ID: 1078756148

View in Genome Browser
Species Human (GRCh38)
Location 11:14212280-14212302
Sequence CAGAATATCCCCAAAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078756148_1078756149 18 Left 1078756148 11:14212280-14212302 CCTTGCTTTTTGGGGATATTCTG 0: 1
1: 0
2: 0
3: 23
4: 181
Right 1078756149 11:14212321-14212343 ACCTCCATTACTGCTTTAATAGG 0: 1
1: 0
2: 0
3: 11
4: 111
1078756148_1078756151 19 Left 1078756148 11:14212280-14212302 CCTTGCTTTTTGGGGATATTCTG 0: 1
1: 0
2: 0
3: 23
4: 181
Right 1078756151 11:14212322-14212344 CCTCCATTACTGCTTTAATAGGG 0: 1
1: 0
2: 1
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078756148 Original CRISPR CAGAATATCCCCAAAAAGCA AGG (reversed) Intronic
903027354 1:20438830-20438852 CAGATTATCCCCAAATTGAATGG - Intergenic
903413607 1:23167361-23167383 CAAAACATCCCCAAAAGGCAGGG + Intronic
906773600 1:48508069-48508091 CAAAAAATCCCCGAAATGCAAGG - Intergenic
907675647 1:56515548-56515570 CAGAATAGCTCCAGAAAGGAAGG + Intronic
911511493 1:98812112-98812134 CAGAATATCCCAGAAAAAAATGG - Intergenic
914959523 1:152194078-152194100 CTGAATTTCTCCAACAAGCAAGG - Intergenic
915446967 1:155979377-155979399 CAGCCTCTCCCCAAGAAGCAGGG + Intronic
917441621 1:175073801-175073823 CAGAAGCTCCCCACAAAGGAGGG - Intronic
917473962 1:175352327-175352349 CATTTTATCCCCAAAATGCATGG - Intronic
919566830 1:199199383-199199405 CAGAATGTCCCCAAAAGGAATGG + Intergenic
919895158 1:202005039-202005061 CAGAATATCCCCGAACAGGCAGG - Intronic
920019017 1:202939816-202939838 CACAATAGCACCGAAAAGCATGG + Intergenic
920213837 1:204348362-204348384 GAGAATACGCCCAAACAGCAAGG + Intronic
1063434311 10:6018201-6018223 GAGGACATCCCCAAAGAGCAAGG + Intronic
1064237802 10:13592495-13592517 CAGATTAACCACAAAAAGCTGGG - Intronic
1069101858 10:64332023-64332045 CAGAGTGTCCTGAAAAAGCAAGG + Intergenic
1069371423 10:67751408-67751430 CAGAGTATCACAGAAAAGCATGG + Intergenic
1070142192 10:73746618-73746640 CAGATTATCTCCTAAAAGCAAGG - Exonic
1070890999 10:79942191-79942213 CAGAGGAGCCCCAGAAAGCAAGG - Intronic
1071095481 10:81969129-81969151 CAGAAGATCCAGCAAAAGCACGG - Intronic
1071860409 10:89666641-89666663 TAGAAGACCACCAAAAAGCAAGG + Intergenic
1073283254 10:102370102-102370124 CAGAATGTCCCCAAGAGCCAGGG - Intronic
1073806376 10:107103086-107103108 GAGAATATGACCACAAAGCATGG + Intronic
1074665853 10:115723109-115723131 AAGAAGATCCCAGAAAAGCATGG + Intronic
1075884150 10:125882769-125882791 CAGAATAGCTCCAGGAAGCATGG + Intronic
1078756148 11:14212280-14212302 CAGAATATCCCCAAAAAGCAAGG - Intronic
1079491206 11:20990930-20990952 CAGAAGATACCCACAGAGCATGG - Intronic
1079991002 11:27246979-27247001 CTGAATAGTCACAAAAAGCAGGG + Intergenic
1085438510 11:76534165-76534187 CTGAATATCCACAAAAGGCAGGG - Intronic
1086992769 11:93323594-93323616 CAGAAGATCCCAAAAGAGAATGG + Intergenic
1087753910 11:102035243-102035265 CAAAATAACACAAAAAAGCAGGG - Intergenic
1091505532 12:1063798-1063820 CAGAATACCACCAAACAGCAAGG - Intronic
1091911089 12:4231172-4231194 AAGAATACCACCATAAAGCAGGG + Intergenic
