ID: 1078758884

View in Genome Browser
Species Human (GRCh38)
Location 11:14235858-14235880
Sequence CTCTCTCCTTTGTTTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 0, 2: 9, 3: 58, 4: 617}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078758884_1078758888 9 Left 1078758884 11:14235858-14235880 CCTGGAGGAAACAAAGGAGAGAG 0: 1
1: 0
2: 9
3: 58
4: 617
Right 1078758888 11:14235890-14235912 ATCTGGGAGAACAGCATTCCAGG 0: 1
1: 5
2: 62
3: 208
4: 689
1078758884_1078758889 15 Left 1078758884 11:14235858-14235880 CCTGGAGGAAACAAAGGAGAGAG 0: 1
1: 0
2: 9
3: 58
4: 617
Right 1078758889 11:14235896-14235918 GAGAACAGCATTCCAGGCACAGG 0: 1
1: 1
2: 38
3: 269
4: 1017
1078758884_1078758887 -7 Left 1078758884 11:14235858-14235880 CCTGGAGGAAACAAAGGAGAGAG 0: 1
1: 0
2: 9
3: 58
4: 617
Right 1078758887 11:14235874-14235896 GAGAGAGTGCTCTGGTATCTGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1078758884_1078758886 -8 Left 1078758884 11:14235858-14235880 CCTGGAGGAAACAAAGGAGAGAG 0: 1
1: 0
2: 9
3: 58
4: 617
Right 1078758886 11:14235873-14235895 GGAGAGAGTGCTCTGGTATCTGG 0: 1
1: 0
2: 0
3: 12
4: 198
1078758884_1078758890 16 Left 1078758884 11:14235858-14235880 CCTGGAGGAAACAAAGGAGAGAG 0: 1
1: 0
2: 9
3: 58
4: 617
Right 1078758890 11:14235897-14235919 AGAACAGCATTCCAGGCACAGGG 0: 1
1: 2
2: 48
3: 353
4: 1899

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078758884 Original CRISPR CTCTCTCCTTTGTTTCCTCC AGG (reversed) Intronic
900161551 1:1226526-1226548 CTGTCTCCTCTGTCTCCTCTGGG - Intronic
901137219 1:7005754-7005776 TTCTCTTCTTTGTGTCCTTCTGG - Intronic
901155851 1:7137723-7137745 CTCCCTCCCTCGTTTCCTTCAGG + Intronic
901179055 1:7327435-7327457 GTCTCCCATTTCTTTCCTCCTGG - Intronic
901198623 1:7454178-7454200 CTCTCTCCTCAGCTTCCTCAAGG - Intronic
901598543 1:10404257-10404279 CACGCTTCTTTGTTCCCTCCTGG - Exonic
902389018 1:16092015-16092037 TTCTCTGCCTTGTTTGCTCCCGG + Intergenic
904536039 1:31200119-31200141 CTCTCTCCTGTCTTTCTTCCAGG + Intronic
904848643 1:33440278-33440300 CTCTGTTCTTTCTGTCCTCCTGG + Intergenic
904863260 1:33556557-33556579 CTCTCCCCTCTGTTTCCTAAAGG - Intronic
905477373 1:38238524-38238546 CTGTCTCCTTCATTTCCTTCAGG + Intergenic
906699676 1:47848836-47848858 CTCTCCCTTTTCTTTTCTCCTGG - Intronic
906976527 1:50579755-50579777 CTCTCCCCATTTTTTCCTCCTGG - Intronic
907327966 1:53653158-53653180 CTTTCTCCTTTGCTTCGTTCAGG - Intronic
907671448 1:56477854-56477876 ATCTCTGCTTTCTCTCCTCCAGG + Intergenic
907742416 1:57179975-57179997 TTCTTTCCTTTTTTTCATCCCGG - Intronic
907801099 1:57766554-57766576 CTTTCTCCTTCATTTCCTTCGGG + Intronic
908339245 1:63159506-63159528 CTCTGTCCTTTGTTTCATTAAGG - Intergenic
908925084 1:69244359-69244381 CTCTCTCCTTTCTTTGCCCTTGG + Intergenic
909523157 1:76592560-76592582 TTCTCTTCTCTGTTTTCTCCTGG - Intronic
909726462 1:78841671-78841693 CACTCTCCTTTGTATCTTGCAGG + Intergenic
910466430 1:87505242-87505264 CTCTCTTCTTTGTCCACTCCAGG + Intergenic
910539214 1:88335928-88335950 CTCACTCTTTTGTTTCCATCAGG - Intergenic
910666697 1:89732976-89732998 CTGTCTTCTTGGTTTCCTACTGG - Intronic
910937868 1:92500989-92501011 TTCACTCCTATGTTTCCTCTAGG - Intergenic
911481545 1:98448533-98448555 CTTTCTTCTTTCTTTCCACCAGG + Intergenic
911645043 1:100328796-100328818 CCCGTTCCTTTGTTTCCTGCAGG + Intergenic
912240614 1:107904001-107904023 CTCTGTCCTTGGCTTCTTCCTGG + Intronic
912692726 1:111816367-111816389 CAGACTCCCTTGTTTCCTCCAGG + Intronic
913094835 1:115506702-115506724 CACTCACCTTGGGTTCCTCCTGG + Intergenic
915236928 1:154490650-154490672 CTCTCTCCTTTGTGGCCTTCTGG - Intronic
916470429 1:165117906-165117928 CTTTCTCCTGGCTTTCCTCCTGG + Intergenic
916522525 1:165577788-165577810 CTTTCTCCTTTGTGTCCTCTGGG + Intergenic
916533932 1:165685480-165685502 CTCCCTCCATTTTTTCCTTCTGG - Intronic
916885107 1:169059863-169059885 GTCTCTCCTTTGTGTGCCCCTGG - Intergenic
917417618 1:174827038-174827060 CTCTCTTCTTGGTTTCCACATGG + Intronic
917501776 1:175592277-175592299 CTCTCTTCTTAGGCTCCTCCAGG + Intronic
918072341 1:181142184-181142206 CTGTTTCTTTTGTTTTCTCCAGG + Intergenic
919794730 1:201314580-201314602 TGGTCTCCTTTGTTTCCTCTGGG - Intronic
919866415 1:201786444-201786466 GCCTCTCCTTGGTCTCCTCCTGG - Exonic
920254176 1:204643146-204643168 TTATTTCCTTTGTTTTCTCCAGG + Intronic
920577382 1:207071488-207071510 CTCTTTCCTCTGTTTTCTCAGGG + Exonic
920686391 1:208112183-208112205 CTCTCCCCTTTGACTCCTGCAGG - Intronic
920928078 1:210361626-210361648 CTCTCTCCTGGGTTTCCTTCTGG + Intronic
922112057 1:222569298-222569320 CTCTCTCCTCAGTCTCATCCGGG + Intronic
922831562 1:228557052-228557074 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922832039 1:228609034-228609056 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922832600 1:228611275-228611297 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922833160 1:228613516-228613538 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922833721 1:228615757-228615779 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922834280 1:228617998-228618020 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922834840 1:228620229-228620251 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922835389 1:228622432-228622454 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922835948 1:228624674-228624696 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922836507 1:228626914-228626936 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922837065 1:228629155-228629177 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922837624 1:228631397-228631419 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922838183 1:228633638-228633660 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922838742 1:228635863-228635885 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922839300 1:228638103-228638125 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922839861 1:228640334-228640356 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922840422 1:228642575-228642597 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922840984 1:228644806-228644828 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922955424 1:229595169-229595191 TTCTCTACTTTTTTTTCTCCTGG - Intronic
