ID: 1078756133

View in Genome Browser
Species Human (GRCh38)
Location 11:14212147-14212169
Sequence GACAAATTTGATCTTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078756133_1078756135 -4 Left 1078756133 11:14212147-14212169 CCTTCCTTAAGATCAAATTTGTC 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1078756135 11:14212166-14212188 TGTCACACAGAATAATTAGATGG 0: 1
1: 0
2: 0
3: 22
4: 232
1078756133_1078756136 3 Left 1078756133 11:14212147-14212169 CCTTCCTTAAGATCAAATTTGTC 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG 0: 1
1: 0
2: 2
3: 7
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078756133 Original CRISPR GACAAATTTGATCTTAAGGA AGG (reversed) Intronic
902316215 1:15620815-15620837 CACAAAATGGAGCTTAAGGAAGG + Intronic
906425219 1:45706253-45706275 GATAAACTAGATCTAAAGGAAGG + Intronic
906772678 1:48499218-48499240 GACAGATTTTATCTTAATAAAGG + Intergenic
906848943 1:49226748-49226770 TAGAAATTTGAATTTAAGGAAGG - Intronic
907931004 1:59000185-59000207 GACATATCTGACCTTCAGGAAGG + Intergenic
909692997 1:78431399-78431421 GAGAAATTTGATCATAGGCATGG + Intronic
911169289 1:94754379-94754401 GAGACATTTTATCTTCAGGATGG - Intergenic
911408381 1:97470611-97470633 GAGAACTTTGATCTTTAGGAGGG + Intronic
912269225 1:108192539-108192561 GACATTTTTGAGCTTCAGGAAGG - Intronic
915097698 1:153475288-153475310 GCCAAACTTGATCTGATGGAGGG + Intergenic
919425708 1:197427675-197427697 GTAAAATTTGTTCTTAATGATGG + Exonic
1063624104 10:7673356-7673378 GACAGATTTGATCTCAGGAAGGG + Intergenic
1063974094 10:11401635-11401657 GACAAAATTGAGCTTCAGGGTGG + Intergenic
1064289958 10:14024499-14024521 GTCAAATTTGATCACAAGGCAGG + Intronic
1064544121 10:16434501-16434523 AAAAAATTGGTTCTTAAGGAGGG - Intergenic
1065883205 10:30055255-30055277 GACCAATTACATCTTAAGCATGG - Intronic
1069281155 10:66655665-66655687 GACAATTCTGATAGTAAGGAAGG + Intronic
1069603987 10:69728573-69728595 GACTAATTTGATCTTCACCAGGG - Intergenic
1069702787 10:70438891-70438913 AACAAATGTGATTTTAAGGTGGG + Intronic
1073759675 10:106616075-106616097 GACAAATATGATCATAACGATGG - Intronic
1074759941 10:116659808-116659830 GAGGAATTTGATGCTAAGGAAGG + Intergenic
1078655510 11:13235174-13235196 GAGAAATTTGTTTTTAAGGCAGG - Intergenic
1078756133 11:14212147-14212169 GACAAATTTGATCTTAAGGAAGG - Intronic
1079396564 11:20068716-20068738 GAAAATTTTGATTTTAAGGGTGG + Intronic
1079766843 11:24405170-24405192 CAAAAATTTAATTTTAAGGAAGG - Intergenic
1080998279 11:37633498-37633520 AACAAATTTGATCATATTGAGGG + Intergenic
1081554990 11:44150677-44150699 GAAAATTGTGATGTTAAGGATGG + Intronic
1086308726 11:85511646-85511668 GAAACATTTAATCTTAATGAAGG - Intronic
1088478700 11:110271326-110271348 GAATAACTTGATCTTAAAGAAGG - Intronic
1088616051 11:111629514-111629536 GACAAATTAGATTTTAAGTATGG + Intronic
1088949557 11:114553584-114553606 GACAAATGTGATCTTGATTAAGG - Intronic
1089922788 11:122226737-122226759 GAGAAATTTCATCTTCAGAAGGG - Intergenic
1090873003 11:130764457-130764479 GAGAAATTTGATGTTACCGAAGG + Intergenic
1094696533 12:32824969-32824991 GAAAAACTTAATCTAAAGGAAGG - Intronic
1099530030 12:83767132-83767154 GACAATTTAAATTTTAAGGAAGG - Intergenic