1092094605 12:5831308-5831330 CAGAATATCCTTCAAAAGGAAGG + Intronic
1093534688 12:20209643-20209665 CAGTATATACCCATGAAGCAAGG - Intergenic
1094046526 12:26173444-26173466 CTGGATATCCCCAAAAAGAAAGG - Intronic
1094746054 12:33345689-33345711 CAAAATATCACCAAACAGTAGGG - Intergenic
1096333105 12:50731878-50731900 CAGAATATCTCCAAAGATAAGGG + Intronic
1096573473 12:52538358-52538380 CAGAAAATCACCAAAAGGGATGG - Intergenic
1098400947 12:70074899-70074921 CAGACTCTCCCCAGCAAGCAGGG + Intergenic
1099432962 12:82609982-82610004 TATAATATCCCCAAAATGAAAGG - Intergenic
1100988643 12:100228874-100228896 CAGAATAGGCCCCAAATGCAAGG - Intronic
1103943573 12:124513896-124513918 CAAATCATCCCCAAAATGCAGGG + Intronic
1105992066 13:25632230-25632252 CATAAAAGCCCCAAAAATCAGGG - Intronic
1106366627 13:29087696-29087718 CAAAACAACCCCAAAAATCATGG - Intronic
1112183823 13:97109829-97109851 CAGAGGAGCCCTAAAAAGCAAGG - Intergenic
1113947337 13:114051585-114051607 CAGTATTGCCCCAAAAACCAGGG + Intronic
1117325529 14:54665752-54665774 CAGAAAATCCTCAGAAATCAGGG - Intronic
1117564566 14:56979713-56979735 CAGTATCTCCTCAAACAGCAGGG + Intergenic
1121674426 14:95740968-95740990 CAGAATCACCCCAAGAACCAGGG + Intergenic
1124628006 15:31320619-31320641 CATGATGTCCCCAAAAGGCAAGG - Intergenic
1127528685 15:59820061-59820083 CAGAAGCTCCCCAGAAAGAAAGG - Intergenic
1127707093 15:61557963-61557985 CAGAATAGCTCCTTAAAGCAAGG + Intergenic
1134756968 16:16675678-16675700 CAGAATATCCAAAAATAACAGGG - Intergenic
1134989100 16:18683485-18683507 CAGAATATCCAAAAATAACAGGG + Intergenic
1136093212 16:27935426-27935448 CTTAATATCCCCAAAATGCAAGG - Intronic
1137577452 16:49610165-49610187 CAGAATCACCCTAAAAAGAATGG + Intronic
1137906941 16:52332785-52332807 CAAAATATACCCAGAAAGTATGG + Intergenic
1138134043 16:54506400-54506422 CACAAAATCTCCAACAAGCAAGG - Intergenic
1138187473 16:54987465-54987487 CAGAAGAACCCCAAAAGGCCTGG + Intergenic
1139079489 16:63498319-63498341 CTGAATTTCCCCATAAAGCCAGG + Intergenic
1139763772 16:69209298-69209320 CAAAATCTTCCCAAACAGCATGG - Intronic
1140314356 16:73880191-73880213 CAGATTTGCCCCAAAAAGCAAGG + Intergenic
1144252617 17:13434716-13434738 GAGTTTATCCCCAAAATGCAAGG - Intergenic
1144393805 17:14823134-14823156 CAGACTACATCCAAAAAGCAGGG - Intergenic
1144723609 17:17489297-17489319 CTGAAAACCCCCAAATAGCAAGG - Intronic
1145201435 17:20948781-20948803 CAGAATATACCTAAGAAACATGG - Intergenic
1145966762 17:28924503-28924525 CAGAGAATCACCAAAAAGCATGG + Intronic
1146554491 17:33812094-33812116 CACAATATCCACAATTAGCATGG - Intronic
1146768808 17:35549259-35549281 CTGGATAACCCCAAAGAGCAAGG - Intronic
1149467544 17:56891735-56891757 CAGAAAATACCCAGAAAGCCGGG + Exonic
1152617577 17:81345077-81345099 CAGAATACCCCCAAAGCCCATGG + Intergenic
1153109416 18:1566355-1566377 CAGGTTTTCCCCAAAAAACATGG + Intergenic
1157943956 18:51958036-51958058 CAGTATATCCCCCAAAATAATGG - Intergenic
1158398545 18:57099059-57099081 CAGAATATACCCAAAGAGTCTGG - Intergenic