923407334 1:233675431-233675453 CTCTCTCCTTTATTTTCTGTGGG - Intergenic
923785502 1:237064451-237064473 CTCTTTCCTTTTCTTCCTCTTGG + Intronic
923988895 1:239412338-239412360 CTCCCTCCCTCTTTTCCTCCAGG + Intronic
923997349 1:239510376-239510398 CTGTCTCCTCTTTTTCCTCTTGG + Intronic
924599935 1:245479816-245479838 CTCTCCCCTTGGTCTTCTCCAGG - Intronic
924699613 1:246438484-246438506 TTCCCTCCCTTGTATCCTCCAGG + Intronic
1062797840 10:357960-357982 ATTTCTCTTTTGTTTCCTCATGG - Intronic
1063265966 10:4451184-4451206 CTGTTTCCTTTTTTTCCTCCAGG + Intergenic
1064325323 10:14345475-14345497 TTGTCTCCTTAGTTTCCTCTTGG - Intronic
1064815741 10:19259759-19259781 CTCTCTCCCTTACTTCCTTCTGG + Intronic
1064873546 10:19966864-19966886 CTCTCCCCAGTGTTTCCCCCTGG - Intronic
1065283507 10:24164816-24164838 CTCTCTTCTTCTTTTCTTCCTGG - Intronic
1065874071 10:29982020-29982042 CTTTGTCATTTGTTTCCTCTAGG + Intergenic
1065875440 10:29993617-29993639 TTCTCTCCTTTGTTTCATCCTGG - Intergenic
1068688369 10:59891928-59891950 CTCTTTTCTTTGTTGCCTCTGGG - Intronic
1068779318 10:60902636-60902658 CTCTCTCCTTTTTCTCCTGGGGG + Intronic
1069866944 10:71510060-71510082 CTCTCTCCCTTGGCTACTCCAGG + Intronic
1070716752 10:78728016-78728038 CTCTCTCTTTTTTTTGTTCCAGG - Intergenic
1071187079 10:83058347-83058369 CTCTACCCTCTGTTTCCTCTGGG + Intergenic
1071556163 10:86603648-86603670 CTCTCTGCTTTTTTACCTCAGGG + Intergenic
1071935693 10:90527474-90527496 TTTTCTCTTTTTTTTCCTCCTGG - Intergenic
1072798180 10:98372644-98372666 ATCTTTCCTGTGGTTCCTCCAGG + Intergenic
1073085061 10:100883046-100883068 GTCTCGCCTTTGTCACCTCCTGG - Intergenic
1073144337 10:101270533-101270555 CACTATCCTTTGCTTCCACCAGG - Intergenic
1073249126 10:102111144-102111166 CTCTCTCCTTCACTTCCTCCAGG - Exonic
1076432564 10:130416217-130416239 CTCCCTCCTCTGTGTACTCCTGG + Intergenic
1076576706 10:131474354-131474376 CGCTCTCCTTTGTTTCCTGCTGG - Intergenic
1078072270 11:8123260-8123282 GTCTCTCTTTTATTTCCTTCTGG - Intronic
1078418495 11:11186436-11186458 CTTTCTCCTTTGTAGCCTTCCGG - Intergenic
1078667293 11:13336615-13336637 CTCTCTCCTGGGGATCCTCCTGG - Intronic
1078758884 11:14235858-14235880 CTCTCTCCTTTGTTTCCTCCAGG - Intronic
1078952374 11:16148710-16148732 CTCTCTCCTTACTTTTTTCCAGG + Intronic
1079418608 11:20264424-20264446 CTCTGTCCTTTGTTTCCCCGGGG + Intergenic
1080023654 11:27591328-27591350 CACTCTCAGTTGTTCCCTCCTGG + Intergenic
1080116170 11:28623760-28623782 ATCTGTCCATTGTTTTCTCCAGG + Intergenic
1080895525 11:36446278-36446300 CTCTCTCCTCTGTCCCCTCTAGG + Exonic
1081052997 11:38368902-38368924 ATCTCTCCAATGTTTCCTTCGGG - Intergenic
1081417684 11:42835478-42835500 CTCCCTCCTTTATCTCCTTCAGG - Intergenic
1081840974 11:46201190-46201212 CTCTCTTCTTGCTTTTCTCCAGG + Intergenic
1083154221 11:60812705-60812727 CCCTCTCCTTTTTTTCAGCCAGG - Intergenic
1084667867 11:70586211-70586233 CTCTCTCCCTTGCTGACTCCTGG - Intronic
1084682150 11:70672668-70672690 CTCTCTGCTTTGCTTTCTTCTGG + Intronic
1084887829 11:72222617-72222639 CTGGCACCTTTGTCTCCTCCTGG + Intergenic
1084962085 11:72722137-72722159 CTCTCTCTGTCCTTTCCTCCTGG - Intronic
1085020046 11:73200874-73200896 CTCTCTCCTCCTTTTCCTCCAGG + Intergenic
1085843157 11:80036994-80037016 CTCTCTCCCTTATTTCCTGCCGG - Intergenic
1086120592 11:83301050-83301072 CTCTGCCCTTTTTATCCTCCAGG + Intergenic
1087016009 11:93555301-93555323 CTCACTCCTTTGTGTCAGCCAGG + Intergenic
1087138952 11:94747046-94747068 CTATCTCCTATGTTTATTCCTGG + Intronic
1087284486 11:96250079-96250101 CTCGCTCCTTTACTTCCTGCAGG + Intronic
1088130289 11:106480644-106480666 TTCTCTCTTTTATTTACTCCTGG - Intergenic
1088367974 11:109058766-109058788 CTTTCCCCTTTCTTCCCTCCAGG + Intergenic
1088436805 11:109822734-109822756 CTGACTACTTTGTTTGCTCCAGG - Intergenic
1088851653 11:113708116-113708138 CCCTCTTCTTTGTATCCTCAGGG - Intergenic
1089339444 11:117747582-117747604 CTCTCTCCTTTGTGTCACTCAGG - Intronic
1090004001 11:122984342-122984364 CTCTTTTCTTAGATTCCTCCTGG - Intergenic
1090040229 11:123284194-123284216 CTCTCTCTTTCCTTTCCTCCTGG + Intergenic
1090113163 11:123938421-123938443 CCTTCTCCTATGTTTCCTCCGGG + Intergenic
1090145035 11:124312430-124312452 AGCTCTGCTGTGTTTCCTCCTGG - Intergenic
1090754202 11:129774305-129774327 TTCTCTCCTTTTTTTTCCCCTGG - Intergenic
1091294463 11:134463860-134463882 CTTTCTCCTTTCTTTTATCCAGG + Intergenic
1091386568 12:99765-99787 CTTTCTCCTCTGTTTTTTCCTGG + Intronic
1091959566 12:4681394-4681416 ATCTATCTTTTCTTTCCTCCTGG - Intronic
1092033058 12:5305880-5305902 CTCTCTCTTATTTGTCCTCCTGG - Intergenic
1092037741 12:5353710-5353732 CTCTTTTCTTTCTTTCTTCCTGG - Intergenic
1092123328 12:6059255-6059277 TTCTCTGCTTTATTTCCCCCAGG + Intronic
1093423353 12:18999857-18999879 CTCTCTCCTTAGATTCCACTTGG - Intergenic
1093763967 12:22941521-22941543 CTCTCTCTCTTGTCTCCTTCTGG + Intergenic
1094216139 12:27944741-27944763 CTCTTTCCCTTGCTTCCTTCAGG + Intergenic
1096578865 12:52571645-52571667 CTCTGGGCTTTGTTTTCTCCAGG - Intronic
1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG + Exonic
1097356977 12:58612864-58612886 CTCTATCCTTTGTTTTCTTCAGG + Intronic
1097461370 12:59867322-59867344 TTTTCTCCTTTGCTTCTTCCTGG + Intergenic
1098205544 12:68105546-68105568 TCCTCTCCTTTATTTCCTACCGG + Intergenic
1098237758 12:68434297-68434319 CCCACTCATCTGTTTCCTCCTGG - Intergenic
1098367855 12:69723872-69723894 GTCTTTCCTTTGTGCCCTCCTGG - Intergenic
1099156369 12:79181502-79181524 CTCTCCCTTTTTTTTCTTCCAGG + Intronic
1099368905 12:81805951-81805973 GTCTATCCTTTTTTTTCTCCAGG + Intergenic
1099417885 12:82415913-82415935 ATCTCTGATTTGTTTCCTACTGG - Intronic
1100735009 12:97518686-97518708 CTGTCTCTGTTCTTTCCTCCTGG + Intergenic
1102611917 12:114119803-114119825 CTCTCTTCCTTGATTCTTCCTGG - Intergenic
1102754715 12:115328117-115328139 CTCTTTTCTTTGTTTCTACCAGG - Intergenic
1103711288 12:122914629-122914651 ATGTCTCCTTAGTTTCCTCCTGG - Intergenic
1103988194 12:124780980-124781002 CTCTCTCCCAGGATTCCTCCAGG - Intronic
1104299312 12:127549790-127549812 CTCCCTCCCTTCTTCCCTCCTGG + Intergenic
1104359420 12:128117949-128117971 CTCTGTTCTTGCTTTCCTCCAGG + Intergenic
1106406350 13:29478146-29478168 CTGTCTCCTTAGTCTCCTTCAGG - Intronic
