ID: 1078749248

View in Genome Browser
Species Human (GRCh38)
Location 11:14144209-14144231
Sequence ATACCCTTTTAGAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 197}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078749248_1078749257 25 Left 1078749248 11:14144209-14144231 CCTTCCATCTTCTAAAAGGGTAT 0: 1
1: 0
2: 2
3: 20
4: 197
Right 1078749257 11:14144257-14144279 ATGGAAAGAAGACATAAATTGGG 0: 1
1: 0
2: 0
3: 59
4: 812
1078749248_1078749252 -8 Left 1078749248 11:14144209-14144231 CCTTCCATCTTCTAAAAGGGTAT 0: 1
1: 0
2: 2
3: 20
4: 197
Right 1078749252 11:14144224-14144246 AAGGGTATTTCGGTTTTACTGGG 0: 1
1: 0
2: 0
3: 10
4: 363
1078749248_1078749256 24 Left 1078749248 11:14144209-14144231 CCTTCCATCTTCTAAAAGGGTAT 0: 1
1: 0
2: 2
3: 20
4: 197
Right 1078749256 11:14144256-14144278 AATGGAAAGAAGACATAAATTGG 0: 1
1: 0
2: 5
3: 98
4: 929
1078749248_1078749254 -4 Left 1078749248 11:14144209-14144231 CCTTCCATCTTCTAAAAGGGTAT 0: 1
1: 0
2: 2
3: 20
4: 197
Right 1078749254 11:14144228-14144250 GTATTTCGGTTTTACTGGGTGGG 0: 1
1: 0
2: 2
3: 3
4: 99
1078749248_1078749258 30 Left 1078749248 11:14144209-14144231 CCTTCCATCTTCTAAAAGGGTAT 0: 1
1: 0
2: 2
3: 20
4: 197
Right 1078749258 11:14144262-14144284 AAGAAGACATAAATTGGGCTAGG 0: 1
1: 0
2: 1
3: 87
4: 1232
1078749248_1078749255 6 Left 1078749248 11:14144209-14144231 CCTTCCATCTTCTAAAAGGGTAT 0: 1
1: 0
2: 2
3: 20
4: 197
Right 1078749255 11:14144238-14144260 TTTACTGGGTGGGAATACAATGG 0: 1
1: 0
2: 2
3: 19
4: 146
1078749248_1078749253 -5 Left 1078749248 11:14144209-14144231 CCTTCCATCTTCTAAAAGGGTAT 0: 1
1: 0
2: 2
3: 20
4: 197
Right 1078749253 11:14144227-14144249 GGTATTTCGGTTTTACTGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 72
1078749248_1078749251 -9 Left 1078749248 11:14144209-14144231 CCTTCCATCTTCTAAAAGGGTAT 0: 1
1: 0
2: 2
3: 20
4: 197
Right 1078749251 11:14144223-14144245 AAAGGGTATTTCGGTTTTACTGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078749248 Original CRISPR ATACCCTTTTAGAAGATGGA AGG (reversed) Intronic
900795689 1:4707012-4707034 ACACCCTTTGAGAAGAGGCAGGG - Intronic
902711256 1:18241562-18241584 ATACCCTGTTAGGGGTTGGAGGG + Intronic
905084926 1:35364494-35364516 ATACTCTTCTAAAAGAAGGAGGG - Intronic
905096762 1:35478888-35478910 ATTCCCTTTTAGAGGAAAGAAGG - Intronic
906328360 1:44863672-44863694 ATACCCTGGTGGAAGAAGGAAGG - Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
911731785 1:101299178-101299200 ATGCCCTTTTAAAATATGGTTGG - Intergenic
913490211 1:119372639-119372661 ATTCCCTTTTACAAGAGGTACGG - Intronic
913997947 1:143666822-143666844 ATATCCTTTTAGGGTATGGAGGG + Intergenic
915679897 1:157571081-157571103 ATACCCTTTTAAGAGATATAGGG + Intergenic
916893710 1:169138809-169138831 ATTCCCTTTTAAAAGCTGGAAGG + Intronic
919148824 1:193669165-193669187 TTCCCCTTTTATAAGATGCAAGG + Intergenic
919499612 1:198320560-198320582 ATACCCTTTTAAAAGATATTTGG + Exonic
920586714 1:207171290-207171312 ATACCATTTTAGTAGGTGAAGGG + Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
923278805 1:232421588-232421610 AAACCCTGTTTGCAGATGGATGG + Intronic
924798079 1:247307399-247307421 ATATACTTTTAGAAGATGGATGG - Intronic