1100040933 12:90315757-90315779 TACAAATTTCTTCATAAGGAAGG - Intergenic
1100569057 12:95829187-95829209 GACATTTTTGATTTTCAGGATGG + Intergenic
1101409129 12:104454965-104454987 GACAACTTGGATCTCCAGGAAGG + Intergenic
1107037398 13:35915983-35916005 AGGAAATTTGATTTTAAGGATGG + Intronic
1108067297 13:46591349-46591371 AACAAATTAGATATTAATGAGGG - Intronic
1109335607 13:60990439-60990461 GACAAGTGTGATCTCCAGGATGG - Intergenic
1110514677 13:76396021-76396043 GACAACTTCCATCTTAAGAAAGG - Intergenic
1111119010 13:83822206-83822228 GACAAAATTGAACTTAACAATGG + Intergenic
1111454917 13:88468229-88468251 TACTAATAAGATCTTAAGGATGG - Intergenic
1112244297 13:97716279-97716301 TACAAATTTAATGTTAAGCATGG + Intergenic
1112596963 13:100816161-100816183 GACAGGTTCGATCTCAAGGACGG - Intergenic
1112829121 13:103427025-103427047 GACAATTTTGAACTTAGGCAAGG + Intergenic
1114402639 14:22423797-22423819 TACATATTTGATCTGAAGGAGGG - Intergenic
1116979787 14:51156342-51156364 GACAAAATTGAACTTAACAATGG - Intergenic
1117011256 14:51472914-51472936 GACAAATATTCTCCTAAGGAAGG - Intergenic
1126222882 15:46235297-46235319 TTCATATTTGATCGTAAGGATGG - Intergenic
1126939161 15:53746959-53746981 GGCAAAGTTGAGCTTTAGGAAGG + Intronic
1127988634 15:64094897-64094919 TACAAATTTGATCGGAGGGATGG - Intronic
1128041348 15:64576201-64576223 GATAAATTTGACCTAAAAGAAGG - Intronic
1129352308 15:74963266-74963288 GACAAAACTGATCCTAAGGGGGG - Intronic
1131306725 15:91251618-91251640 TACAAATTTTATCTTAAAAATGG - Intronic
1140616022 16:76664986-76665008 GAGGAAATTGATCTTAAGAAGGG - Intergenic
1145325755 17:21823053-21823075 GACAAATGTGATCTTGATTAAGG - Intergenic
1148575253 17:48706131-48706153 GAGAAATCTGGCCTTAAGGATGG - Intergenic
1152201113 17:78946817-78946839 GACAAACTTGAACATGAGGAAGG - Intergenic
1155567092 18:27147367-27147389 GACATTTATGATTTTAAGGAAGG + Intronic
1155982172 18:32192669-32192691 GACATATTTGATATCAATGAAGG + Exonic
1156473393 18:37391206-37391228 GACAAATATGAACTAAAGGCAGG - Intronic
1158837129 18:61342894-61342916 GAAAAACCTGATCTTAATGAAGG - Intronic
1159605509 18:70470363-70470385 GGTAAGTTTGATCTTAACGATGG + Intergenic
1159936093 18:74368764-74368786 GAAAAATGTGATTTAAAGGAAGG + Intergenic
1161753725 19:6116034-6116056 GACAAAATTGTGCATAAGGAAGG - Intronic
1164212442 19:23110998-23111020 GACAAATTTAATGTTAAGTGTGG + Intronic
1168535654 19:57167170-57167192 GACATATTTGAGCTTCAGGAAGG - Intronic
1168608255 19:57776989-57777011 AACAAATGTGAACTAAAGGAGGG - Intronic
926027017 2:9554741-9554763 GAGAGATTGGATTTTAAGGATGG - Intronic
926481492 2:13401983-13402005 GCCAAATTTTACCTTAAAGATGG - Intergenic
927330729 2:21860294-21860316 GAGAAAACTGATCTTAAAGAGGG + Intergenic
927937599 2:27084385-27084407 GACAAAATTGAGTTGAAGGAGGG - Intronic
928408262 2:31032024-31032046 GGCATATTTGTTCTTATGGAAGG + Intronic
929152415 2:38759312-38759334 GCCAAATTTGATTTTAAAAATGG + Intronic
929904241 2:46032329-46032351 GACAATGTTCATTTTAAGGAGGG + Intronic
930852918 2:55980833-55980855 GACAAAATTGAACTTAATAATGG + Intergenic
939172797 2:138715383-138715405 GACAAATTAAATCTAGAGGAAGG - Intronic
939572103 2:143852643-143852665 GTCAATTTTGATCTGGAGGATGG - Intergenic
