergenic
1194430094 X:93792600-93792622 TTTTTCAAATTAAAAAGTTAGGG - Intergenic
1194599306 X:95900680-95900702 TTTTATAAATGTAGAAACTAAGG + Intergenic
1194843259 X:98771633-98771655 TTTTTCAAATGTTCAATAAATGG + Intergenic
1194884994 X:99303479-99303501 TGTTTCTAATTTTAAATCTAAGG + Intergenic
1194909117 X:99617514-99617536 TTTTTAAAAAGAAAAATGTATGG - Intergenic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic
1195165634 X:102216884-102216906 TTTTTTAAATGAAAAATAAATGG + Intronic
1195193224 X:102470207-102470229 TTTTTTAAATGAAAAATAAATGG - Intronic
1195441103 X:104899102-104899124 GATTGCAAATGTAAAATGTATGG - Intronic
1195454731 X:105054887-105054909 GTTTACAAATGTGAAATTTATGG - Intronic
1195590400 X:106618411-106618433 TGTTCGAAATGTAAATTCTAGGG - Intronic
1195852618 X:109299327-109299349 TTTTTCAAGTCTAACTTCTAAGG + Intergenic
1195893880 X:109725432-109725454 CTTGTCAAATGTAAAATCAATGG - Intronic
1195931633 X:110083124-110083146 CTTTTCAAGTGTAAAAGCAATGG - Intronic
1196076650 X:111585376-111585398 TTTTGCAAATGAGAAAGCTAAGG - Intergenic
1196212882 X:113014863-113014885 TTTTACCAATGTAAACTCCATGG - Intergenic
1196967493 X:121073772-121073794 ATTTTCAAATAAACAATCTAAGG - Intergenic
1197453921 X:126653450-126653472 TTTTACAAATGTGAAAGCTAAGG - Intergenic
1197482075 X:126999529-126999551 TTTTACAGATGAAAAAACTAAGG + Intergenic
1198131318 X:133698073-133698095 TTGTTCAAATGCCGAATCTATGG - Intronic
1198199650 X:134402531-134402553 TTTTACAGATGCAATATCTAAGG - Intronic
1198373568 X:136015261-136015283 TTTTTAAAATATATAGTCTATGG + Intronic
1198628268 X:138603995-138604017 TTATATAAATGTAAAATATATGG - Intergenic
1199012431 X:142773354-142773376 TTTTTTAAATTTTAAATCTGTGG - Intergenic
1199100872 X:143798526-143798548 TTTTACAAATGGAAAACCTAAGG + Intergenic
1199328004 X:146524086-146524108 ATTCTCAAATGAAAAATATATGG + Intergenic
1199363813 X:146954276-146954298 TTTTTCAAATTTCAAATAAATGG + Intergenic
1199527368 X:148807447-148807469 TTTTCCAAATGTAAAAGAAAAGG - Intronic
1199759969 X:150898195-150898217 TTTCTCAAAGGTAAACTCTTGGG + Intronic
1199820303 X:151439007-151439029 TTTTACAAATGTGAAAACTAAGG + Intergenic
1201470133 Y:14324140-14324162 TTTTTAAAATGCAAATTCTCTGG + Intergenic
1201637577 Y:16142202-16142224 TTTTTCATTTGAAAAATCTAAGG - Intergenic
1201906876 Y:19094468-19094490 TATTTTAAATGTAAAATATTAGG - Intergenic
1202266990 Y:23029964-23029986 TTTTTTAAATGTACAATCAGTGG + Intergenic
1202419982 Y:24663709-24663731 TTTTTTAAATGTACAATCAGTGG + Intergenic
1202450804 Y:25006375-25006397 TTTTTTAAATGTACAATCAGTGG - Intergenic