ID: 1078759974

View in Genome Browser
Species Human (GRCh38)
Location 11:14243965-14243987
Sequence AAACTCATCATGTCCAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 1, 2: 4, 3: 42, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078759969_1078759974 1 Left 1078759969 11:14243941-14243963 CCATGGATGGTCCACCTGGACCT 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG 0: 1
1: 1
2: 4
3: 42
4: 296
1078759970_1078759974 -10 Left 1078759970 11:14243952-14243974 CCACCTGGACCTTAAACTCATCA 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG 0: 1
1: 1
2: 4
3: 42
4: 296
1078759965_1078759974 24 Left 1078759965 11:14243918-14243940 CCGTCAGGTTTTTGGACAGCTCT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG 0: 1
1: 1
2: 4
3: 42
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078759974 Original CRISPR AAACTCATCATGTCCAAAAT GGG Intronic
901009162 1:6189130-6189152 AGACTCACCATCTCCAAAAAAGG + Intronic
902054988 1:13593283-13593305 AAACTCATCATATCTAAAGCCGG - Intronic
902222464 1:14975676-14975698 AATCTTTTCATGTGCAAAATGGG - Intronic
902778698 1:18690852-18690874 AAACCCTTCATGTCACAAATGGG + Intronic
903618068 1:24676681-24676703 AAAATTAACATGTCCAAAATAGG + Intergenic
905675968 1:39825303-39825325 AGACTCACCATGTCCAAGACAGG - Intergenic
909328183 1:74379526-74379548 AAACTGAGCATGTCAGAAATGGG - Intronic
911411029 1:97507376-97507398 AAAATAATCATATACAAAATTGG + Intronic
911588157 1:99714827-99714849 AGACTTAACATGTCCAAAATGGG - Intronic
912062854 1:105695528-105695550 AAGTTCATCTTGTCCAAAAGTGG + Intergenic
912326772 1:108771056-108771078 AAACACAACATTACCAAAATCGG - Intronic
915153574 1:153855609-153855631 AAAGTCATTAAGTCTAAAATGGG + Intronic
917177238 1:172249396-172249418 AAACAGATCAGGTCCAAAAAGGG - Intronic
917511289 1:175671200-175671222 AAACCCAACATGTCCAAAGCTGG - Intronic
917868410 1:179220193-179220215 AAACTCTTCATCTACAAAATGGG + Intronic
918869398 1:189949565-189949587 AAATTCATCTTGCCCCAAATTGG + Intergenic
918982350 1:191579313-191579335 ATACGCAGCATGTCCAAATTTGG - Intergenic
919062357 1:192649395-192649417 ATACTCTTCATCTACAAAATGGG + Intronic
919796945 1:201326644-201326666 AAACTCAACCTCTCCAAATTGGG - Intronic
919934114 1:202240465-202240487 AAACTCAACATGTCCCAGAGGGG - Intronic
920415468 1:205796476-205796498 AAACTGGGCATGTGCAAAATGGG - Intronic
920461652 1:206145318-206145340 AAATAGATAATGTCCAAAATTGG + Intergenic
921245126 1:213230313-213230335 AAAATAATCTTATCCAAAATAGG - Intronic
921686114 1:218091038-218091060 CAGCTCAACATATCCAAAATTGG - Intergenic
921788551 1:219263031-219263053 AAACTTATCCTGTCCAACTTAGG - Intergenic
922942644 1:229481131-229481153 GAACTCATCCTGCCCAACATGGG - Intronic
923565867 1:235075480-235075502 AAACTCATACTGTTCAGAATGGG + Intergenic
1063789931 10:9432788-9432810 ATACTCATCATTTTCAAAGTAGG - Intergenic
