ID: 1078756134

View in Genome Browser
Species Human (GRCh38)
Location 11:14212151-14212173
Sequence GTGTGACAAATTTGATCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078756134_1078756136 -1 Left 1078756134 11:14212151-14212173 CCTTAAGATCAAATTTGTCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG 0: 1
1: 0
2: 2
3: 7
4: 161
1078756134_1078756135 -8 Left 1078756134 11:14212151-14212173 CCTTAAGATCAAATTTGTCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1078756135 11:14212166-14212188 TGTCACACAGAATAATTAGATGG 0: 1
1: 0
2: 0
3: 22
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078756134 Original CRISPR GTGTGACAAATTTGATCTTA AGG (reversed) Intronic
904201545 1:28822918-28822940 GTGTGGCCAATTTGATTTTGAGG - Intronic
904566884 1:31433591-31433613 GTGTCACAAATTTGGTCATTTGG + Intronic
915950494 1:160186986-160187008 ATGTGTCAAATCTGATCTTGGGG + Intergenic
916516369 1:165521111-165521133 GTGTGACACATATGATGTTTTGG - Intergenic
919012079 1:191977498-191977520 GTGTGACAAATGTGCTGTCAAGG + Intergenic
919605145 1:199672601-199672623 ATGTGGCAAATTTAACCTTAGGG - Intergenic
922139494 1:222868802-222868824 GATTGAAAAGTTTGATCTTAGGG - Intergenic
924858659 1:247899053-247899075 GTGTGACGGATTTGATCCTGGGG - Intergenic
1063655538 10:7984866-7984888 GTGTGAGTAGTTTGATCTTTAGG - Intronic
1064452957 10:15460216-15460238 GTATGACCAACTTGTTCTTAGGG - Intergenic
1065101877 10:22339835-22339857 GTAAGACAAATCTGGTCTTAAGG - Intergenic
1067656085 10:48192657-48192679 GTGTGACACATTTGTTCTCTGGG - Intronic
1069649998 10:70039856-70039878 GTGGGCTAAATTTGTTCTTAGGG - Intergenic
1072251978 10:93588974-93588996 GAGTGACAAATTGGATCAAAAGG + Exonic
1073413658 10:103363663-103363685 TTGTCACAAATTTGATCATTAGG - Intergenic
1078756134 11:14212151-14212173 GTGTGACAAATTTGATCTTAAGG - Intronic
1081550154 11:44104118-44104140 GTATGACAAAATTGAGGTTAAGG - Intronic
1082673526 11:56066936-56066958 GTGTAACAACTTTGCTTTTAAGG + Intergenic
1095175107 12:39083023-39083045 GTTTGAATAATTTGATCTAATGG + Intergenic
1095236111 12:39797981-39798003 GTGTAACCAATTTGATATTATGG + Intronic
1097641197 12:62184416-62184438 GCGTGACATATTTAACCTTAAGG - Intronic
1098619947 12:72583384-72583406 ATGTGAGAAATGTGATCTTTTGG - Intronic
1099240650 12:80134741-80134763 ATGAGAATAATTTGATCTTAAGG - Intergenic
1099910893 12:88831911-88831933 GGGTGTCAAAATTGATCTAATGG + Intergenic
1099949505 12:89285293-89285315 GTGTGACATTTTTGATCAAAGGG - Intergenic
1102321201 12:111936019-111936041 GTGGGACACATTTGATCTGCAGG + Intronic
1104434469 12:128744752-128744774 GTGTGAAAAATTGGCTTTTAAGG + Intergenic
1107746738 13:43518339-43518361 GTATGACAAATTTGGTAGTAAGG - Intronic
1112158116 13:96839650-96839672 GTTTGACAAAGCTGATCCTACGG - Intergenic
1116182409 14:41551768-41551790 GAGTGGAAAATTTGATGTTACGG + Intergenic
1119679599 14:76582303-76582325 GTATGACAAACTTGACCTGAGGG + Intergenic
1127181563 15:56424668-56424690 GTGTCACAAATTACATCTTTAGG + Intronic
1127642930 15:60932441-60932463 CTGTTACTTATTTGATCTTAGGG - Intronic
1127882776 15:63172768-63172790 GTGTGACACTTTAGATCTCAAGG + Intergenic
1128947453 15:71838290-71838312 GTGTGACAAAAATGACCATAAGG - Intronic
1129975188 15:79815907-79815929 GTGTGACAGTTTTGAATTTAGGG - Intergenic