1106880115 13:34120000-34120022 CTCTCTCCTTTATTCTCTCTCGG - Intergenic
1107341949 13:39417072-39417094 ATCCCACCTTTGTTTCTTCCTGG - Intronic
1107429439 13:40326930-40326952 CACTCTCCTTTGCTGCCTCATGG + Intergenic
1108180834 13:47838198-47838220 TCCTCTCCTTTGTTTCCTGAGGG + Intergenic
1108349822 13:49581706-49581728 CTGTCTCCTGGTTTTCCTCCTGG - Intronic
1108389518 13:49934719-49934741 CTCTGTCATCTGTTTCCTCTAGG - Intronic
1108969635 13:56357190-56357212 CTTTCTCCTTTTGTTCTTCCAGG + Intergenic
1109580963 13:64333891-64333913 CTCTCTCAATTGGTTCCTTCTGG + Intergenic
1109583513 13:64370521-64370543 CTACCTCCTATGTTTGCTCCAGG + Intergenic
1109804112 13:67415850-67415872 CTCTCTCAATTGGTTCCTTCTGG + Intergenic
1111280866 13:86022732-86022754 CTCTCTCATTTTTTTCCTTTTGG - Intergenic
1112170988 13:96971517-96971539 TTCCCTCCTGAGTTTCCTCCAGG - Intergenic
1112242932 13:97700162-97700184 CTGTCTCCTTTGGTTCCTATTGG - Intergenic
1113312645 13:109146793-109146815 CTCTCTTCTTTCTTTCTTTCTGG - Intronic
1113852427 13:113425339-113425361 GTCTCTCAGTTGTTTACTCCAGG - Intronic
1114354373 14:21891142-21891164 CTCTCTCGATTGGTTCCTTCTGG + Intergenic
1114465624 14:22920192-22920214 ACCTCTCCTTTGTTACCTCTTGG - Intergenic
1114948622 14:27717914-27717936 CTCTCTCCTTTTTTTTCTTGAGG + Intergenic
1114955143 14:27808054-27808076 CTCTCTCCTTTGCTTGCACATGG + Intergenic
1115056903 14:29139423-29139445 CTCTCTTCTTTGTTTCCTTTTGG + Intergenic
1115084772 14:29501120-29501142 CTTTCAGCTTTGTTTCCTCAGGG + Intergenic
1116928806 14:50669320-50669342 ATGTCTCCTTTGTTTGCTCATGG - Intergenic
1117262044 14:54045532-54045554 CTCTCTCTTTTCCTTCCTGCTGG - Intergenic
1117823297 14:59673683-59673705 CTCTCTCTGTTGGTTCCTTCTGG - Intronic
1118312863 14:64705819-64705841 CTCACTCCCTAGTTTCCTCCTGG - Intronic
1118395191 14:65330175-65330197 CTCTATTCTTAGTTTCCTCAAGG + Intergenic
1118811943 14:69281586-69281608 CTCTCTCCTTTGTTGCCAGCAGG + Intronic
1119130586 14:72168936-72168958 CTCTCTCCTTTGCCTACTTCTGG + Intronic
1119622795 14:76145301-76145323 CTTTCACCTTTGTATCCCCCTGG - Intergenic
1119660531 14:76448183-76448205 TTCTCTCCTCTCATTCCTCCTGG + Intronic
1120275428 14:82367336-82367358 CTCTCTCCTGTCTTTCCTTATGG - Intergenic
1120628164 14:86855340-86855362 CTTGCTCCTTTGTCTCCTCAAGG + Intergenic
1121376042 14:93411439-93411461 CTATCACCTTTGTTCCCTCAAGG - Intronic
1121454524 14:94029863-94029885 CTCTCACCTTTATTTCTTCATGG - Intronic
1121895120 14:97639748-97639770 CTCTGTCCTGTGTATCCCCCTGG + Intergenic
1122404268 14:101490589-101490611 CTGTCTCCTTTGAGCCCTCCTGG - Intergenic
1122521266 14:102345444-102345466 CTGGCTCCTTTCTTTCCTGCTGG - Intronic
1123068720 14:105630696-105630718 CTCTCTCCAGAGTTTCCACCTGG - Intergenic
1123134976 14:106019218-106019240 CTTTCCCCTTTCTTTACTCCAGG - Intergenic
1123585520 15:21757088-21757110 CTTTCCCCTTTCTTTACTCCAGG - Intergenic
1123622161 15:22199676-22199698 CTTTCCCCTTTCTTTACTCCAGG - Intergenic
1124133958 15:27017596-27017618 CTCTTTTCTTTCTTTCCTCAGGG + Intronic
1124616982 15:31249016-31249038 CTCTCTCCTTATTTTACCCCAGG - Intergenic
1124690326 15:31816261-31816283 ATATCTCCTTTGTTTAGTCCAGG - Intronic
1125134840 15:36329180-36329202 CTCTCTCAGTTGGTTCCTTCTGG - Intergenic
1126188387 15:45853393-45853415 CTCCCTTCTTTACTTCCTCCTGG + Intergenic
1126319737 15:47409246-47409268 CTCTCTCCCACATTTCCTCCAGG - Intronic
1126454837 15:48849716-48849738 CTCTCTCCTTTCCGTCATCCTGG - Intronic
1127568710 15:60219217-60219239 CTCTCTTTTTTTTTTCTTCCAGG + Intergenic
1127697986 15:61470518-61470540 CTCTCTCTTTTGTTTCCATATGG - Intergenic
1128787270 15:70407034-70407056 CTTTCTACTTTGTTTCCCCCTGG - Intergenic
1128870665 15:71153045-71153067 CTCTCTCCAGTCTTCCCTCCTGG + Intronic
1128980044 15:72179392-72179414 CTCTCTCGCCTGTTCCCTCCTGG - Intronic
1129184822 15:73899622-73899644 TTCTCTCCTCTGATTCCGCCTGG - Intergenic
1129664685 15:77572914-77572936 CTCCCTCCTCCTTTTCCTCCAGG - Intergenic
1129672662 15:77615907-77615929 CTCTGTCCTGTGCTTGCTCCCGG - Intronic
1129833369 15:78685229-78685251 CTCTCTCTTTGGGATCCTCCTGG + Intronic
1130160023 15:81389432-81389454 CTCTCTCCCTTGTGTCCTGCAGG - Intergenic
1131255194 15:90857485-90857507 GTCTCTGCTGTATTTCCTCCTGG + Intergenic
1131627776 15:94141940-94141962 CTCTCTCCTTTCTTTCCTTCTGG + Intergenic
1131653718 15:94430977-94430999 GTCTCTCTTTTGTTTTCTCATGG + Intronic
1131668221 15:94592577-94592599 CTCTCTCCTTTGTTTTTTTTGGG + Intergenic
1132017491 15:98331710-98331732 CTCTCTCCTCTTCTTCCTCTGGG + Intergenic
1132048457 15:98586275-98586297 CTCTAGCCTTGGTTTCCTTCAGG + Intergenic
1132084007 15:98891708-98891730 CTCTGTCGGTTGTTTCATCCGGG + Intronic
1132301906 15:100781272-100781294 TTCTCACCTTTGTTTTGTCCAGG + Intergenic
1132953052 16:2575611-2575633 CCCTCTCCCTTCTTTCCTCAGGG - Intronic
1132961299 16:2624557-2624579 CCCTCTCCCTTCTTTCCTCAGGG + Intergenic
1133301259 16:4784125-4784147 CCCTCTCCTCTGTGTCCTCTGGG + Intronic
1134571513 16:15295231-15295253 CTCCCTCCTTTATTTGGTCCTGG - Intergenic
1134936563 16:18251085-18251107 CTCCCTCCTTTATTTGGTCCTGG - Intergenic
1135496271 16:22954269-22954291 GTGCCTCCTTGGTTTCCTCCAGG - Intergenic
1135570920 16:23548797-23548819 CTCTCTCGATTGGTTCCTTCCGG + Intronic
1135604523 16:23811846-23811868 CCTTCTCCTCTGTTTCCTCATGG + Intergenic
1135693691 16:24567300-24567322 TTTTCTCCTCAGTTTCCTCCTGG + Exonic
1135872992 16:26169395-26169417 CTCTCTCCTCTTTTTTCTGCTGG - Intergenic
1136344309 16:29665010-29665032 CTCGCTCCCATGTTTCCACCCGG + Exonic
1137037179 16:35577033-35577055 CTCTCTCATTTGTGTCTTTCAGG + Intergenic
1137038288 16:35586356-35586378 CTCCATCCTTTGTGTTCTCCAGG + Intergenic
1137282440 16:46989442-46989464 CTCCCTCCTTCACTTCCTCCAGG - Intergenic
1137289980 16:47045851-47045873 CTCTTTCTTTTTTTTCCTTCAGG + Intergenic
1137394465 16:48107000-48107022 CTCTCTTGTAAGTTTCCTCCAGG - Intronic
1137524956 16:49226848-49226870 CTCTTTCCTCTGTTTCTACCTGG + Intergenic
1137532000 16:49283591-49283613 CCCGCCCCTTTCTTTCCTCCTGG - Intergenic
1137901843 16:52277121-52277143 CTCTCTCTTTTTTTTGCCCCAGG - Intergenic
1138688533 16:58747415-58747437 CTCTCCCATTTGTTTCCTGCTGG + Intergenic
1138799615 16:60012138-60012160 CTCTCTCCTTTTTTTTTTCTAGG - Intergenic
1139871889 16:70114519-70114541 CTTTCTCCTTTGGTTTCGCCCGG + Intronic