1063949653 10:11210108-11210130 AAAGTCATCATGTTGTAAATAGG - Intronic
1065811958 10:29450665-29450687 AAACTAATCATGTCCAAAGGAGG - Intergenic
1066550216 10:36547664-36547686 AAACTTAACATGTCCAGACTGGG + Intergenic
1067332650 10:45336006-45336028 ACATTCATCATGTCCAAAGCTGG + Intergenic
1069700081 10:70417804-70417826 AATCTCATCATGAACAAAAGTGG + Intronic
1070109675 10:73472905-73472927 AATCTCATCAAAACCAAAATAGG - Intronic
1070184069 10:74043645-74043667 AAAATTATTATGTCAAAAATTGG - Intronic
1072175396 10:92915701-92915723 AAACTGATTATGGTCAAAATTGG - Intronic
1072609775 10:97010457-97010479 GAAATCAACATGTTCAAAATTGG + Intronic
1074421449 10:113312599-113312621 AATTTCCTCATCTCCAAAATGGG + Intergenic
1076577777 10:131481947-131481969 TATCTTCTCATGTCCAAAATGGG - Intergenic
1076596904 10:131629035-131629057 AAACTCATGGTCTGCAAAATGGG - Intergenic
1077621822 11:3731735-3731757 ATACTCAACATGTACAAAGTTGG - Intronic
1078307929 11:10209637-10209659 AAATTAATCATGACCAAATTGGG + Intronic
1078644144 11:13123473-13123495 AAACTCCACATGGCCAAAACTGG + Intergenic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1080060728 11:27954022-27954044 GAACTCAACATGTCAATAATTGG - Intergenic
1080144881 11:28969507-28969529 AAATTCAGCATGTTCAACATAGG + Intergenic
1080694634 11:34591486-34591508 AAATACATCATGTCCAAATTTGG - Intergenic
1081347054 11:42001214-42001236 GATGTCTTCATGTCCAAAATAGG + Intergenic
1082883770 11:58063266-58063288 AATGTCATCATCTGCAAAATGGG + Intronic
1083790352 11:64980783-64980805 AAATTTAACATGGCCAAAATAGG + Intergenic
1084649243 11:70479000-70479022 AAGGGCCTCATGTCCAAAATGGG + Intronic
1086314562 11:85577523-85577545 AAACTTATCATGGCCAAAACTGG - Intronic
1086695273 11:89837102-89837124 CAACTTATTATGTCAAAAATAGG - Intergenic
1086710879 11:90007382-90007404 CAACTTATTATGTCAAAAATAGG + Intergenic
1089854712 11:121532990-121533012 AAACTCTTTATCTCCCAAATGGG + Intronic
1091057439 11:132432018-132432040 AAAGTCACCATGTCCATGATGGG + Intronic
1091073781 11:132594717-132594739 TATATCACCATGTCCAAAATAGG + Intronic
1091553157 12:1552172-1552194 AAAGTCAGCAGGTCCAAAAATGG - Intronic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1096465104 12:51844129-51844151 AATTTCATCATTTCTAAAATGGG - Intergenic
1096746255 12:53729044-53729066 AATCTCATCATGTGTAAAATGGG - Intergenic
1097306289 12:58072781-58072803 AAATTCATCTTGTCCTTAATTGG - Intergenic
1098020972 12:66156251-66156273 AAACTTAACATGGCCAAAACTGG + Intronic
1098126640 12:67302533-67302555 AAACTCGTCCTGTACAAAGTTGG + Exonic
1098404863 12:70113971-70113993 AAAGTCATCATTTCCTGAATGGG - Intergenic
1098611054 12:72458649-72458671 AAACTCAGTATGTCCAAAGCAGG + Intronic
1098910063 12:76199758-76199780 AACCTCATTATGTCCAAAACAGG + Intergenic
1099423862 12:82499193-82499215 AAACTCAACATACACAAAATAGG - Intergenic
1099485074 12:83219396-83219418 CATCCCATCATGTCTAAAATAGG - Intergenic