1064727481 10:18295615-18295637 ATACCATTTAAGAAAATGAAGGG + Intronic
1067035786 10:42915541-42915563 ATACCCTTCAAGAAAAAGGAAGG - Intergenic
1068253927 10:54483096-54483118 ATAGAATTTTAGAAGAAGGATGG - Intronic
1074344311 10:112667412-112667434 AGACCCTTTTAGAAGACAGTAGG - Intronic
1074827640 10:117226108-117226130 ATTCCATGTTTGAAGATGGAAGG - Intergenic
1074903704 10:117841485-117841507 ATACCCACCTTGAAGATGGATGG + Intergenic
1074932301 10:118141013-118141035 AGAACCTTGAAGAAGATGGATGG - Intergenic
1078749248 11:14144209-14144231 ATACCCTTTTAGAAGATGGAAGG - Intronic
1082711195 11:56555592-56555614 ATACCATTAAAGAAGAAGGAAGG - Intergenic
1082892303 11:58153056-58153078 ATAACATTCTAGAAGATAGAGGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085224783 11:74909885-74909907 GTACCATATTAGAAGATGCATGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085575375 11:77598208-77598230 ACACCCATGTAGAAGCTGGAAGG - Intronic
1085824453 11:79829216-79829238 ATATCATTTGAGAACATGGAGGG + Intergenic
1086171511 11:83841984-83842006 ATACCTTTTAAGAAGAAGGCTGG - Intronic
1086991148 11:93304666-93304688 ATACACTCATAGAAGATGGCTGG - Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088185848 11:107168765-107168787 ATGACCTTTTGGAACATGGATGG - Intergenic
1088389224 11:109295521-109295543 CTACATTTTTAGAAGAGGGAGGG + Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1089824001 11:121256073-121256095 ATACCATTTTAAAATATGTATGG + Intergenic
1090329075 11:125915877-125915899 ATACATTTTTGGAAGACGGAAGG - Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1094043808 12:26145527-26145549 GTACCCTGTTAGGAGATGGCAGG + Intronic
1094138237 12:27151975-27151997 AGAGCTATTTAGAAGATGGAAGG - Intergenic
1094691290 12:32771986-32772008 AGACCCTGTTAGAAAAAGGAAGG + Intergenic
1095550900 12:43438362-43438384 ATATCCTTTTAGAAGATAATTGG - Intronic
1095655057 12:44659440-44659462 TTACCTTTTTATCAGATGGATGG - Intronic
1095951758 12:47785445-47785467 ATCCCCTTTCAGAAGAAGGCTGG - Exonic
1097325830 12:58276168-58276190 ATATGCTTGGAGAAGATGGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098759660 12:74407145-74407167 ATACCCTTATATAAAATAGAAGG - Intergenic
1099330743 12:81282778-81282800 GTACCCTTTTAAAAGAGGTAAGG + Intronic
1099824988 12:87763721-87763743 ACACCCTATTAGAGGGTGGAAGG + Intergenic
1100361181 12:93881004-93881026 ATTCCTTTTTTGAAGCTGGAGGG + Intronic
1107428980 13:40321767-40321789 ATCCCATTTTAGCAGATGTATGG + Intergenic
1107935586 13:45342747-45342769 AACCCCTTTAAGAAGATGGGGGG + Intergenic
1110037422 13:70705902-70705924 GTACCCTTTTAAAATATGCAGGG + Intergenic
1110225146 13:73111788-73111810 ATAGCCTTCTAGAATATGAAGGG - Intergenic
1110598149 13:77341422-77341444 AGCCCCTTTCAGGAGATGGAAGG + Intergenic
1111500227 13:89109231-89109253 TTATCCTTTTAGAAGAAAGAGGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1117836325 14:59810265-59810287 GTACCCTCTTAGAAGATGGGAGG + Intronic
1120023669 14:79557691-79557713 ATAACCTTTTGGCTGATGGAGGG + Intronic
1120483346 14:85080428-85080450 ATAACGTTTTTGGAGATGGATGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1127411307 15:58709878-58709900 ATACCCTTTTCAAAGGAGGAGGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1130242273 15:82205724-82205746 ATATACTCTTTGAAGATGGAGGG + Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134438978 16:14286217-14286239 ATCCCCTGGGAGAAGATGGAGGG + Intergenic