1140364038 16:74367964-74367986 CTTTCTCCTTTGGTTTCGCCCGG - Intergenic
1140425334 16:74856478-74856500 CTCCCTCCGTAGGTTCCTCCTGG + Intergenic
1140730995 16:77856116-77856138 CTCTTTCCTGTCTTTTCTCCCGG - Intronic
1142877706 17:2862019-2862041 CTCTCTCCTTTCTTTCCTTCTGG + Intronic
1143175218 17:4951260-4951282 ATTTCTGCTTTTTTTCCTCCTGG + Intronic
1143555266 17:7655917-7655939 CTCTCTCCTGTGGATGCTCCTGG + Exonic
1143641540 17:8201166-8201188 CTCTCTCCTCTGTTTTCTCGAGG - Intergenic
1143686897 17:8524546-8524568 CTCTGTCCTGTTCTTCCTCCTGG + Intronic
1144124310 17:12188156-12188178 CTCACTCTTTTCTTTCCTTCTGG + Intergenic
1144203513 17:12962703-12962725 CTCCCTCCTTGATTTCCACCTGG + Intronic
1144218472 17:13078856-13078878 CTCTTCCCTTTTTTTCCTCAGGG + Intergenic
1144287886 17:13796189-13796211 TTCTCTCCTGTGTTTGCTCAGGG + Intergenic
1144306621 17:13974356-13974378 CTCTCCCCTTTGTCTACACCAGG + Intergenic
1144929586 17:18848560-18848582 CTGTCTCCTCGGCTTCCTCCTGG + Intronic
1145057443 17:19712802-19712824 CCCTCTCCCCTGTGTCCTCCAGG + Intronic
1145762278 17:27432181-27432203 ATGTCTCCTTAGCTTCCTCCAGG + Intergenic
1145999871 17:29124692-29124714 CTCTCTCCTTTGCTTGCTGTCGG - Intronic
1148046382 17:44747550-44747572 CTCTCTCCTCTGTTGCCCTCTGG + Intronic
1148152989 17:45407232-45407254 GTCCCTGCTGTGTTTCCTCCAGG + Intronic
1150735834 17:67738296-67738318 TGCTCTCCTTTGTTTCGTCCTGG - Exonic
1151326533 17:73383332-73383354 CTCTTTCCTTCCTTTGCTCCAGG + Intronic
1151879303 17:76885559-76885581 CCCTGCCCTTTGTCTCCTCCTGG + Intronic
1152537541 17:80959448-80959470 CCCACGCCTGTGTTTCCTCCTGG + Intronic
1152796235 17:82308954-82308976 CTCTCTCTATTCTTTCCTTCTGG + Intergenic
1152885814 17:82848767-82848789 CTCTCTCCTGTGTCTCCTGGAGG + Intronic
1154386253 18:13895056-13895078 CCCTCTTCTTTGTATCTTCCCGG + Intronic
1154460678 18:14581822-14581844 CTCTCTGTTTTGTTTGCACCAGG + Intergenic
1155071947 18:22324755-22324777 CTGTCTTCTTTGCTTCCTCAGGG - Intergenic
1155081668 18:22416244-22416266 CTCTCACCTTTGCTTCCACGGGG - Exonic
1155554036 18:26998176-26998198 CTCTCTCCGTTGTGCCCTCCTGG + Intronic
1156362291 18:36393692-36393714 CACTCCCCTTTGTATTCTCCAGG - Intronic
1156837411 18:41570868-41570890 CTCTATCCTATGTTTCATGCTGG + Intergenic
1157503169 18:48204831-48204853 CTCTCTCCTTTGAGAGCTCCTGG - Intronic
1157712655 18:49860451-49860473 CTTTCTCCTTTTTTACCTCTGGG - Intronic
1158306277 18:56109663-56109685 CTCTCTCCTTGTATTCATCCAGG - Intergenic
1158351266 18:56566945-56566967 CTCTGTACCTTGCTTCCTCCTGG + Intergenic
1159601892 18:70436156-70436178 CTCTCTCCTTTCTTTCCCAGGGG + Intergenic
1160158342 18:76451055-76451077 CTCGCTCCTTTGTTCCTCCCTGG - Intronic
1161148194 19:2692285-2692307 CTCTTTTCTTTGATTCCTCCTGG + Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161792113 19:6366369-6366391 CACCCTCCTTTATTTCATCCTGG + Intronic
1161881907 19:6960806-6960828 TTCTTTCCTTGGATTCCTCCTGG - Intergenic
1162158848 19:8697375-8697397 CTCTGTCCTGTCCTTCCTCCAGG - Exonic
1162401233 19:10447850-10447872 CTCTCTCACTGGGTTCCTCCAGG + Intronic
1162770154 19:12944487-12944509 CTCCCTCCTGTGTCTCCTTCTGG + Exonic
1163045883 19:14641547-14641569 CTCTCTGCTGTGCCTCCTCCTGG - Exonic
1163059812 19:14752457-14752479 CTCTCTGCTGTGCCTCCTCCTGG - Exonic
1163637304 19:18443274-18443296 CTCTCTCCTTTGGGACCCCCGGG - Exonic
1163870329 19:19815996-19816018 CTCCATCCTTTGTGTGCTCCAGG + Intronic
1163884415 19:19953200-19953222 CTCCATCCTTTGTGTGCTCCAGG + Intergenic
1163905025 19:20144730-20144752 CTCCATCCTTTGTGTGCTCCAGG + Intergenic
1164095455 19:22005866-22005888 CTCTATCCTCTGTGTTCTCCAGG + Intronic
1164101471 19:22058190-22058212 CTCCATCCTTTGTGTGCTCCAGG - Intronic
1164114936 19:22210600-22210622 CTCTATCCTCTGTGTTCTCCAGG + Intergenic
1164176409 19:22779089-22779111 CTCTATCCTTTGTGTGCTCCAGG + Intronic
1165283569 19:34818030-34818052 CTTTCTTCCTTTTTTCCTCCAGG - Intergenic
1166233028 19:41436766-41436788 CTCTCTGCTTTGTTTGGTCATGG - Intronic
1167753912 19:51398832-51398854 CTCTCTCTTTTCTTTCCAACAGG - Intergenic
1167821141 19:51928501-51928523 ATCTCTCCTTTCTCTCATCCTGG + Intronic
1167860912 19:52283315-52283337 CTCTGTCCTTTGCTTCATCATGG - Exonic
1167869279 19:52354281-52354303 CTCTCTCCTTTGCTTCAACATGG - Exonic
1168102786 19:54149798-54149820 CTCTGTTGTTTCTTTCCTCCAGG + Intronic
924986425 2:274645-274667 CTCTCTGCTTTATTTCCTCCAGG + Intronic
925523017 2:4768465-4768487 TTCTCTCCTTTCTCTGCTCCTGG + Intergenic
925628069 2:5862089-5862111 CTCTCTCAATTGATTCCTTCTGG + Intergenic
925760498 2:7179838-7179860 CTCCCTCCGTAGGTTCCTCCTGG - Intergenic
927077895 2:19598251-19598273 CTCTCTCCTAATTTACCTCCAGG + Intergenic
927543734 2:23934741-23934763 CTCTATTCTTTATTTCCTTCTGG - Intronic
928264355 2:29798831-29798853 CCCTCTCTTTTTTTTCCCCCAGG - Intronic
929023234 2:37574975-37574997 CTCTTTCCTTAGTGTCCTCATGG + Intergenic
929059322 2:37906990-37907012 CTCTGACTTTGGTTTCCTCCTGG - Intergenic
929588770 2:43132162-43132184 CTTCCTCCTTTGCTGCCTCCAGG - Intergenic
929830724 2:45344362-45344384 CTCTCTCCTTTGCTGCTCCCGGG + Intergenic
930018108 2:46984637-46984659 CTCTCTCCCTCTTTCCCTCCTGG - Intronic
930440780 2:51402743-51402765 CTCTCTCTTTTCTTTTCTTCTGG - Intergenic
930871701 2:56177672-56177694 CTCTCTTCTTTGCGTACTCCTGG + Intergenic
932335331 2:70927888-70927910 CTCCCTCCTCTGTTTTCTCAGGG - Intronic
932673812 2:73760558-73760580 CTCTGTCCTTAGCTTCCTCCAGG + Intergenic
932732705 2:74232301-74232323 CTCTCTCCTTCCCTCCCTCCAGG + Intronic
932779773 2:74553018-74553040 CTCTCTCCTCTGTGTCTTTCTGG - Intronic
933017667 2:77149876-77149898 CTCTCTCCTTGGTTTTGCCCAGG + Intronic
933023761 2:77227444-77227466 CTTGCTCTTTTGTTTCCTCATGG - Intronic
933041168 2:77468731-77468753 CTCTCTCCCTGCTCTCCTCCTGG + Intronic
933155515 2:78968954-78968976 CTCTTTCCTATTTTTCCTCTTGG + Intergenic
934482199 2:94661463-94661485 CTCTCTCCTTTGCTTGCACATGG - Intergenic
934626431 2:95860081-95860103 ATCTCTACTTTGTTTTTTCCTGG - Intronic
934723271 2:96596841-96596863 CTCTCTCCTCTCTGTCCTGCTGG - Intronic
934807128 2:97241237-97241259 ATCTCTACTTTGTTTTTTCCTGG + Intronic
935507763 2:103927778-103927800 CTCTCTCCTTTGTTATTTCTTGG - Intergenic
936528159 2:113256276-113256298 TTCTTCCCTTTGATTCCTCCAGG - Intronic