1103063900 12:117881111-117881133 AAACTCATCATGTTCATTGTTGG - Intronic
1105320833 13:19320013-19320035 AAACTTGTCAGGTCCAAAATCGG - Intergenic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1107458788 13:40580502-40580524 AATCTCCTCATCTACAAAATGGG + Intronic
1107657047 13:42602204-42602226 AGCTTCATCATGTCTAAAATGGG + Intronic
1107914583 13:45136140-45136162 AAATTCATCATCTGTAAAATGGG + Intronic
1108941299 13:55958031-55958053 AAACTCAACATGACCTAAAGTGG + Intergenic
1110279982 13:73681841-73681863 AAGCTTGTCAAGTCCAAAATCGG + Intergenic
1112569922 13:100584915-100584937 AAGCTCAACATTACCAAAATAGG - Intronic
1113080721 13:106517006-106517028 AACCCCATCACTTCCAAAATAGG - Intronic
1113526972 13:110987373-110987395 AAACTGATCGTGTCCAGACTTGG - Intergenic
1113922529 13:113921468-113921490 AAACAGATAATGTCTAAAATGGG - Intergenic
1114928814 14:27441245-27441267 AAAATGATCATCTCCAGAATCGG - Intergenic
1116211447 14:41951022-41951044 AAACTCTTCATTTCCGAAAAAGG + Intergenic
1118442287 14:65822721-65822743 GAAGTCATCATAGCCAAAATAGG - Intergenic
1119759855 14:77142487-77142509 AACCTCCTCATCTCCAGAATGGG - Intronic
1122463133 14:101912186-101912208 AAATTTAACATGTCCAAGATTGG - Intronic
1124351912 15:28962012-28962034 AAATTCATCATCTTCAAAACTGG - Intronic
1125418675 15:39479931-39479953 AATCTCATGATGTCCAAATGGGG - Intergenic
1128094206 15:64941577-64941599 AAACTAATAATGTCAATAATGGG + Intronic
1128671714 15:69578644-69578666 AACCTCAGCATCACCAAAATTGG - Intergenic
1129237539 15:74232821-74232843 GAACTCACCAAGTCCAAAGTTGG - Intergenic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1130869598 15:87960069-87960091 AAACTCATAATGGTGAAAATAGG + Intronic
1131973646 15:97918912-97918934 AACCTCTTCATCTCCAAATTGGG - Intergenic
1133068005 16:3223767-3223789 AATCTCATTATTGCCAAAATTGG - Exonic
1133767266 16:8846737-8846759 CAACTCCCCATCTCCAAAATGGG - Intronic
1135361041 16:21815096-21815118 AAACTTATCATGTCCACTCTTGG - Intergenic
1136775037 16:32867372-32867394 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1136895581 16:33994140-33994162 AGACTCAGCTTGTCCAAAATGGG + Intergenic
1139052509 16:63143528-63143550 AAAGCCATAATTTCCAAAATGGG - Intergenic
1139970884 16:70774139-70774161 AAACTCGTGATGTTCAAATTAGG - Intronic
1140675924 16:77329466-77329488 AACCTCCTCATTTGCAAAATAGG + Intronic
1141327221 16:83072643-83072665 AAACCCCTCATTTCCCAAATGGG - Intronic
1141332622 16:83125945-83125967 ATACTAATCATATCCAGAATCGG + Intronic
1203077455 16_KI270728v1_random:1129481-1129503 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1143561298 17:7696838-7696860 AAACTCAATTTGTCCATAATAGG - Intronic
1144528086 17:16008279-16008301 ATACTTAACATGTCCAAAATAGG + Intronic
1144901831 17:18601003-18601025 AAACTTACCAGGTCCAAGATTGG - Intergenic