1158943117 18:62424665-62424687 CAGATTCTCCCCAAAGAACATGG + Intergenic
1160359482 18:78260041-78260063 AAACATATCCCCAAAAAGTAAGG + Intergenic
1164090640 19:21948566-21948588 CAGAAAATGCCCAATAAACATGG + Intronic
1164695806 19:30242557-30242579 CAGGAAATCTCCACAAAGCAGGG + Intronic
1165579328 19:36848790-36848812 CAAAAAACCCCCAAAAAACAAGG - Intronic
926660173 2:15456912-15456934 CAGAGTATAGGCAAAAAGCAAGG + Intronic
929439312 2:41952841-41952863 GAGAAGATACCCAAAGAGCAGGG + Intronic
932523518 2:72439387-72439409 AAGAAAATCTCCAAAAAGCATGG - Intronic
932871895 2:75409450-75409472 CAGAGTTTCCCAAAAGAGCAAGG - Intergenic
933278287 2:80305018-80305040 GAATATATCCCCAAAAGGCAAGG - Intronic
934526107 2:95052703-95052725 CAGCAAGTCCCCAGAAAGCAGGG + Intronic
938820504 2:134953678-134953700 AAGAATATACTCATAAAGCAGGG + Exonic
939220322 2:139293425-139293447 CTGAATATGCGCAAACAGCATGG - Intergenic
941172348 2:162154735-162154757 CACAATAACCCCACAATGCATGG - Intergenic
945493079 2:210478498-210478520 CAGAATATACCCCACAAACACGG - Intronic
945926532 2:215811245-215811267 CTGAATATCAACAAAAATCAGGG - Intergenic
947347675 2:229210008-229210030 CAAAATATCTCCCAAGAGCAAGG + Intronic
947361986 2:229355006-229355028 CACAATCACCCCTAAAAGCAAGG + Intergenic
947690152 2:232127910-232127932 AAGAATAATCCCAAAAAGAAGGG - Intronic
1171498047 20:25571176-25571198 CAAAATATCCAGAAAAAGGAAGG + Intronic
1175508387 20:59503798-59503820 CAGCATACCCCCAAGAAGCATGG - Intergenic
1176113291 20:63420345-63420367 AAGAATCTCCCCAAAAACCCTGG + Intronic
1176726027 21:10433312-10433334 GTGAATATCACCATAAAGCAAGG + Intergenic
1177806034 21:25875560-25875582 CTGATTCTCCCCAACAAGCATGG - Intergenic
1178118351 21:29440929-29440951 AAGAATATCCCTAAACAGAAAGG - Intronic
1180288345 22:10773801-10773823 GTGAATATCACCATAAAGCAAGG - Intergenic
1182586117 22:31345249-31345271 CAGAATGTCCCCAAATACCTTGG + Exonic
1184545761 22:45166089-45166111 CAGTATATAACCAAAACGCAGGG - Intronic
951907095 3:27716178-27716200 CAGAATATTCCCAAATATCATGG + Intronic
953548966 3:43885806-43885828 AAGAATATACCCAGAAAGCTGGG + Intergenic
953917559 3:46930426-46930448 CAGAAAGCCCCAAAAAAGCATGG - Intronic
959552852 3:107683005-107683027 GAGAATAACACCAAAATGCATGG + Intronic
961072933 3:123953202-123953224 CTGTATATACCAAAAAAGCAAGG + Intronic
963402239 3:144814056-144814078 CAGAATATGACCAGAAAGTAAGG - Intergenic
964697312 3:159524213-159524235 CAGAATATCTGCCAAGAGCATGG - Intronic
964995732 3:162877960-162877982 CACAATATGACCCAAAAGCAGGG + Intergenic
965872865 3:173281394-173281416 AAGAATATCCCCCAAAATTAAGG + Intergenic
968417220 4:450639-450661 TAAAATATCCCAAAAAAGCCGGG + Intronic
970866700 4:20767277-20767299 CAGAATTTACCCTAAAAGAAAGG + Intronic
973087496 4:46084057-46084079 CAAAATATCAACAAAAAGAAAGG + Intronic
973731902 4:53831003-53831025 CAAAATATTTCCTAAAAGCATGG - Intronic
974054698 4:56973869-56973891 CTTAATGTCCTCAAAAAGCATGG - Exonic
974063700 4:57057647-57057669 GAGAACATACCCAAAAAGCAAGG - Intronic
976584473 4:86779643-86779665 CTGACTAGCCCCAAAATGCAAGG - Intronic