937004948 2:118502773-118502795 CTCTCTTCTCTGTTTCTGCCTGG - Intergenic
939028453 2:137042396-137042418 CTCTCTCTTTTTTTTCCTCCAGG + Intronic
939067243 2:137498688-137498710 CTTTCTCTTTTGTTTCTTACTGG - Intronic
939829962 2:147060033-147060055 TACTCTCCTTTCATTCCTCCAGG + Intergenic
940152205 2:150615000-150615022 CTCTCTTCTTTCTGTTCTCCAGG - Intergenic
940533742 2:154911738-154911760 ATATCTTCTTTGTTTTCTCCTGG + Intergenic
941758498 2:169214655-169214677 CTCTCTCCACTCTCTCCTCCAGG - Intronic
942018014 2:171836647-171836669 CTCCTTCCTTTGTTGCCTTCAGG - Intronic
942414434 2:175744023-175744045 CTCTCTCCTTTGATCCATGCCGG - Intergenic
942588238 2:177510277-177510299 CTCTCTCTCTGCTTTCCTCCAGG - Intronic
942588911 2:177519222-177519244 TACTCTCCTTTGTTATCTCCTGG + Intronic
943331063 2:186559663-186559685 CTCTTTCATTTGTTTCTACCAGG - Intergenic
943776486 2:191772303-191772325 CTTTCTACTTTGTTTCTCCCAGG - Intergenic
943966907 2:194347269-194347291 TTCTCTCCTTGGTTTTCTCTAGG - Intergenic
944463763 2:199979823-199979845 CTCTCTCCTTCCTTTCCTCTTGG + Intronic
944708778 2:202317012-202317034 CTTTCTACTTTGTTCCCTACTGG - Intergenic
945331703 2:208547435-208547457 CTCTGTGCTTTGTTTCCTTCAGG + Intronic
945554549 2:211262691-211262713 CTCTCTCCTCTCTTTTCTCTGGG + Intergenic
945598438 2:211826563-211826585 CTGTCTGTTTTATTTCCTCCTGG + Intronic
945630535 2:212269823-212269845 CTCTTTGCCTTGTTTCCTGCTGG + Intronic
946679746 2:222201263-222201285 CACTCTCCTTTGTCTCCTATTGG + Intronic
947081357 2:226400650-226400672 TTCTCTCCATTCTTGCCTCCAGG + Intergenic
947169399 2:227296169-227296191 CTCTCCCATTTGTTTCTTACTGG + Intronic
947352642 2:229262393-229262415 CTTTCTCCTTTATTTCCTTCTGG - Intronic
947378647 2:229523418-229523440 CTCTCTCCTTGGTTTGCCCGTGG + Intronic
947946009 2:234102839-234102861 CTCTCTTGCTGGTTTCCTCCTGG + Intergenic
948353325 2:237358549-237358571 CTTTCTCCTTTCTCTCCTCGAGG + Exonic
948573765 2:238936665-238936687 CTGTCTCCTTTATTCCCTGCTGG + Intergenic
1169894765 20:10491013-10491035 CTCTCTTGTTTGCTTTCTCCTGG - Intronic
1170296109 20:14827720-14827742 CTCTTTGCTGTGTTTCCTCTTGG + Intronic
1170298063 20:14851288-14851310 CTCTTTCATTTGTAACCTCCAGG + Intronic
1170414529 20:16125794-16125816 CTCTCTCTTCTGTTTTTTCCTGG + Intergenic
1170887089 20:20349936-20349958 CTCTGTTCTTTTTTCCCTCCAGG - Intronic
1170912445 20:20586882-20586904 TTCTCTCTTTGCTTTCCTCCTGG - Intronic
1171252875 20:23662844-23662866 CTGTCTCCTTTGTTCCATCCTGG + Intergenic
1171252932 20:23663160-23663182 CTCCTTCTTCTGTTTCCTCCTGG - Intergenic
1171259355 20:23718164-23718186 CTGTCTCCTCTGTTCCATCCTGG + Intergenic
1171268451 20:23793736-23793758 CTGTCTCCTTTGTCCCCTCCTGG + Intergenic
1173758085 20:45535655-45535677 AGCTCTCCTTTATTTCCTTCCGG + Intronic
1173765161 20:45600625-45600647 CTCTCTCTTTGCTTTCCTTCTGG + Intergenic
1173953463 20:47011649-47011671 CTTGCTCCTTTGCTTCCTTCAGG + Intronic
1174121494 20:48268991-48269013 CTCACTCCTTGATTTCCTTCAGG + Intergenic
1174990355 20:55502334-55502356 CTTTCTCCTTTTTTTCAACCAGG - Intergenic
1175333715 20:58181448-58181470 CTCTCTCCTGTGTCATCTCCAGG - Intergenic
1176521492 21:7827825-7827847 CTCTGTCCTTTGGGACCTCCTGG - Intronic
1177278166 21:18943096-18943118 CTTTCTCTGTTATTTCCTCCTGG + Intergenic
1177972102 21:27802853-27802875 CACTCTTCATTGTTTCCTCTTGG - Intergenic
1178310953 21:31529617-31529639 TTATTTCCTTTGTTTCCTTCTGG - Intronic
1178433542 21:32537218-32537240 CTTGCTCCTTTGATTCCTCCTGG - Intergenic
1178655512 21:34457837-34457859 CTCTGTCCTTTGGGACCTCCTGG - Intergenic
1179021823 21:37647748-37647770 TTCCCTCCCTTGTTCCCTCCTGG + Intronic
1179510018 21:41866450-41866472 CTCTCTCCTTAGTGGCCTCCAGG + Intronic
1179721693 21:43319978-43320000 CCCTGTCCTTGGTTTCCTCTGGG - Intergenic
1180786461 22:18550440-18550462 CTCACTCCTGCGTCTCCTCCAGG - Intergenic
1180884185 22:19228207-19228229 TCCTATCCTTTGTTTCCTTCAGG + Intronic
1181131742 22:20736163-20736185 CTCACTCCTGCGTCTCCTCCAGG - Intronic
1181243382 22:21489993-21490015 CTCACTCCTGCGTCTCCTCCAGG - Intergenic
1182003493 22:26940137-26940159 TTCACTCCTTTGTTTCTTTCAGG - Intergenic
1182003700 22:26941697-26941719 TTCACTCCTTTGTTTCTTTCAGG + Intergenic
1182855726 22:33516168-33516190 CTCGCTCCTTCATTTCCTGCAGG - Intronic
1182995880 22:34811999-34812021 CTGTCTCCTTAGATTCCTCTTGG - Intergenic
1183564268 22:38601918-38601940 CTTTCTGATCTGTTTCCTCCTGG - Intronic
1185238060 22:49725965-49725987 CTGTGTCCTTGGTTTTCTCCAGG - Intergenic
949829969 3:8203701-8203723 ATCTCTTCTTTTTTTCTTCCTGG - Intergenic
950081464 3:10225149-10225171 CTTTATCCTTTCCTTCCTCCAGG + Intronic
950921751 3:16702144-16702166 CTGTTTCCTTTGTTTCAGCCAGG - Intergenic
950951280 3:17002693-17002715 ATCTCTCCTGTTTTTCCTACAGG + Intronic
951704279 3:25528085-25528107 CTCTTTACTTTCTTTTCTCCTGG - Intronic
952018943 3:28993674-28993696 CTCTCTCCCTTTATTCCTTCTGG + Intergenic
952395605 3:32917959-32917981 CTCTCTTGATTGGTTCCTCCTGG - Intergenic
952541842 3:34375030-34375052 CTGTCTCCCTCCTTTCCTCCAGG + Intergenic
952873121 3:37919806-37919828 CTTTCTTCTCTGTTTCCCCCAGG - Intronic
953141007 3:40229358-40229380 CTCTATCGTTTTTTTCCTCTAGG - Intronic
954156180 3:48686035-48686057 CTGTCTCCTCTGGTCCCTCCCGG + Intronic
954512583 3:51139402-51139424 CTATCTCATTTGCTCCCTCCTGG + Intronic
955497654 3:59551949-59551971 CTTTCCACTTTGTTTCCTGCAGG - Intergenic
955745037 3:62132045-62132067 CTCCCACCTTCATTTCCTCCTGG - Intronic
955831268 3:63006717-63006739 CTCTCTGCTTTGTTGCCTGAAGG - Intergenic
956593105 3:70936751-70936773 TTCTCCCTTTTTTTTCCTCCTGG + Intergenic
957326245 3:78699052-78699074 ATCTTTCCTGTCTTTCCTCCTGG + Intronic
958446502 3:94222109-94222131 CTCTCTCAGTTGGTTCCTTCTGG + Intergenic
960297011 3:115956675-115956697 TTCTCTCCTTTGTTGCCTTTTGG - Intronic
960334498 3:116399936-116399958 CTGTTTCCTTTCTTTCCTTCTGG - Intronic
960346019 3:116534278-116534300 GGCTTTCCTTTGTTTTCTCCTGG - Intronic
960414573 3:117368559-117368581 CTCCCTCCTTTGGTACCTGCAGG - Intergenic
960421190 3:117447513-117447535 GTCTCTCTTTTTTTTCCCCCTGG - Intergenic
960837279 3:121919556-121919578 CTCTCTCCATTGGTTCCTTTTGG - Intronic
961855476 3:129866188-129866210 ATCTCTCATTTGTTTCCTAATGG + Intronic
962135033 3:132723056-132723078 TTCTCTCCGTTGTCTCCGCCCGG + Intergenic