1134756023 16:16668165-16668187 ACACCCTTTCAGAGGGTGGAGGG + Intergenic
1134896431 16:17891492-17891514 GTACCCTTGTAGAAAATGTAAGG + Intergenic
1134990045 16:18690999-18691021 ACACCCTTTCAGAGGGTGGAGGG - Intergenic
1138488048 16:57359274-57359296 ATAACATTTTAAAAAATGGATGG - Intronic
1140526946 16:75630941-75630963 ATAGCTTTTTAAAAGCTGGACGG + Intronic
1141362635 16:83410369-83410391 TAACATTTTTAGAAGATGGAAGG - Intronic
1144306788 17:13975810-13975832 ATACTCCTTTAGAGGATGGTTGG - Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1144584263 17:16478484-16478506 AGACTCTTTTAGAAAATGGGAGG - Intronic
1147203503 17:38820323-38820345 ATCTCCTTTTATGAGATGGATGG + Intronic
1149326829 17:55539610-55539632 CTTCCCTTTTGGAAGATTGATGG + Intergenic
1153462688 18:5353902-5353924 ATCCCATGGTAGAAGATGGAAGG + Intergenic
1154378870 18:13831920-13831942 GTACATTTTTAGAAGATGGTTGG + Intergenic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1156961227 18:43033940-43033962 ATAACCTTTTAAAAGATTGGTGG - Intronic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157331841 18:46709929-46709951 TTACCCTGTTACAAGATTGAGGG + Intronic
1162154191 19:8665460-8665482 ATACCCTGTTTGAAGAATGAGGG - Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1164829623 19:31310501-31310523 ATCTCCTTTAAGAAGGTGGAAGG - Intronic
1166208635 19:41290748-41290770 ATCCCATTTTAGAAGGTGGATGG - Intronic
925241314 2:2332211-2332233 ATACCTTTTTAAAAAATGAAAGG - Intergenic
925494195 2:4427616-4427638 ACAGCCTTTTAGAAAATGAAGGG + Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
930042427 2:47137520-47137542 AATCCCTTTCAGAAGATAGAGGG - Intronic
930557783 2:52921750-52921772 AAACCCTTGGGGAAGATGGAAGG - Intergenic
933548465 2:83743502-83743524 AGGCCCTTTTAGAAGGAGGAAGG - Intergenic
935888595 2:107650738-107650760 AATCCCTTGTAGAAAATGGAAGG + Intergenic
936689759 2:114872491-114872513 AAACCCTTTTAGTAGGTGGCAGG + Intronic
937142923 2:119617523-119617545 ATACCCTTTTTCAGGCTGGAAGG - Intronic
939106796 2:137958008-137958030 TTATCTTTTTAAAAGATGGAAGG + Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
1170346599 20:15393780-15393802 TTACCTTGTTAGAAGGTGGATGG - Intronic
1170837003 20:19893200-19893222 ATACCATTTAGGAAGATGGTTGG + Intronic
1173927579 20:46792234-46792256 ATAACCATTTAGAGGTTGGAAGG - Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177805125 21:25867842-25867864 ATCCCCTTTTGGAAGGAGGAGGG + Intergenic
1177860297 21:26444751-26444773 ATACTGTCTTTGAAGATGGAGGG + Intergenic
1177960117 21:27653820-27653842 ATATTCTTTTAGAACTTGGAGGG + Intergenic
1178176076 21:30101074-30101096 ATACCCTTTCATAAGAAGTATGG - Intergenic
1179967130 21:44813770-44813792 ATGGCCTTTTATAAGGTGGAGGG - Intronic
1181879400 22:25965900-25965922 ATACCCTGTTAGAAGGCGGTTGG + Intronic
1182391149 22:29997727-29997749 AGAGCCTTTTAGATGATGGCAGG - Intronic
949185292 3:1184074-1184096 ATACTCTCTCACAAGATGGAAGG + Intronic
950685582 3:14616419-14616441 ATGGCCTTTGGGAAGATGGATGG + Intergenic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