939719223 2:145626518-145626540 AGCAAATTGGATGTTAAGGAAGG + Intergenic
941314922 2:163980554-163980576 CACAAATTTATTCTTCAGGAAGG - Intergenic
942313439 2:174677196-174677218 AACAAATTTGATCCTAAGAGTGG - Intronic
943120982 2:183734966-183734988 GACAGATTTGATGTCAAGGAAGG + Intergenic
943405718 2:187481575-187481597 GAGACATTTGATATTAAGGATGG - Intronic
946128503 2:217585795-217585817 GACAAGCTTGATCGTGAGGACGG - Intronic
948106731 2:235420606-235420628 GACATCTTTTATCTTCAGGATGG + Intergenic
1170461049 20:16576489-16576511 AATAAATGTGATCTTAAGGTAGG - Intergenic
1173022657 20:39280751-39280773 TACAATTTTGATCTTCATGAAGG + Intergenic
1174851219 20:53997020-53997042 GACACTTATGACCTTAAGGATGG - Intronic
1177565187 21:22811080-22811102 TACAATTTTGTTCATAAGGAAGG + Intergenic
1180627220 22:17201934-17201956 AAAAAATTTGATTTTAAGGAAGG - Intronic
1182433956 22:30318343-30318365 GACATATTGGATGATAAGGAAGG - Intronic
949737651 3:7192619-7192641 GACAAATCGGAACTGAAGGAAGG - Intronic
950619918 3:14196639-14196661 GACATATTTGATCTAATTGAGGG - Intronic
951164906 3:19473558-19473580 CACAAATTTACTCTTAAAGATGG - Intronic
952803684 3:37323485-37323507 GATAATTTTGATCTTCAGGTAGG + Intronic
953073069 3:39542733-39542755 GACAAATTTTCTCTTCAGCAGGG + Intergenic
953803775 3:46050527-46050549 GTAAAATTTGATCTGTAGGAGGG + Intergenic
953959244 3:47254813-47254835 TAAAAATTTCATCTTAAGGTCGG - Intronic
955452886 3:59089133-59089155 TTCAAATTTGATCTTAGGAAAGG + Intergenic
956685860 3:71826618-71826640 GACAATTTTTATGTTAAGGAAGG - Intergenic
958143895 3:89599353-89599375 AACCAAATTGGTCTTAAGGAGGG + Intergenic
959315383 3:104799397-104799419 GACCAATTTGACCTTACGCATGG + Intergenic
959444374 3:106420166-106420188 GAGAAACTTGATTTTGAGGAAGG - Intergenic
960636771 3:119792329-119792351 GACACATCTGACCTTCAGGAAGG + Intronic
963223561 3:142837481-142837503 GACATATTTGAGTTAAAGGAGGG - Intronic
966288181 3:178322324-178322346 GACAATTATGATCTAGAGGAAGG + Intergenic
968176931 3:196558621-196558643 AACAAATTTTATCTCAAGGCAGG - Intronic
970148028 4:13057422-13057444 GAAAAATAGGATCTTTAGGACGG + Intergenic
970645090 4:18110690-18110712 AACAAATTTGCTCTCAAAGAGGG + Intergenic
974553728 4:63415317-63415339 GACCTATATGATCTTTAGGATGG - Intergenic
975174743 4:71275303-71275325 GACAAAGTTGTTCTTTTGGAGGG - Intronic
977423301 4:96831314-96831336 TACAAATTTGAGTTTAAGAATGG + Intergenic
977578005 4:98695099-98695121 GACAAATTTCACCTTAACTATGG + Intergenic
980420871 4:132559186-132559208 GAAAGAGTTGATCTTAATGAAGG + Intergenic
981471694 4:145142514-145142536 AACAAATTTGATCCTAACCAAGG + Intronic
984358454 4:178696184-178696206 GATAGATTTGTTCTTAAGGTAGG + Intergenic
984781265 4:183527947-183527969 GCAAAATTTGATGTTAAGTAGGG + Intergenic
985937326 5:3106946-3106968 GACAAATTCGAGATAAAGGAGGG - Intergenic
986095863 5:4553663-4553685 GACAAATATGACTTTGAGGAAGG - Intergenic
986423848 5:7610860-7610882 GTCAAATTTGATCTAAATAAAGG + Intronic
987889754 5:23862088-23862110 GACAACTTTGATATTACAGAAGG + Intergenic
989970152 5:50513921-50513943 CACAAATCTGCTCTTAAGAATGG - Intergenic
991641239 5:68755835-68755857 GAAAACTTCGATCTTTAGGAAGG + Intergenic