962936478 3:140085694-140085716 CTCTCTCCATTGTTGGCCCCAGG + Intronic
962936787 3:140088746-140088768 CTCTCCCCTGGGTTTCTTCCTGG + Intronic
963001517 3:140686057-140686079 CTCTGTCTTTTTTCTCCTCCTGG + Intronic
963097246 3:141556999-141557021 CTGCCTTCTTTGTTTTCTCCAGG - Intronic
963119705 3:141765635-141765657 CTCTCTGCAGTGTTTCCTCCTGG - Intergenic
963273342 3:143306891-143306913 TTCTCTTCTTTCTTTCCTCCTGG + Intronic
963310861 3:143708613-143708635 CTCTCTCCTTTATTTCATCTAGG + Intronic
963447282 3:145428337-145428359 CTCTCTCAATTGGTTCCTTCTGG - Intergenic
964315866 3:155443838-155443860 CTCTCTTCTTTTTTTCTTACTGG - Intronic
964408657 3:156376314-156376336 CTCTCACCATTCTTTCCTCTTGG - Intronic
964849191 3:161076689-161076711 CTCTCTCTTTTTTTTTTTCCTGG - Exonic
964887311 3:161499236-161499258 TTCTCTCCTTTGTAGCCTCTAGG - Exonic
965438282 3:168679884-168679906 CTCTCTCCTTTTTTTTCTTAAGG - Intergenic
966728515 3:183130837-183130859 CACTCTTTTTTTTTTCCTCCAGG + Intronic
967922887 3:194625779-194625801 CTTTCTCCTTTGTTTGTGCCTGG + Intronic
968474486 4:796839-796861 CACTCTCCTCTTTTTCCTTCAGG - Intronic
968743402 4:2343077-2343099 CTCACTCCTTTGTCTTCTGCTGG + Intronic
969148004 4:5141304-5141326 CTTCCTCCTTTGCTTCCTTCAGG - Intronic
969417398 4:7069499-7069521 CACTTTCTTTTGTTTCCTCCAGG - Intergenic
969572661 4:8018986-8019008 GTCTCCCCTCTCTTTCCTCCTGG - Intronic
969593355 4:8134148-8134170 CGCTTGCCTTTGTTTCCGCCTGG - Intronic
969746954 4:9080095-9080117 CTCTCTCCTTCACTTCCTTCCGG + Intergenic
970818180 4:20182659-20182681 CTCCCTCCTTCATTTTCTCCAGG + Intergenic
971791070 4:31170447-31170469 CTCTTTTCTTTGTGTCTTCCTGG + Intergenic
971841612 4:31859665-31859687 TTCTCTCCTTTTTCTCCTTCTGG - Intergenic
971957324 4:33438510-33438532 TTTTCTCCTTGGTTTTCTCCTGG + Intergenic
972132870 4:35859699-35859721 CTGTCAAATTTGTTTCCTCCAGG - Intergenic
972305835 4:37828637-37828659 CTGTCTCCTTTGTTTCTCTCAGG + Intronic
972701751 4:41500916-41500938 CTCTCTCATTTGTCTCCATCTGG - Intronic
973002129 4:44963807-44963829 CTTTCTCTATTGTTTCCTTCTGG - Intergenic
973138988 4:46742718-46742740 CACTCTCTTATTTTTCCTCCAGG - Intronic
973168165 4:47104524-47104546 CTCTCTCTTTTCTTTTATCCAGG + Intronic
974068737 4:57104867-57104889 CTGTCTGCTCTCTTTCCTCCTGG - Intronic
974198821 4:58612173-58612195 CTCTTTCCATTCTTTCCACCAGG + Intergenic
974994342 4:69134789-69134811 CTCTCTCTTTTTTTTCTTTCTGG - Intronic
975512919 4:75212946-75212968 CTCCCTCCTTCCTTCCCTCCTGG - Intergenic
975775653 4:77784144-77784166 CTTTCTCCTTTATTTCCTCCTGG - Intronic
975818224 4:78241696-78241718 CTCTCACCCTTATTTCCTCCAGG - Intronic
976140219 4:81983787-81983809 CTCTTTCCTTTCTTTCCTCCAGG - Intronic
976208153 4:82641421-82641443 TTCTCTGCTTTTTTTCTTCCTGG - Intronic
976339239 4:83927421-83927443 CTCTTTCCCTTCTTTCCTCTCGG + Intergenic
976448791 4:85163110-85163132 CTCTCTTTTTTGTTTCTGCCAGG + Intergenic
976762157 4:88560845-88560867 CTCTCTCCATTGTGTTCTCTTGG + Intronic
976829316 4:89296124-89296146 CTCTCTACTGTGTTACCTCCGGG + Intronic
977154058 4:93551362-93551384 CTCACTCCTTTATTTCATTCAGG - Intronic
977273559 4:94948129-94948151 CTCTGTCCTTAGCTTCTTCCTGG + Intronic
977315135 4:95437527-95437549 CTATCTCCTTTATTTCCTAAAGG - Intronic
978500252 4:109401502-109401524 ATCCCTCCTCTGTTTCCTCTAGG - Intergenic
978592652 4:110342985-110343007 CTCCCTCCATTGGTTCCTTCTGG + Intergenic
978846822 4:113283040-113283062 CTCTCTCCCTTGCTTCCTTATGG - Intronic
978937688 4:114398292-114398314 ATCTCTCCTTTATTTCCCACAGG + Intergenic
979005142 4:115284840-115284862 CTCTCTCCCTTTCTTCCTTCAGG + Intergenic
979192067 4:117873982-117874004 CTTTCTCATTTGCTTCCTCATGG - Intergenic
979663283 4:123283342-123283364 CTCTCTTTTTTTTTTCCTACCGG - Intronic
979980016 4:127243337-127243359 CTCTCTCCTTTCATGCCACCAGG - Intergenic
980282579 4:130739410-130739432 CTCTCTCGATTGGTTCCTTCTGG - Intergenic
981813600 4:148803471-148803493 CTCTCTTCTTTGTTACTTCTTGG + Intergenic
983526423 4:168764865-168764887 CTCTTTCCATTGCCTCCTCCTGG + Intronic
984367119 4:178813406-178813428 CTCTCTCTATTGATTCCTTCTGG - Intergenic
986778978 5:11046881-11046903 CTCTGTGCTTTGTTAACTCCAGG - Intronic
986848334 5:11781172-11781194 CTCTCTCATTTGCTTGCTGCGGG - Intronic
987386297 5:17332743-17332765 CTTTATTCTTTCTTTCCTCCTGG + Intergenic
988783055 5:34541102-34541124 CTCTCTGTGCTGTTTCCTCCTGG + Intergenic
991204965 5:64039588-64039610 CTCTCTCCTTTTCTTCCTCCTGG + Intergenic
991226242 5:64276406-64276428 CTTTCTCCTTTGTTTCTTTGTGG - Intronic
991262614 5:64683502-64683524 TTCTTTCCTTGTTTTCCTCCTGG - Intergenic
991574671 5:68090448-68090470 CTCTCTACTGTGACTCCTCCAGG - Intergenic
992381168 5:76239322-76239344 CTATCTCCTTTGATTCCACATGG - Intronic
992867660 5:80973810-80973832 CTCTCTCCCTCATCTCCTCCTGG - Intronic
995013828 5:107288072-107288094 CTCCTTCCTTTGTTTCCTCGGGG + Intergenic
995038173 5:107558875-107558897 CTCTTTCCTTTGATTCAGCCTGG - Intronic
995102784 5:108334738-108334760 TTGTGTCCTTTGTTTTCTCCTGG - Intronic
995166650 5:109051607-109051629 CTCTCGCCTATGTCTCTTCCTGG - Intronic
995250361 5:109985940-109985962 ACCTTTCCTTTGTGTCCTCCAGG - Intergenic
995840465 5:116438944-116438966 TTCTCTGCTTTGATTCATCCTGG + Intergenic
996027819 5:118668452-118668474 TTCTTTCCTTTTTTTCCTTCCGG + Intergenic
996275297 5:121659586-121659608 TTCTCTCATTTGTGTCCTACAGG + Intergenic
996908244 5:128626635-128626657 TTCTCTTCTTTCTTTCCTCTTGG - Intronic
997074884 5:130662027-130662049 TTCTCTCATTTGCTCCCTCCAGG + Intergenic
997254013 5:132412710-132412732 GTCTCTCGTTCTTTTCCTCCTGG - Intronic
997852713 5:137346977-137346999 CTCCCTTCTCTGTTACCTCCAGG + Intronic
997930589 5:138069505-138069527 CCCTCTCCCTTGTTTTCTCTAGG + Intergenic
999135744 5:149317707-149317729 CTCACACCATTGTCTCCTCCAGG + Exonic
1000042002 5:157491723-157491745 CTCTGCCCTTTCTTTGCTCCAGG - Exonic
1000392497 5:160739657-160739679 CTCTCACCTATGTTCCCTCCAGG - Intronic
1000658751 5:163914223-163914245 CTCTCTTCTTACTGTCCTCCAGG + Intergenic
1001668493 5:173453793-173453815 CTCTCCCCTTTTGTTTCTCCTGG + Intergenic
1001716006 5:173816742-173816764 CTCTTTCCTTTCTATCTTCCTGG - Intergenic
1001754926 5:174160946-174160968 CCCTCTCATTTCTTTTCTCCAGG - Intronic
1001832198 5:174798318-174798340 CTTTCTCCTTAGTTTCCTGGGGG + Intergenic