952952265 3:38534273-38534295 AGAGCCTTTTAGAGCATGGAAGG - Intronic
955143690 3:56294796-56294818 TCACCCTCTTGGAAGATGGATGG + Intronic
957091991 3:75740067-75740089 ATACACTTTTCGAAGATGACGGG - Intronic
957355445 3:79078686-79078708 ACACACTTTTAGAACATGTATGG + Intronic
958093434 3:88907336-88907358 AGACTCTTTTAGAAAATGCAAGG + Intergenic
959045872 3:101472912-101472934 AGAGCCTTTCAGAAGGTGGAGGG - Intronic
960476520 3:118136407-118136429 ATAATCTTTTTGTAGATGGAGGG - Intergenic
961614034 3:128164642-128164664 ATTACATTTTAGAAGATGGGAGG + Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965275978 3:166683388-166683410 GGAACCTTTAAGAAGATGGAGGG - Intergenic
965585382 3:170313334-170313356 ATACCCATTCAATAGATGGAGGG + Intergenic
965841369 3:172909401-172909423 TTACCCTTTAAGAGGATTGATGG + Intronic
967264721 3:187680359-187680381 AGACCCTCTAAAAAGATGGAAGG - Intergenic
967555841 3:190857663-190857685 ATATGCATTTATAAGATGGATGG - Intronic
969143942 4:5103538-5103560 ATTCCCTTATTGATGATGGATGG + Intronic
969371071 4:6731998-6732020 ACACCCTGTTAGAAGGTGGCAGG + Intergenic
970621902 4:17830798-17830820 AGTCCCTTTTAGCAGGTGGAGGG + Intronic
972624914 4:40787757-40787779 ATACTCTTTCAGAGAATGGAAGG + Intronic
973871849 4:55174529-55174551 ATACTGTGTTAGAAAATGGAAGG + Intergenic
974108628 4:57500186-57500208 CTAGCCTCTTAGAGGATGGATGG - Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974996997 4:69173737-69173759 ATACCCTTTTAAAATTTGTAAGG + Intronic
975009966 4:69338696-69338718 ATACCCTTTTAAAATTTGTAAGG + Intronic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
975267347 4:72386050-72386072 ATACCCATATAGATGATGGCTGG - Intronic
976837227 4:89388649-89388671 ATACTCTTTTATAAGAAGTATGG - Intergenic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
978490421 4:109305759-109305781 ATACTGGTGTAGAAGATGGAAGG + Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979780407 4:124644695-124644717 CAGCCCTTTTAGAAGATTGAGGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
982204878 4:152990135-152990157 AGACCCTTCTAGGAGATGGGTGG - Intergenic
985352352 4:189078541-189078563 ATAGTCTTTTAGAAAATTGATGG - Intergenic
989117753 5:37972254-37972276 AAACTCTTTTAGAAAATAGAGGG - Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
992169341 5:74086599-74086621 ATTGCCTTATGGAAGATGGAGGG + Intergenic
992776060 5:80090315-80090337 ATCCCCTGGTGGAAGATGGAGGG - Intergenic
995227199 5:109714196-109714218 ATATCCTTTTGCAAGAGGGAAGG + Intronic
996443765 5:123520320-123520342 ATATTCTTCCAGAAGATGGATGG - Intronic
1000044794 5:157513323-157513345 ATTCCCTTTCAGAAGATGGCTGG + Intronic
1000845432 5:166274222-166274244 ATACCATTTTTGAAAATGCATGG - Intergenic
1000881268 5:166700507-166700529 ACACTCTTTTAGAAGAGGAAAGG + Intergenic
1003625741 6:7739759-7739781 AAACACTTTCAGCAGATGGATGG - Intronic
1003713021 6:8614544-8614566 ATTCCCTTCTAGAAGGTGTAGGG - Intergenic
1003781317 6:9430321-9430343 ATACCCTTGTACAAGCTGGAAGG - Intergenic
1005196666 6:23295262-23295284 ATACTTTTTTACAAGATAGATGG - Intergenic