976886505 4:89991268-89991290 GAGAAAAGCCCCAAATAGCATGG - Intergenic
977188373 4:93969525-93969547 CAGAATATCATAAAAAAGAATGG - Intergenic
978027981 4:103901442-103901464 CAAAATATACCAAAACAGCATGG + Intergenic
979280821 4:118865718-118865740 AAGAATAACCTGAAAAAGCACGG + Intronic
980755249 4:137150000-137150022 GAGAATATCCTGAAAGAGCATGG + Intergenic
980994880 4:139770640-139770662 GGGAAGATCCCAAAAAAGCAGGG - Intronic
983097102 4:163575590-163575612 GAAAATATCCCCAAAAATCGAGG - Intronic
983494873 4:168431231-168431253 CAGAAAATTCCCAGGAAGCAAGG + Intronic
984427679 4:179608743-179608765 CAAAAAATCCCCAAAATTCAGGG - Intergenic
984907020 4:184637893-184637915 CAGAATATTCCAAAAAGACACGG + Intronic
985060889 4:186077332-186077354 CAGAATATCCCCTAAGAACATGG + Intronic
985301227 4:188492110-188492132 CAGAACTTCCTCAAAAGGCAAGG + Intergenic
985496556 5:210244-210266 TAGACTTTCCACAAAAAGCATGG + Intronic
989764122 5:45059195-45059217 CAGAATATCCCAAAAGAGCTGGG - Intergenic
993625130 5:90214912-90214934 TAGAATTTCCCCCAAAATCAAGG + Intergenic
994248182 5:97505427-97505449 CAGTAGATCCCCAAAAGGCTTGG - Intergenic
998897974 5:146820589-146820611 GAAAATATCCCCAAACAGCATGG - Intronic
999486200 5:151998797-151998819 AAGTATAACCCCAAAGAGCAAGG - Intergenic
1002576019 5:180174170-180174192 GAAAATAACTCCAAAAAGCAAGG + Intronic
1004164393 6:13243102-13243124 TAAAATATCCCCCAAAAGAATGG + Intronic
1004728057 6:18330195-18330217 CATAATTTCCTTAAAAAGCAAGG + Intergenic
1005199784 6:23330967-23330989 CATCATCTCCCCAAAAGGCATGG - Intergenic
1005572676 6:27160653-27160675 AAGAATAGCCCCAAAAGTCAGGG + Intergenic
1005988336 6:30888343-30888365 CAAAATATCCCCATAAACAACGG - Intronic
1006573828 6:35028176-35028198 CAGAACTTCCCCCAAAAGCATGG + Intronic
1007397296 6:41585194-41585216 CAGGAGATCCACCAAAAGCAGGG + Intronic
1007713209 6:43838003-43838025 CAGACTATCCTCAAAAAGTTCGG - Intergenic
1008130920 6:47719652-47719674 CACAGTATCCCCCAAAGGCAGGG - Intronic
1009042746 6:58199700-58199722 GAGAATATTCCCAAATAGTAAGG + Intergenic
1009616740 6:66018367-66018389 TAGAATCTCTCCAAAAAGTAAGG - Intergenic
1011844719 6:91549449-91549471 CTGAATATCCACAACAAGAAAGG - Intergenic
1015106090 6:129538932-129538954 TAGAATTTCTCCAGAAAGCAAGG + Intergenic
1015804524 6:137095098-137095120 CAGATTCTCCCCAAACAGGAAGG - Intergenic
1017157110 6:151332375-151332397 CTGAATATACCCAAGAAGGAGGG - Intronic
1018732952 6:166666765-166666787 GAGTATATACCCAAAAAGAATGG + Intronic
1021076463 7:16310307-16310329 CAGAGATCCCCCAAAAAGCAAGG + Intronic
1021285040 7:18770542-18770564 CAGAAAAACCCACAAAAGCAAGG + Intronic
1021876325 7:25053022-25053044 GGGAAAATCCCCAAAAAGGAAGG - Intergenic
1024002766 7:45201934-45201956 CAGCATGTCCCCAATAAGCCAGG - Intergenic
1025535189 7:61938881-61938903 GAGAATATCCCCAGATAGGAAGG + Intergenic
1026145912 7:67746645-67746667 CATAATCTCCACAACAAGCATGG + Intergenic
1029643939 7:101839498-101839520 AAAAATATCTCCACAAAGCACGG - Intronic
1029887827 7:103891538-103891560 CAGAAATTCGCCAAAAAGCTGGG - Intronic