1131332256 15:91512603-91512625 GTGTGAAGTATTTCATCTTAAGG + Intergenic
1135409155 16:22220160-22220182 TTGTCATAAATTTGCTCTTAAGG - Intronic
1140131886 16:72169911-72169933 GTGTGCCAATTTTGTTTTTATGG - Intronic
1146848485 17:36201327-36201349 GTGTCACAGTTTTGATCTTTGGG + Intronic
1149106540 17:52974333-52974355 GAGTAAAAAATTTGAACTTATGG - Intergenic
1151060865 17:71092151-71092173 GTCTCACAAAATTGACCTTACGG - Intergenic
1161000931 19:1910448-1910470 GTGAGACAAGTTTTCTCTTAGGG + Intronic
1162266832 19:9582802-9582824 TTCTGAAAAATTTGATCCTAGGG - Intronic
1162277877 19:9672513-9672535 TTCTGAAAAATTTGATCCTAAGG - Intronic
1167191743 19:47994840-47994862 GTGTGACAAGTGGGGTCTTAGGG + Intronic
924961047 2:34969-34991 GTGTGACAAGTTTCTTCTCAGGG + Intergenic
926870462 2:17409811-17409833 GTGTATCAAAATTGATCTTCTGG - Intergenic
928748137 2:34439857-34439879 GTGTGGTTAATTTGCTCTTATGG + Intergenic
930178460 2:48325746-48325768 GTGTGACAAATGTTATCAAAAGG + Intronic
930555486 2:52889959-52889981 GTGCTAAAAATCTGATCTTATGG - Intergenic
935899726 2:107778530-107778552 GGATAACAAATTTGATCTTTTGG - Intergenic
941157944 2:162001842-162001864 GGGTGACAAATCTGAGCTAAAGG - Intronic
941253255 2:163194880-163194902 GTTTTACAAATGTGATGTTATGG + Intergenic
943771178 2:191719484-191719506 GTGTGTCCAATTTGATTCTAAGG + Intergenic
945266455 2:207895881-207895903 TTTTGACAAATATGATCTGAAGG - Intronic
1169101091 20:2950154-2950176 GTGGGACAAATTTGAACTTGTGG + Intronic
1169920556 20:10730731-10730753 GTGTCACAAATTTGATTTCTGGG + Intergenic
1171418808 20:25002932-25002954 TTGTGAGAAATTTCATCATATGG + Intergenic
1177140324 21:17351927-17351949 ATGTGACACATTTGATCATGTGG + Intergenic
1177689205 21:24482015-24482037 GTGAAAAAAATTTGAACTTAAGG + Intergenic
1178484486 21:33009689-33009711 GAGTGTCAAATTTGATAATATGG - Intergenic
1180035585 21:45246508-45246530 TGGTGACAAGTTTGAGCTTATGG + Intergenic
1183918091 22:41139564-41139586 GACTGACAAATGTGATCTTTAGG - Intronic
949217337 3:1585073-1585095 GTCTGACTAAGTTGATTTTAAGG - Intergenic
951626630 3:24672051-24672073 GTGTGCCAAATTTGATGGGATGG + Intergenic
952757303 3:36882105-36882127 GAGTGACAGATTTGGTCTTCTGG + Intronic
952780563 3:37093116-37093138 GGGTGACAAATTTTTTTTTAAGG + Intronic
952803683 3:37323481-37323503 GTATGATAATTTTGATCTTCAGG + Intronic
954703801 3:52467627-52467649 GTGTAACAATTTTGCTCTTTAGG - Intronic
959296002 3:104534898-104534920 GTGTGGCAAATTTTATCAAAAGG - Intergenic
960202283 3:114851434-114851456 ATGTGAAAAATTTGAACATAAGG - Intronic
964942961 3:162183874-162183896 ATCTAAAAAATTTGATCTTATGG + Intergenic
965020520 3:163223170-163223192 GAGAGACAAATTTTATGTTAAGG + Intergenic
970265630 4:14281154-14281176 GTGTGACAAATTTGTTAGCATGG + Intergenic
970626709 4:17893774-17893796 GTGTGACACATTTGATTCTAAGG + Intronic
976591756 4:86856118-86856140 GTATGAGTAATTTGCTCTTATGG - Intergenic
978947347 4:114515839-114515861 GGGAGCCTAATTTGATCTTAAGG - Intergenic
979878237 4:125920808-125920830 GTGTCACAACTTTGATATTAGGG - Intergenic
980442566 4:132867673-132867695 GTGGAACAAATTTTGTCTTATGG + Intergenic
980920437 4:139080830-139080852 GTGTGCCAAATTGGAACTTGAGG - Intronic
986626712 5:9729429-9729451 GTGTGTCAAATATGGTCATAAGG - Intergenic