1005396263 6:25384998-25385020 GTACTCTTTTAGATGCTGGAGGG + Intronic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006884111 6:37366019-37366041 GAGCCCTTTTAGAAGCTGGAAGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012324327 6:97896115-97896137 TTACACCTTTAGAAGCTGGAAGG - Intergenic
1012693691 6:102351879-102351901 ATACACTCTTAGTAGATGGAAGG - Intergenic
1012856689 6:104510113-104510135 ATTTACTTTTAGAAGATGAAAGG + Intergenic
1014640323 6:123900950-123900972 ATTTTCTTTGAGAAGATGGAAGG + Intronic
1015490227 6:133816936-133816958 ATACCCTTTTTAAAAATAGAAGG + Intergenic
1018775241 6:167008836-167008858 ATACCCATTTAGAAGATTTGTGG + Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020604597 7:10320680-10320702 ATGCCCTTTTAGTATTTGGAAGG + Intergenic
1021722345 7:23516580-23516602 ATACCTTCTTGGAAGAGGGAAGG - Intronic
1021845669 7:24760026-24760048 ATCCCCTTTGAGGAAATGGAGGG + Intergenic
1021986656 7:26103661-26103683 ACAAACTTTTAGAAGATGGTAGG - Intergenic
1022297750 7:29072231-29072253 ATGCCTTTTTATCAGATGGAAGG - Intronic
1023099590 7:36702708-36702730 ATAATCTTTTTGCAGATGGAGGG + Intronic
1024694711 7:51843725-51843747 TTAACCTCTTAGAAGATGTATGG - Intergenic
1027492375 7:78845155-78845177 ATATTCTTTCAGAAAATGGAAGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028212934 7:88097487-88097509 ATTCCTTTTTTGAAGAAGGAAGG - Intronic
1030915992 7:115314189-115314211 ATAGCCTTTTAGAATTTAGAAGG - Intergenic
1031884958 7:127236692-127236714 ATACTCCTTTAGAAAAAGGAGGG - Intronic
1032307419 7:130749189-130749211 ATAATTTTGTAGAAGATGGAAGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033255461 7:139797512-139797534 ATAGTCTTTGTGAAGATGGATGG - Intronic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1036787865 8:11699725-11699747 ATAGCCTTTTTGAATAGGGAGGG - Intronic
1037501275 8:19487750-19487772 AAATCCTATTAGAAGATGGATGG - Intronic
1039268852 8:35858453-35858475 CTGGCCTTTGAGAAGATGGATGG + Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1042018573 8:64344745-64344767 ATACACTTCCAGAAAATGGAGGG + Intergenic
1044044263 8:87410876-87410898 ATAATCTTTTTGCAGATGGAGGG - Intronic
1044930071 8:97244033-97244055 ATATCCTTTGAGAAGAGGGTTGG - Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047783265 8:128127651-128127673 ATACACTTTTAGGAGACTGAAGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1051794400 9:20848523-20848545 CTAGCCTCTTGGAAGATGGAAGG + Intronic
1056006324 9:82275354-82275376 ATAGCATTTTATTAGATGGATGG + Intergenic
1057238171 9:93383118-93383140 ATAACATTTTAAAAGAAGGAGGG - Intergenic
1058821789 9:108738567-108738589 AAACTCTTTTAGAAAATAGAAGG + Intergenic
1060453246 9:123763675-123763697 ACACCAATTTAGAAGATGGGTGG + Intronic
1061758408 9:132832578-132832600 AGTCCCTTTTTGAAGCTGGAAGG + Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1188452103 X:30318139-30318161 ATACATTTTTGGAAGATAGAAGG - Intergenic
1188556951 X:31423071-31423093 ACACCCTTGTGGAAAATGGAAGG - Intronic
1190614411 X:52216087-52216109 AAACCCTTTTAAAATATGGTAGG + Intergenic
1193746925 X:85293506-85293528 TTGGCCTTTTAGAAGGTGGAAGG + Intronic
1194801334 X:98277146-98277168 ATACCCATTTACAAGAAGAAAGG + Intergenic
1194821518 X:98512443-98512465 TGACTCTTTTGGAAGATGGATGG + Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic