ID: 1078756136

View in Genome Browser
Species Human (GRCh38)
Location 11:14212173-14212195
Sequence CAGAATAATTAGATGGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078756133_1078756136 3 Left 1078756133 11:14212147-14212169 CCTTCCTTAAGATCAAATTTGTC 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG 0: 1
1: 0
2: 2
3: 7
4: 161
1078756134_1078756136 -1 Left 1078756134 11:14212151-14212173 CCTTAAGATCAAATTTGTCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG 0: 1
1: 0
2: 2
3: 7
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078756136 Original CRISPR CAGAATAATTAGATGGAGTC CGG Intronic
901625774 1:10624189-10624211 CAGATAAATTAGATGGATTGCGG + Intronic
903941177 1:26932473-26932495 CAGAAAAATTAGCTGGGGGCCGG - Intronic
907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG + Intronic
908343319 1:63205255-63205277 CTGAATAATGACATGGAGCCAGG - Intergenic
919611120 1:199747071-199747093 CAGAACAATTAGGTAGAATCAGG + Intergenic
922180954 1:223232252-223232274 CAGTATTATTAACTGGAGTCTGG - Intronic
924655235 1:245968765-245968787 CAGAATTATTAAATGGAATATGG - Intronic
1064271906 10:13872889-13872911 AAGGATAGTTAGATGGAGCCTGG + Intronic
1065940920 10:30563302-30563324 CACAATTATTGGATGGAGCCCGG + Intergenic
1068668234 10:59698248-59698270 CAGAATAATTAGATCCTTTCAGG + Intronic
1071732563 10:88263265-88263287 CAGAGAAATTATATGGTGTCTGG + Intergenic
1071990369 10:91095570-91095592 CAGAGTAATAAGATGAAGTTTGG + Intergenic
1073110323 10:101059507-101059529 CAGAATGATGAGCTGGAGTGTGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1087946553 11:104166637-104166659 CAGAATAATTGGTTGGGTTCAGG - Intergenic
1088032726 11:105271008-105271030 CAGAAAAATTAGATGACGTTGGG - Intergenic
1094079810 12:26521482-26521504 CAGATTCATTATATGCAGTCAGG + Intronic
1095355908 12:41274951-41274973 CAGTATAATTAGGTAGATTCAGG + Intronic
1099739499 12:86614409-86614431 CAGAATAATTAAAGGGATTATGG + Intronic
1102333922 12:112060692-112060714 CTAAAGAATTAGATGAAGTCAGG - Intronic
1102672369 12:114631001-114631023 CAGGATAATTAGATCTAGCCTGG - Intergenic
1105791574 13:23805445-23805467 CAAAGGAATTAGATAGAGTCTGG + Intronic
1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG + Exonic
1106602902 13:31202322-31202344 CAGAATGAGAAGATTGAGTCAGG + Intronic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1107711788 13:43157810-43157832 CAGAACACTGAGATGGAGTTAGG + Intergenic
1108645783 13:52426228-52426250 GAGAATAATTAGATGTATGCAGG - Intronic
1110303080 13:73952146-73952168 CAGAAAAGTTACTTGGAGTCAGG + Intronic
1110633322 13:77735826-77735848 AAGAAGAGTTAGATGGGGTCTGG - Intronic
1111092755 13:83468336-83468358 CAAAATAAATATATGGAGACAGG + Intergenic
1112540820 13:100310923-100310945 CATAATTATTAAATGGCGTCAGG - Intronic
1114337383 14:21705172-21705194 AAGAATAAAAAGATGTAGTCTGG + Intergenic
1116141195 14:40996237-40996259 CATAAAAATTAGATGAAGTGTGG - Intergenic
1116381857 14:44278773-44278795 CAAAATAAGTAAATGGAGGCTGG - Intergenic
1119057831 14:71441309-71441331 CAAAATATTTAGATGGGATCTGG + Intronic
1119772236 14:77227435-77227457 CAAAATGATGAGATGTAGTCAGG + Intronic
1120647315 14:87089460-87089482 GAGAATAAAAAGATGGATTCTGG - Intergenic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1122188063 14:100017062-100017084 CAGAGTAATGACATGGATTCCGG - Intronic
1122646927 14:103201052-103201074 CAGAAGAATTAGGTGGGGTGGGG - Intergenic
1122911948 14:104834427-104834449 CAAAAGAATTAAATGGAGGCTGG - Intergenic
1126824212 15:52532740-52532762 TAGAATAACTAGCTGGAGTTGGG - Intergenic
1129506050 15:76082474-76082496 CAGAGTATTATGATGGAGTCAGG + Intronic
1138224205 16:55278652-55278674 CAGAATGGTTAGAGGAAGTCTGG + Intergenic
1138339882 16:56281626-56281648 CATAATAATGAGCTGGAGTGAGG - Intronic
1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG + Intronic
1140174382 16:72641798-72641820 CAAACTAACTAAATGGAGTCAGG + Intergenic
1140601764 16:76485055-76485077 CAAAATAATTAGTTAGAGTAAGG + Intronic
1140627246 16:76808979-76809001 CAGCAAAATTAGATGAATTCTGG - Intergenic
1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG + Intergenic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG + Intronic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1158325340 18:56307833-56307855 CAAAATAATTAATTTGAGTCTGG + Intergenic
1165648439 19:37465710-37465732 CAGAATAATTGGATAGGTTCTGG + Intronic
925070430 2:962551-962573 AAAAATAATTAGATGAAGTAAGG + Intronic
928304306 2:30153870-30153892 GAGAAAAAATAGATGGAATCAGG + Intronic
928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG + Intronic
932129286 2:69173287-69173309 TAGAAATATCAGATGGAGTCAGG - Intronic
932154549 2:69404132-69404154 AAGAATAATTAATTGGAGGCCGG - Intronic
934152704 2:89163657-89163679 CACAATAATTAAATGCAGTGTGG - Intergenic
934214537 2:90018277-90018299 CACAATAATTAAATGCAGTGTGG + Intergenic
935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG + Intronic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
939028709 2:137044860-137044882 CAGAATAGTGACATGGATTCAGG - Intronic
941280231 2:163540726-163540748 CAAAACAATTAGCTGGAGTGTGG + Intergenic
942586696 2:177487567-177487589 CAAATAAATTAGAAGGAGTCAGG + Intronic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
943328995 2:186536476-186536498 CAGAAAAATGAGATGGTGACTGG + Intergenic
945345755 2:208713479-208713501 CAGAATAATTGAATTGAGTTTGG - Intronic
945611250 2:212006190-212006212 AAGAATAATTAGAAAGATTCTGG - Intronic
945752055 2:213799793-213799815 CAGAATAAATATATGGGTTCCGG + Intronic
946040293 2:216777100-216777122 CAAAAGAACTGGATGGAGTCTGG + Intergenic
1169764919 20:9138744-9138766 TAGAATAATTAGAAGGAATAAGG - Intronic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1176972453 21:15282260-15282282 CAGAATAATTTGAAGGAATTAGG - Intergenic
1177209055 21:18047169-18047191 CATAATAATTAAATGGAGAAGGG - Intronic
1177801025 21:25828906-25828928 CTGAATAATTGGTTGGAGTAGGG - Intergenic
1179327020 21:40357293-40357315 CTGAATAATTAAGTGGAGACAGG + Intronic
1179953411 21:44724207-44724229 CAGAATACTTGGAGGCAGTCTGG - Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
949502323 3:4692822-4692844 CATAAAAATAAGATGGAGGCAGG + Intronic
949725643 3:7041268-7041290 CAGGAGAATTAGAGGGAGACAGG - Intronic
951303546 3:21028489-21028511 CAGCAAAGTGAGATGGAGTCTGG + Intergenic
954217897 3:49134481-49134503 CAAAATAAATAGATGGGGCCTGG - Intergenic
960046951 3:113208391-113208413 CAAAACAGTTAGGTGGAGTCTGG - Intergenic
960514146 3:118584344-118584366 CACATTAATTAGACAGAGTCAGG - Intergenic
961680920 3:128599519-128599541 CAGAATAAATAGATACAGGCCGG + Intergenic
964181378 3:153891111-153891133 CAAAATAAGTAGATGAGGTCTGG - Intergenic
964403826 3:156327987-156328009 GAGCATAATTCCATGGAGTCAGG - Intronic
965681136 3:171252886-171252908 CAGAAAATTTAAATGGAGTAGGG + Intronic
966026745 3:175293151-175293173 CAAGATAATTAGTTGGAGTTAGG - Intronic
967765819 3:193278288-193278310 CAGACTAATTAGATGACGGCAGG - Intronic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
969218620 4:5744495-5744517 CAGAATCATTTGAGAGAGTCAGG + Intronic
969226563 4:5802340-5802362 TAGGATACTGAGATGGAGTCAGG + Intronic
970166300 4:13241752-13241774 AAGAATAAATAAATGGAGCCAGG - Intergenic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
970775187 4:19666108-19666130 CAAAATTATTAAATGCAGTCAGG + Intergenic
972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG + Intergenic
972370385 4:38418258-38418280 CAGAATATTTACATGTAGTAAGG - Intergenic
973170278 4:47134048-47134070 CAAAATGATTAGAGGGAGACTGG + Intronic
974873046 4:67667244-67667266 CAAAATAATTAGATATAGTCAGG + Intronic
976478719 4:85514143-85514165 TAGAATAGAAAGATGGAGTCTGG - Intronic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
979065672 4:116129489-116129511 CAGAATAATTTAATGGAGAGAGG - Intergenic
984135988 4:175939926-175939948 CAGAAATATTATATGTAGTCTGG - Intronic
984554790 4:181200875-181200897 CAGGATAATAAGATGCAATCGGG - Intergenic
986149311 5:5112366-5112388 CATAATAATTAAGGGGAGTCTGG - Intergenic