1002663979 5:180809837-180809859 CTCTCTCCTTTCCTTCCTGTAGG + Intronic
1003721842 6:8711830-8711852 CTTTCTCATTCATTTCCTCCTGG - Intergenic
1004511928 6:16290307-16290329 CTCTCTCGCCTGTCTCCTCCTGG - Intronic
1005166307 6:22925459-22925481 CTTTCCCCTTTGTTTCCTTGAGG - Intergenic
1005409235 6:25525023-25525045 TTCTCTCTTTTCTTTCCTTCTGG - Intronic
1005942380 6:30570375-30570397 CTCCCTCCTTTGTTTTCTTCAGG - Intergenic
1006411671 6:33877549-33877571 CTCTCTCCTTTGCTTCTGCAAGG - Intergenic
1006471663 6:34232826-34232848 CTCTCTCCTTAGATTTCTTCAGG + Intergenic
1007600663 6:43078845-43078867 CTCCCTGGTTTCTTTCCTCCGGG + Intronic
1007600989 6:43081124-43081146 CTCCCACCTTTCTTTCCTTCGGG + Intronic
1007628205 6:43258446-43258468 CTCTCTCCTTGGCTTGCTCCTGG - Intronic
1007688621 6:43682949-43682971 GTCTCTCCTTTGGTTCCTTTGGG - Intronic
1008919645 6:56828588-56828610 CAGTCTCCTTTGTTTCTTACTGG - Intronic
1011222030 6:85064675-85064697 CTCTCTCCTTGGTTTACTGATGG - Intergenic
1011694038 6:89895972-89895994 CTTTTTCCTTTCTTTCTTCCTGG + Exonic
1012158761 6:95856084-95856106 TTCTCTCCCTTTTCTCCTCCTGG + Intergenic
1012708109 6:102560034-102560056 CTCACTCCTTTACTTCCTTCAGG + Intergenic
1013429430 6:110042627-110042649 CTCCCTCCTGTTTTTCCTTCAGG - Intergenic
1013998677 6:116340227-116340249 TTCTCTCTCTTGTTTCCTTCTGG + Intronic
1014438581 6:121447679-121447701 CTCTCGCCTATGTCTCCTCCTGG + Exonic
1014931664 6:127343496-127343518 CGCTCTCCTTTCCTTTCTCCGGG + Intronic
1015268260 6:131311229-131311251 ATCTCTCCTTTGTTCACTCCTGG - Intergenic
1015717134 6:136204555-136204577 TGCTCTACTTTGTTTCCTCTGGG - Intergenic
1016207522 6:141487615-141487637 ATCTTTTCTTTGTGTCCTCCTGG - Intergenic
1016420950 6:143882587-143882609 TTCTCTCCTGTTTCTCCTCCTGG + Intronic
1016732877 6:147445221-147445243 CCCTCTCCTTTGCTTTCTGCAGG - Intergenic
1016845660 6:148565832-148565854 GTGTCTCCTTTCTTTCTTCCTGG + Intergenic
1016997471 6:149970550-149970572 CTCTCTTCTTAGCCTCCTCCAGG - Intronic
1017001330 6:149999626-149999648 CTCTCTTCTTAGCCTCCTCCAGG + Intergenic
1017011051 6:150064145-150064167 CTCTCTTCTTAGCCTCCTCCAGG + Intronic
1017020816 6:150138716-150138738 CTCTCTCCTGTCTTGGCTCCAGG - Intergenic
1017059362 6:150467820-150467842 ATATCTCCTTAGTCTCCTCCTGG + Intergenic
1017544077 6:155432650-155432672 CTCTCTGCTTTTTTTCCTGGGGG + Intronic
1018394897 6:163370562-163370584 GTCTCTCTTTTTTTTCCTCCTGG + Intergenic
1018619756 6:165718652-165718674 CACTCTCCTGTGTCTCGTCCGGG - Intronic
1018957085 6:168417365-168417387 TGCTCTCCTTTGCTTCTTCCTGG - Intergenic
1018971223 6:168530807-168530829 ATTTCTCCTGGGTTTCCTCCCGG - Intronic
1019727884 7:2612885-2612907 CTCTCTACTTCGTCTCCCCCGGG - Exonic
1019759614 7:2800809-2800831 CTCTCCACTTTCCTTCCTCCCGG + Intronic
1019914141 7:4121459-4121481 CTCTCTCTTTTCTCTCCTGCTGG + Intronic
1021326042 7:19270128-19270150 CTCTTTCTTATGTCTCCTCCTGG - Intergenic
1021852277 7:24820238-24820260 TTCTGTCCTTTGTTTCCATCAGG - Exonic
1021887872 7:25157702-25157724 ATCTCTCCTTAGGTTCCTCTTGG - Intronic
1022570493 7:31448453-31448475 CTCTCTTCTTTGTGTGCTGCTGG + Intergenic
1023288786 7:38647223-38647245 ATCTCCTCATTGTTTCCTCCTGG + Intergenic
1023536472 7:41217937-41217959 CTTTCTCATTTGCTTCCTCATGG - Intergenic
1023593516 7:41804008-41804030 TTCTGTCCTTCATTTCCTCCTGG - Intergenic
1023646794 7:42325980-42326002 CTTTCTCTTTTGTATCTTCCAGG + Intergenic
1023668767 7:42554387-42554409 CTCTCTCCTTGACTTCCTTCAGG - Intergenic
1023731851 7:43199102-43199124 CTCTCTCCACGGTTTTCTCCAGG + Intronic
1023782496 7:43669867-43669889 CTCTCTCATCTGTTTCCGTCAGG - Intronic
1023883338 7:44334094-44334116 CTCGCTCCGTTGTTTCTGCCAGG - Intronic
1023988028 7:45109286-45109308 CTCTCTCCTTTTTCTCTTCAGGG - Exonic
1024186483 7:46953110-46953132 CATTGTCCCTTGTTTCCTCCAGG - Intergenic
1024247627 7:47482101-47482123 CTCACTCCTTAGCTTTCTCCTGG + Intronic
1024452398 7:49563247-49563269 CTCTCTCCTTTTTTTCTGGCAGG - Intergenic
1024751469 7:52470552-52470574 CTCTCTCCTTTGTTCATTACTGG - Intergenic
1025824836 7:65002149-65002171 CTCTATCCTTTGTGTTCTCCAGG + Intronic
1025936222 7:66039829-66039851 CTCTCTCTATTTCTTCCTCCTGG + Intergenic
1026631340 7:72040708-72040730 CTCTCTCCTTGGTTTGCACATGG - Intronic
1027547379 7:79545101-79545123 TTCTCTTATTTTTTTCCTCCAGG + Intergenic
1027748954 7:82116581-82116603 CTCTCTCTCTTTTTCCCTCCCGG - Intronic
1028449660 7:90967091-90967113 CTCCCTCCTTTCCTTCCTTCTGG - Intronic
1030838337 7:114316616-114316638 CTCACTCCTTTGTCTCCTTCAGG - Intronic
1030866853 7:114710688-114710710 CACTTGCCTTTGTTCCCTCCAGG + Intergenic
1030923620 7:115423319-115423341 ATCTCTCCTTTTCTTTCTCCAGG - Intergenic
1031301068 7:120061054-120061076 CTCCCTGCTTTGGTTCCTTCTGG + Intergenic
1031536129 7:122935355-122935377 CTCTCCTCTTTTTTTCCTTCTGG + Intergenic
1031725014 7:125227769-125227791 CTCTCCCCGTTGTGTCCTCTTGG + Intergenic
1031963221 7:128008410-128008432 AGCACTCCTTGGTTTCCTCCGGG - Intronic
1032446055 7:131984616-131984638 CTCTCTCCTCCTTTTCCACCAGG + Intergenic
1032553881 7:132811744-132811766 CACTCTCCTGTTTTTCCTCCCGG + Intronic
1032635175 7:133699186-133699208 CTCTTTCCCTTTTTTGCTCCTGG + Intronic
1032730551 7:134637985-134638007 GTCTCTCCACTGTTTCTTCCAGG + Intergenic
1033091510 7:138390336-138390358 CTCTTGCCTTTATTTCCTACAGG - Intergenic
1033124208 7:138693458-138693480 CTCTCTTCTTTCTTTCTTCTGGG - Intronic
1033125981 7:138707761-138707783 CCCTCCCCTTCATTTCCTCCAGG + Intronic
1033313693 7:140280921-140280943 CTCACTCCTTCGCATCCTCCAGG - Intergenic
1034063236 7:148112049-148112071 CTCTTTCCTCTGTTCCCACCTGG - Intronic
1034738962 7:153455726-153455748 CTCCCTCCTATTTTTTCTCCTGG + Intergenic
1034968211 7:155404243-155404265 CCCACCCCTTTGTTTCCTTCTGG - Intergenic
1035542499 8:452818-452840 CTTTCTCCTTTCTCTCCTCTTGG - Intronic
1035588279 8:793879-793901 TTCTCAGCTTTGTTTCCTGCTGG + Intergenic
1035606036 8:930208-930230 GTCTTGCCTTTGCTTCCTCCAGG - Intergenic
1036198053 8:6738912-6738934 TTTTCTCCTTTGTTTTCTTCTGG + Intronic
1036475096 8:9086004-9086026 CTCTTTTCTGTGATTCCTCCTGG - Intronic
1036690364 8:10941164-10941186 CTCTCTCCTGTCCTTCCTCCGGG + Intronic
1037272908 8:17149483-17149505 TTCTTTCTTTTTTTTCCTCCAGG + Intergenic