1030186178 7:106764294-106764316 CATGACATCCCCAAATAGCAGGG + Intergenic
1030352350 7:108504054-108504076 AAGAATATGCCCAAAAATCAGGG + Intronic
1031007394 7:116488992-116489014 GAGAATTTCCCCCAAAAGCATGG - Intronic
1031770095 7:125831646-125831668 CAGAACATCCCAAAACAGCATGG - Intergenic
1031995110 7:128225514-128225536 CAGGATATCTCCAAAACCCAAGG - Intergenic
1032719768 7:134541267-134541289 CAGAATATCACAGAAAAGCATGG + Exonic
1032724662 7:134579727-134579749 AAGAATATCACAGAAAAGCATGG + Exonic
1036107512 8:5856650-5856672 CAGAAGAACCTCAAAAAGGAAGG - Intergenic
1037525001 8:19716069-19716091 CAGTTTATCCCCAGAAACCAAGG + Intronic
1039529012 8:38243076-38243098 CAGAATATACCCAAATCACAGGG - Intronic
1040979832 8:53234979-53235001 CAGCACATCCCCAAAAGGCCAGG + Exonic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042267738 8:66925847-66925869 CAGAATATGCCCTAAAAGGCCGG + Intergenic
1042629793 8:70804251-70804273 CAGGAAATACCCAAACAGCAGGG - Intergenic
1044748136 8:95390916-95390938 CAGAATTTTCCCACAAACCATGG - Intergenic
1045018253 8:98018279-98018301 GAGAAATTCCCGAAAAAGCAAGG - Intronic
1045943077 8:107761559-107761581 CAGAATACAGCCAAAGAGCAAGG - Intergenic
1046233104 8:111383698-111383720 CAGTAGATCCAGAAAAAGCATGG - Intergenic
1047474559 8:125214259-125214281 CAGAATATACACAAACAGTAAGG + Intronic
1049080420 8:140438642-140438664 AAGAAATTCCCCAAAAAGAAGGG - Intronic
1052972400 9:34385114-34385136 GACAAGAACCCCAAAAAGCAGGG + Intronic
1053103402 9:35390383-35390405 CAGAAGATGCCCAGAAGGCAGGG - Intronic
1056931955 9:90886211-90886233 CTCAATATCACCAAACAGCAGGG + Intronic
1057407395 9:94785536-94785558 CAGAATCTGCCCAGAAAGAAGGG + Intronic
1057707001 9:97401976-97401998 CAGCATGTCCCTAAAAAGCTGGG + Intergenic
1057745708 9:97749231-97749253 GATAATATCCCTAAAAGGCAGGG + Intergenic
1061356489 9:130109465-130109487 AAGAATATCCCCAAAGAGGCTGG - Intronic
1061648190 9:132023662-132023684 CTGTATATCCCCAGTAAGCAGGG - Intronic
1187093776 X:16125049-16125071 CACAATAAGCCCCAAAAGCATGG - Intronic
1190216962 X:48485980-48486002 CAGAATTTTCCCTAAAGGCAGGG + Exonic
1190412927 X:50154827-50154849 CAAAATAACAACAAAAAGCAGGG - Intergenic
1192017642 X:67348824-67348846 CATAATGTCCACAAAAAGAAAGG - Intergenic
1193186114 X:78514695-78514717 CTAAATTTCCCCAAAAAGAAAGG - Intergenic
1193405133 X:81091527-81091549 CAGAATATCAACAAAAAAAATGG + Intergenic
1193770121 X:85578226-85578248 AAGAAAACCCCCAAAAAGCAGGG + Intergenic
1194217217 X:91145710-91145732 CAGAATATCCAGAAACAGCCCGG - Intergenic
1195093286 X:101484010-101484032 CAGAATAATCCCAAAACTCAGGG - Intronic
1195108076 X:101619401-101619423 CAGAATAATCCCAAAACTCAGGG + Intergenic
1195793637 X:108619508-108619530 CTGATTTTCCCCCAAAAGCAAGG - Intronic
1196895733 X:120333879-120333901 CAGAATGTCCCTGAAAAGAATGG + Intergenic
1199807526 X:151315155-151315177 TAGGATTTCCCCAAAAAGAAGGG + Intergenic
1201396618 Y:13555338-13555360 CAGAAAATGCCCAATAGGCATGG + Intergenic
1201401427 Y:13608219-13608241 CAGAATAACCTAAAAAAGGAAGG + Intergenic