1144929236 17:18844942-18844964 AAACTTACCAGGTCCAAGATTGG + Intronic
1145130671 17:20345067-20345089 AAACTTACCAGGTCCAAGATTGG + Intergenic
1145832937 17:27931973-27931995 AAACTCAACATGACCCAAACTGG - Intergenic
1146477034 17:33171359-33171381 AAACTCAACATGTCCACACTTGG + Intronic
1146800647 17:35817371-35817393 AAACTAATCAGGTCCAAAAAGGG - Intronic
1147487107 17:40826731-40826753 AAAGTCATCAATTCCAATATTGG - Intronic
1150744382 17:67804436-67804458 AAAATCATAATAACCAAAATGGG - Intergenic
1150792891 17:68213319-68213341 AAAATCATAATAACCAAAATGGG + Intergenic
1151520526 17:74626031-74626053 AAACTCACCATGTCTAATATAGG + Intergenic
1159133697 18:64310704-64310726 AAACTGATCTAGTCCAAAGTAGG - Intergenic
1159382117 18:67674110-67674132 AAACTTAACATGTCCCAAACTGG + Intergenic
1159395428 18:67849280-67849302 ATTCTCATCATGTTCAAAAAAGG + Intergenic
1159587158 18:70291570-70291592 AAAGTCAAAAAGTCCAAAATTGG - Intronic
1162190808 19:8945110-8945132 AATGTCTTCATCTCCAAAATAGG + Intronic
1164269624 19:23660086-23660108 AAATTCAGTCTGTCCAAAATGGG + Intronic
1164439538 19:28262636-28262658 AATGTTATCAGGTCCAAAATTGG + Intergenic
1166702876 19:44892159-44892181 AAACTCATCATCTGAAAGATGGG - Intronic
925356581 2:3246224-3246246 AAACACAACATTTACAAAATGGG + Intronic
926368720 2:12158469-12158491 AAACTCATTAACTCAAAAATAGG - Intergenic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
928916874 2:36481671-36481693 AATGTCTTCATCTCCAAAATGGG - Intronic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
930852763 2:55978356-55978378 AAAGTCAGCATATTCAAAATAGG - Intergenic
930995324 2:57710348-57710370 AACCTCATCATGTCTAATAGAGG + Intergenic
931621174 2:64211196-64211218 AAACTTAACAAGTCCAAACTTGG + Intergenic
931623225 2:64231953-64231975 AAACTTAACAAGTCCAAACTTGG - Intergenic
934475565 2:94591254-94591276 ACACTCAACATGTCCAGAAAGGG + Intronic
936030135 2:109064141-109064163 AGTCTCTTCATGTCTAAAATGGG - Intergenic
938453108 2:131441520-131441542 AAACTTAATATGTCCAAAATGGG - Intergenic
939546665 2:143563157-143563179 CAACTCTTCATTTCCAAAATGGG + Intronic
939953659 2:148505904-148505926 AAATTCTTCATTTCTAAAATGGG + Intronic
941366230 2:164614814-164614836 AAGTTCAGCATGTCCAAAGTGGG + Intronic
941505372 2:166337325-166337347 AAACACAGGATGTCCAAAATTGG - Intronic
941724151 2:168842753-168842775 AATCTCCTCATGTGTAAAATTGG + Intronic
942479452 2:176368390-176368412 CAACTCAATATGTCCAAAACTGG - Intergenic
943153300 2:184141244-184141266 AAACTCAACATGTGAAATATGGG + Intergenic
943423030 2:187693349-187693371 GAATTCCTCATGTGCAAAATGGG + Intergenic
944920505 2:204408109-204408131 AATCTAATGCTGTCCAAAATTGG + Intergenic
945204145 2:207313826-207313848 AAAATCCTTATATCCAAAATAGG + Intergenic
945271010 2:207940040-207940062 AAACTCAACAGTTCCCAAATTGG - Intronic
945508394 2:210669722-210669744 AGACTCATCATGTTATAAATGGG + Intronic