992918879 5:81491676-81491698 TACAAATTTGAACTTAAAGGAGG - Intronic
993514099 5:88808074-88808096 GTCATAATTGATATTAAGGATGG + Intronic
993536379 5:89091922-89091944 TACACATTTGATTTTAAAGAAGG + Intergenic
994910098 5:105893652-105893674 AACACATTTAATCTTATGGAAGG - Intergenic
996222147 5:120947334-120947356 GACAAAATTGAGCTTAATAATGG - Intergenic
996345391 5:122482924-122482946 GACAATTTTAATCTTAGTGAAGG - Intergenic
996368798 5:122731328-122731350 AAAAAATTTGATCTTGTGGAGGG - Intergenic
997784258 5:136693431-136693453 GACAAAATTGAACTTAATAATGG - Intergenic
1001998108 5:176178272-176178294 GACAAATGTGAACTCAAGAATGG - Intergenic
1002554122 5:180020969-180020991 AAAAAATTAGATTTTAAGGAAGG - Intronic
1003728067 6:8789436-8789458 AACAAAGTTGACCTTCAGGATGG + Intergenic
1004484590 6:16054154-16054176 GATATATTTGGTCTTAAGTAGGG + Intergenic
1005498404 6:26409141-26409163 GACTAATTTGAAGTTAAGAAAGG + Intronic
1011134054 6:84080622-84080644 GACAAAATTGAACTTAAATATGG - Intronic
1012522966 6:100143041-100143063 GAGAAATTAGACCTTGAGGATGG + Intergenic
1013149836 6:107433937-107433959 GAATAATTTGATCTTAAAGTGGG + Intronic
1014331221 6:120066641-120066663 GGCAAATTTTATTTGAAGGAAGG - Intergenic
1014600658 6:123407765-123407787 GTAAAAATTAATCTTAAGGAAGG + Intronic
1015848348 6:137545962-137545984 CACAAATTTAATATTCAGGAAGG + Intergenic
1016434175 6:144018825-144018847 CACAAATTAAATCTTAATGATGG + Intronic
1020964717 7:14850495-14850517 GCCAAAATTAATCTTAAGGATGG + Intronic
1023653553 7:42396096-42396118 AATAAATTTGATTGTAAGGAAGG - Intergenic
1024145212 7:46508417-46508439 TACAAATTTGATCTCTAGGTGGG - Intergenic
1028400428 7:90419468-90419490 GCCAAATTTTATTTTAAGTATGG - Intronic
1033848801 7:145469297-145469319 GTTAAATGAGATCTTAAGGATGG + Intergenic
1036928328 8:12929006-12929028 GACAGATCTGAACTAAAGGAAGG + Intergenic
1040791392 8:51234045-51234067 TTCAAGTTTGAACTTAAGGAGGG - Intergenic
1043655334 8:82657916-82657938 GACCATTTTGAGCCTAAGGATGG + Intergenic
1046186203 8:110723300-110723322 GAGAAAATTAATCTAAAGGAAGG + Intergenic
1049581747 8:143414914-143414936 GAGGAATTTGATCTAAAGGCAGG + Intergenic
1051816879 9:21119229-21119251 GACAAATTGGATTTGAAGAATGG - Intergenic
1052864974 9:33459397-33459419 GACAGAGTGGATCTTAAGTATGG - Intergenic
1058492236 9:105515376-105515398 GCCAGATTTGATCTTTAAGATGG + Intronic
1186926795 X:14342560-14342582 CACAAAATTGATCTTAGGAAAGG + Intergenic
1188823786 X:34805244-34805266 GAAAAGTTTAATCTTAATGATGG + Intergenic
1189308455 X:40004691-40004713 GACAGGTTTTATCTTAATGAGGG + Intergenic
1191643862 X:63457458-63457480 GACATATTTGATTTTAATTAGGG - Intergenic
1191858591 X:65647583-65647605 GTGATATTTGATCTAAAGGAAGG + Intronic
1193367109 X:80648117-80648139 GAGAATTTGTATCTTAAGGAAGG + Intergenic
1194997448 X:100606750-100606772 CTGAAATTTGTTCTTAAGGATGG + Intergenic
1195307869 X:103603462-103603484 TACAAGATTTATCTTAAGGAAGG + Intergenic
1195436180 X:104846012-104846034 GACAAATTTGAACTTAATAATGG - Intronic
1195498424 X:105565344-105565366 AATAAATTTGATTTTAAGGGAGG + Intronic
1196345847 X:114657588-114657610 GACAAACTGTATCTTAAGGGAGG - Intronic
1197265123 X:124361162-124361184 GATAAATGAGATCATAAGGATGG + Intronic