987159193 5:15122990-15123012 GTTTGACAAAATTATTCTTAGGG + Intergenic
988523607 5:31967522-31967544 GTGTGTCAAAGATGATCTAAGGG - Intronic
989603525 5:43222233-43222255 GGGTGAGAAATACGATCTTATGG + Intronic
991163459 5:63532931-63532953 GTTAGAAAAATTTGTTCTTAAGG + Intergenic
991297953 5:65101480-65101502 GTGTGACAAAATTGTGCTGAGGG + Intergenic
991488315 5:67160692-67160714 CTGTGAGAAATTTTATGTTATGG + Intronic
991622835 5:68563620-68563642 GTGTGACCAATTGGATATTGTGG + Intergenic
991918875 5:71633641-71633663 TTGTGTCAAATTAGCTCTTAAGG - Intronic
993778416 5:92032598-92032620 GTGTTACAAATTTCATCATTGGG + Intergenic
993844848 5:92928630-92928652 ATGTTAAAAATTTGATTTTAAGG - Intergenic
994995778 5:107060988-107061010 GAGAGACAAATTTGCTCTTCTGG + Intergenic
998686814 5:144536440-144536462 ATGTGACATATTTCATTTTATGG + Intergenic
1002147002 5:177192133-177192155 GTGTTACATATTTTATCTTTTGG + Intronic
1002346460 5:178551425-178551447 GTCTTACAAATTGGTTCTTAAGG + Intronic
1003341525 6:5226158-5226180 GTGTACCAAATTTTATGTTATGG + Intronic
1004354741 6:14921250-14921272 CTGGGACAAATTTGATCTGGAGG + Intergenic
1005186584 6:23169066-23169088 TTCTGACAACTATGATCTTAAGG + Intergenic
1006650293 6:35545520-35545542 ATATGACATATGTGATCTTAAGG - Intergenic
1007188543 6:39994212-39994234 ATGTGATAAATTTTATCATATGG - Intergenic
1007901428 6:45417359-45417381 GTGTAAGAAAATTGTTCTTAAGG + Intronic
1008568387 6:52791531-52791553 GTATGACAAATTGTATGTTACGG + Intergenic
1012359484 6:98359638-98359660 GTGTGACAAATTGGAGATTCAGG + Intergenic
1014193736 6:118527442-118527464 GTGTTCCAAATTTCATCATAAGG + Intronic
1015326475 6:131929305-131929327 GTTGTACAAATTTGATCTTGTGG + Intergenic
1015375379 6:132504161-132504183 GTGTGTTAAATTAGATATTAAGG - Intronic
1018428819 6:163707585-163707607 CTGTGACAGATGTGATCTTCAGG + Intergenic
1018453211 6:163928237-163928259 GTGTGACAAATGTGGATTTAGGG - Intergenic
1031281327 7:119804458-119804480 GTGTGAGACATTTTATCTAAAGG + Intergenic
1031619177 7:123915398-123915420 GTCTGACAAATATGATGTCAGGG + Intergenic
1038944928 8:32348366-32348388 TTATGACAAATTTTATTTTATGG - Intronic
1040969733 8:53122062-53122084 GTATGACATATTTAATCTTCAGG + Intergenic
1042329754 8:67566480-67566502 GAGTGAGAAATTTGAATTTAAGG - Intronic
1043723131 8:83573255-83573277 GTGTGATAAATTAAATGTTATGG - Intergenic
1044196904 8:89388079-89388101 GTGTGAAAACTTTGAAGTTATGG - Intergenic
1050658351 9:7854356-7854378 TTGTGAAAAATTTGATCTTTTGG + Intronic
1051515795 9:17929379-17929401 GGGTGAAAAATTGGTTCTTAGGG - Intergenic
1056109110 9:83376901-83376923 GTGTGTCCAATATGATCCTAGGG + Intronic
1185956189 X:4493289-4493311 GTTTGACATATATAATCTTAAGG - Intergenic
1187221128 X:17327279-17327301 GTGTGGCAAATTAGATTTGAAGG + Intergenic
1187857741 X:23653472-23653494 CTGTGCCAAATTTGGTTTTAGGG + Intergenic
1188147533 X:26631671-26631693 GTGAGACATATTTGACCTTTGGG - Intergenic
1189370284 X:40422682-40422704 GTGTGACATTTTTGAACTTAAGG + Intergenic
1190129283 X:47732208-47732230 GTGTGACTGATTTGATCATGTGG - Intergenic
1194996559 X:100597388-100597410 GTGTAACAATTTTAATCCTAGGG - Intronic
1196093084 X:111767987-111768009 GTGTGACAACTCAGATTTTAAGG - Intergenic
1197688716 X:129474121-129474143 GTTTGACAATTTACATCTTATGG - Intronic