988055972 5:26097244-26097266 CAGAAAAGTTTGCTGGAGTCTGG - Intergenic
990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG + Exonic
992671341 5:79063979-79064001 CAGAATCATTATATGGAATGGGG - Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993110264 5:83648454-83648476 CAGAATAAATATATGTAGTTTGG + Intronic
995513523 5:112931314-112931336 CAGCATATTTTGTTGGAGTCAGG + Intergenic
995984791 5:118157005-118157027 CTGAATAAGTATCTGGAGTCAGG + Intergenic
997221093 5:132165084-132165106 CAGAATAAGTAGGTGGTGGCGGG - Intergenic
999093797 5:148959891-148959913 CAGAATCATTTGATGCAGACTGG - Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
1000844603 5:166264087-166264109 CAGTATAATTAGATTAAGTGGGG - Intergenic
1001180584 5:169516344-169516366 CAGAATAGTAAGATGGGGTCAGG + Intergenic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1004909928 6:20273127-20273149 CAGAAGAATCACATGAAGTCAGG - Intergenic
1005287125 6:24339720-24339742 CAGAGTAATTACATGGTGCCTGG + Intronic
1007955931 6:45917908-45917930 CAGAGTAATTATGTGGAGTGAGG - Intronic
1007963449 6:45982228-45982250 CAAACTGATAAGATGGAGTCAGG - Intronic
1012854080 6:104480561-104480583 AAGAAGAAATAGATGGGGTCGGG + Intergenic
1016155502 6:140802127-140802149 CAAAATAATTTGAGGGAGTGTGG + Intergenic
1017755903 6:157528935-157528957 AAGCATAATTAGATGAAGACTGG + Intronic
1019927722 7:4204450-4204472 CAAAATAAATAGTTGGTGTCAGG + Intronic
1020484307 7:8702836-8702858 CAGAAAAGTTTCATGGAGTCAGG - Intronic
1022250719 7:28605343-28605365 CACAATATCTAGATGGATTCAGG - Intronic
1022648956 7:32257578-32257600 CAGAATAATTACAAGGTGCCAGG - Intronic
1024670125 7:51586557-51586579 CAGCAAACTTAGAGGGAGTCAGG - Intergenic
1028131507 7:87181002-87181024 CAGAAAAATTAGCTGGTGGCAGG - Intronic
1028977463 7:96930016-96930038 TAGAATAAATAGAGGGAGACAGG - Intergenic
1030504070 7:110397796-110397818 CAAAATCATGAGATTGAGTCAGG + Intergenic
1032805754 7:135352664-135352686 CAGAATAATTCGATGTGGCCTGG - Intergenic
1033324358 7:140365100-140365122 GACAATAATTAGCTGGAGACAGG + Intronic
1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG + Intronic
1037873029 8:22517603-22517625 CAGAAGAAATGGATAGAGTCTGG - Intronic
1039532276 8:38273843-38273865 CAGAATTAATTGCTGGAGTCAGG + Exonic
1039839543 8:41284156-41284178 AAGAATAATAAGAAAGAGTCTGG + Intronic
1040700948 8:50064760-50064782 CAGAATTATAAGAAGGAGCCAGG - Intronic
1041405794 8:57497903-57497925 CAGAATAATTAGGAGAAATCGGG + Intergenic
1042322457 8:67491184-67491206 CAGAAGAATCAATTGGAGTCGGG + Intronic
1042346831 8:67736146-67736168 CAGGAAAGTGAGATGGAGTCAGG - Intronic
1042788724 8:72579813-72579835 CAGAATAAGAAGATAGAGTAAGG - Intronic
1046171478 8:110513610-110513632 TAGAACAATTATCTGGAGTCAGG + Intergenic
1048033901 8:130658624-130658646 CTGAATAATAGGAGGGAGTCAGG + Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1052027572 9:23590579-23590601 CAGAATATTCAGAATGAGTCTGG - Intergenic
1053400845 9:37820434-37820456 CAGAATCACTACATGAAGTCCGG + Intronic
1054830912 9:69623572-69623594 AAGAACAATTAGATCTAGTCAGG - Intronic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1055160206 9:73117462-73117484 CAAAATAACTACATGGAGACTGG + Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1186436081 X:9544154-9544176 CATAATAATTAGTAGGAGTTTGG - Intronic
1187408568 X:19026160-19026182 CTGAATCATTAGATGTAGCCAGG + Intronic
1187710948 X:22053804-22053826 CAGAACAATAAGATGAAGTAGGG + Intronic
1187799340 X:23042948-23042970 AAGAATAACTGGATGGAGTGGGG + Intergenic
1193566024 X:83078181-83078203 CAGCATAATTGGAATGAGTCAGG - Intergenic
1193607676 X:83588563-83588585 CAGCAGAATGAGATGGAGTTTGG - Intergenic
1193913045 X:87328351-87328373 CAGAAAAATCAGGTGGAGTTGGG - Intergenic
1194970764 X:100341081-100341103 CAGAATGTTTAGATGGACTTGGG - Intronic
1196614739 X:117755192-117755214 CAGAGTAATAAAATGGAGTGGGG + Intergenic
1197057500 X:122138504-122138526 CAGAACAAATTGATGAAGTCTGG + Intergenic
1201465547 Y:14276333-14276355 CAGGATAATTACATGGAACCAGG + Intergenic