1037657207 8:20895163-20895185 CACTCTCCTTTTAATCCTCCTGG + Intergenic
1037841926 8:22250913-22250935 CTCTCTCCTATACTGCCTCCAGG - Exonic
1038481536 8:27905169-27905191 CCCTCTCCTTTGTTTTCCCCTGG - Intronic
1038961788 8:32528091-32528113 CTCACTCCTTTTTATCATCCAGG + Intronic
1039036763 8:33368129-33368151 CTTGCCCCTTTGTATCCTCCTGG - Intergenic
1039625056 8:39040828-39040850 CTTTCCCCATTGTATCCTCCTGG - Intronic
1039907772 8:41798734-41798756 CTCCCTCCATGGTTTCCTCTAGG + Intronic
1040421935 8:47248903-47248925 CTTTCTCCATTGTGTCCTCTTGG + Intergenic
1040887521 8:52282202-52282224 TTTTCTTCTTTTTTTCCTCCTGG - Intronic
1041089212 8:54286437-54286459 TTCTTTCCTTTTTTTCCCCCAGG - Intergenic
1041613696 8:59881598-59881620 CTGTCTCCTTGGGCTCCTCCTGG - Intergenic
1041709021 8:60876264-60876286 CTTTCACCTTTGCTTCCTCCTGG - Intergenic
1042519611 8:69697517-69697539 ATTTCTCCTTAGTTTCCTCATGG - Intronic
1042627502 8:70774502-70774524 TTTTCTCCTTTGTTTTCTTCTGG + Intronic
1042817767 8:72896361-72896383 CTTTCACCTTTGTTTCCACATGG + Intronic
1043013573 8:74910416-74910438 CTTTCTCTTTGTTTTCCTCCTGG + Intergenic
1043052312 8:75399011-75399033 CTCTCTACTCTGTCTCCTTCTGG - Intergenic
1044250238 8:89997776-89997798 CTGTCTCCTTTCTTCCCTCTCGG + Intronic
1045138992 8:99257834-99257856 CTCTCTCCTTCTTTCCCTCTTGG + Intronic
1047410932 8:124624079-124624101 CTCTCTCCTTTGTTTTAAGCTGG - Intronic
1048351848 8:133623054-133623076 CTCCTTCCTGTGTCTCCTCCTGG + Intergenic
1048415013 8:134217944-134217966 CTCACTCCTGTGATTCCTTCTGG - Intergenic
1048538937 8:135324759-135324781 TTCTCTCCTGAGTTTCCTCAAGG - Intergenic
1049480563 8:142820555-142820577 TTCTCTCCTCTGCCTCCTCCAGG + Intergenic
1049681314 8:143919716-143919738 CCTTCTCCTTGGTGTCCTCCAGG + Exonic
1050414247 9:5398443-5398465 TTCTCTGTTTTCTTTCCTCCAGG - Intronic
1050448034 9:5747669-5747691 CTCCCTCCTTTCTTTCCACTTGG + Intronic
1050673949 9:8030546-8030568 CTCTCTTCTTTATGTTCTCCAGG - Intergenic
1050768211 9:9162963-9162985 CTCTCTATTTTCTTACCTCCTGG + Intronic
1050786997 9:9415922-9415944 CACTCTGCTTTTTTTCCTTCTGG - Intronic
1050830430 9:10004320-10004342 CTTTCTCCTTTGTTTCCACATGG - Intronic
1051663574 9:19447138-19447160 ATCTTTCCTTTCTGTCCTCCAGG + Intronic
1051742315 9:20263827-20263849 CCCTCTCCCTTGTGCCCTCCTGG + Intergenic
1051857825 9:21589508-21589530 CCCTCTCCTTGGTCTCCTCCTGG + Intergenic
1052779049 9:32761743-32761765 CTCCCTCCTCTTTTTCTTCCTGG - Intergenic
1053338589 9:37301727-37301749 CTCCCTCCTGTGGATCCTCCTGG + Intronic
1053386626 9:37696253-37696275 TTCTCTTGCTTGTTTCCTCCAGG + Intronic
1053675630 9:40423256-40423278 CTCTCTCCTTTGCTTGCACATGG + Intergenic
1053925426 9:43049591-43049613 CTCTCTCCTTTGCTTGCACATGG + Intergenic
1054288086 9:63201638-63201660 CTCTCTCCTTTGCTTGCACATGG - Intergenic
1054386731 9:64563320-64563342 CTCTCTCCTTTGCTTGCACATGG + Intergenic
1054508992 9:65953036-65953058 CTCTCTCCTTTGCTTGCACATGG - Intergenic
1054956290 9:70914591-70914613 CTGTCTCCTATGTTTGCTCAAGG - Intronic
1054963419 9:70994917-70994939 CTCTTTTCCTTGTTTCCTGCAGG + Intronic
1055373513 9:75624974-75624996 CCCTCGCCTTTGCTGCCTCCAGG - Intergenic
1055562446 9:77534376-77534398 CTTTGGCCTCTGTTTCCTCCTGG - Intronic
1056029803 9:82541369-82541391 CTCTTTTCTTTCTTTTCTCCTGG - Intergenic
1056325911 9:85478992-85479014 CACTCTCCTTTGCATCCGCCAGG - Intergenic
1056364073 9:85885397-85885419 CTATCTCCTTAGGTTCCTCTTGG + Intergenic
1056994074 9:91438769-91438791 CTTTCTCCATTGTGTCCTCTTGG + Intergenic
1057491905 9:95526737-95526759 CCTTCTCCTTTGCTTCCTCCTGG - Intergenic
1057917166 9:99065694-99065716 CTCTCTCTTTTTATTCATCCTGG - Intronic
1058057156 9:100460387-100460409 CTCTCTGCTTTTTTTGCTTCAGG - Intronic
1058248989 9:102668391-102668413 CTATCGCCTGTGTTTCCTCAAGG + Intergenic
1058717595 9:107736862-107736884 CTCTCTGCTTTCTTTCAGCCAGG + Intergenic
1058944869 9:109846751-109846773 CTCACTCCCTTCCTTCCTCCAGG + Intronic
1059415990 9:114162807-114162829 CGTTCTCCTTTGTCTCCCCCTGG - Intronic
1059603975 9:115813009-115813031 CTCTTCCCTTTCTTTCCTCTAGG - Intergenic
1060331537 9:122675594-122675616 CTCTCTCCTACATGTCCTCCTGG + Exonic
1060832424 9:126724798-126724820 CCCTCTCCTTTGTTTCCGTGTGG + Intergenic
1060920497 9:127417393-127417415 CTCTCTCCTTTGCTCTCTGCTGG + Intergenic
1060987817 9:127829827-127829849 GTCTCTCCTCTGTGTCCCCCAGG - Exonic
1061098392 9:128473333-128473355 CATCCTCCTTTGCTTCCTCCAGG + Intronic
1061216536 9:129224928-129224950 CTCTCTCCTACGCTGCCTCCTGG - Intergenic
1061216782 9:129226232-129226254 CTCTCTCCTTCCTCTACTCCAGG - Intergenic
1061288580 9:129638212-129638234 CCCTCTCCTGCGCTTCCTCCTGG - Exonic
1061795131 9:133081915-133081937 CTGTGTCCTTTCTTTCCTCAGGG + Intronic
1061996589 9:134189241-134189263 CCCTCTCCTTTATTTACACCGGG - Intergenic
1062581903 9:137232472-137232494 CTCTCTCCTCTGTCTCCAACAGG - Intronic
1186261665 X:7786497-7786519 CTCTCTCAATTGTTTCCTTCTGG - Intergenic
1187469500 X:19556100-19556122 TTCTCTCATTTTTTTCCTGCTGG - Intronic
1187550593 X:20300982-20301004 ATCTCTCCTTTTGCTCCTCCAGG - Intergenic
1188089143 X:25940636-25940658 CACTCTCCTTTCTTTCCCCCAGG + Intergenic
1188240650 X:27785010-27785032 CTCTCAGCTTTGTTTTCCCCAGG + Intergenic
1188378451 X:29462556-29462578 CTCTCTCCCCTGCTGCCTCCAGG + Intronic
1189010960 X:37045377-37045399 CACTCTCCTTTTTTTCCTTCTGG + Intergenic
1189035445 X:37490147-37490169 CCTTCTCCTTTTTTTCCTTCTGG - Intronic
1190340376 X:49291330-49291352 CTCTCTCCTTTCTTTCTTGACGG + Intronic
1191974339 X:66853759-66853781 CTCTCTCTTTTATTTTCTTCAGG + Intergenic
1192182301 X:68923715-68923737 CTTTCTCCTTTCTTTCCTGAGGG + Intergenic
1194746312 X:97632256-97632278 CCCTCTACTGTGTTTCTTCCAGG - Intergenic
1195169076 X:102248473-102248495 ATTTCTCCTTAGTCTCCTCCAGG + Intergenic
1195189781 X:102438616-102438638 ATTTCTCCTTAGTCTCCTCCAGG - Exonic
1196553029 X:117052975-117052997 CCCTCTCCCTTGTGTCTTCCAGG - Intergenic
1198925996 X:141796320-141796342 TTGTCTCATTTGTTTCCTCAAGG + Intergenic
1199571604 X:149272268-149272290 TGCTCTCCTTTGTGTCCTCAAGG + Intergenic
1200967001 Y:9056276-9056298 CTCTCTCTTTTACTTCCTACTGG + Intergenic
1201765497 Y:17570392-17570414 CTCTCTCTGTTTTTTCCGCCTGG - Intergenic
1201836055 Y:18335597-18335619 CTCTCTCTGTTTTTTCCGCCTGG + Intergenic