946906017 2:224417039-224417061 AAAGTCATCATATTCAAAAATGG + Intergenic
947151394 2:227120056-227120078 AGACTCATCATGTAAAAAATAGG - Intronic
949004936 2:241640121-241640143 AAAATCATCATGTTCAAGTTGGG + Intronic
1169173365 20:3485541-3485563 AAACATATCATGGCCAAAATGGG - Intronic
1169456089 20:5753838-5753860 AACCTCATCTTGCCCCAAATGGG + Intronic
1169586755 20:7094547-7094569 AAACTGTTGATATCCAAAATTGG - Intergenic
1169690043 20:8320401-8320423 AATTTCCTCATCTCCAAAATAGG - Intronic
1169799164 20:9497450-9497472 TAACTAAACATGTCCACAATGGG - Intergenic
1170205249 20:13791139-13791161 AAACTCAACATATCTAAAACAGG - Intronic
1170738389 20:19030569-19030591 AAACTCAACAAGCCCCAAATAGG - Intergenic
1171004434 20:21450447-21450469 AAATTCATGATTTCTAAAATAGG + Intergenic
1172027638 20:31959983-31960005 AAACTGCTCTTGTCCAAAACAGG - Intergenic
1173024671 20:39296779-39296801 AATTTCATCATCTGCAAAATGGG + Intergenic
1173179956 20:40798669-40798691 AAACTTCTCATCTACAAAATGGG - Intergenic
1173341136 20:42154066-42154088 GAACTCATAATGACCAAAACAGG - Intronic
1177385464 21:20404233-20404255 AAACTCTTCATTTAAAAAATTGG - Intergenic
1177685338 21:24429000-24429022 AAACACATCATTTTTAAAATTGG + Intergenic
1178468180 21:32868136-32868158 AAACTAATCATCTTCAAGATGGG - Intergenic
1178733542 21:35128657-35128679 TTAATCATCATGTCCTAAATTGG - Intronic
1178768716 21:35481936-35481958 AATCTCCTCATCTGCAAAATGGG + Intronic
1179295777 21:40061125-40061147 AAATTCAACATGACCCAAATAGG + Intronic
1179335097 21:40443984-40444006 AACCTAATCTTGTGCAAAATGGG + Intronic
1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG + Intronic
1183270234 22:36857534-36857556 AGTTTCCTCATGTCCAAAATGGG + Intergenic
1185359550 22:50397405-50397427 TAATTCATAATGTCTAAAATTGG + Intronic
950627838 3:14261161-14261183 AATCTAATCAAGTCCTAAATGGG - Intergenic
951165051 3:19475408-19475430 AAAGTCAGCATTTCCAAATTTGG - Intronic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952001966 3:28796416-28796438 AAATTCACCTTGTCCAAAACTGG - Intergenic
952497403 3:33928156-33928178 ACATTCATCATCTCGAAAATAGG - Intergenic
953112878 3:39960293-39960315 AAGCCCATCATATCCAAAGTGGG + Intronic
953795458 3:45982360-45982382 ACACTCCTCATCTGCAAAATGGG - Intronic
953846874 3:46434455-46434477 AAGCCCAACATGCCCAAAATTGG + Intergenic
954200115 3:49018922-49018944 ATATTCATCATGTGTAAAATGGG - Intronic
954369645 3:50163504-50163526 AACCTCATCATCTCCAAACCTGG - Intronic
955826615 3:62953807-62953829 AAACTTTTCATGTATAAAATTGG - Intergenic
956099028 3:65748155-65748177 AAAATCTTCATGTCTAAATTTGG - Intronic
957376287 3:79363199-79363221 AAACTCATCATGGCTAAGACTGG - Intronic
957552941 3:81730446-81730468 AAACTCACCAAGCCTAAAATTGG - Intronic
957931522 3:86884564-86884586 AAACTTAGCATGTCCAAATCTGG - Intergenic
958174252 3:89974961-89974983 GAACTCAGTATATCCAAAATAGG + Intergenic
958741853 3:98083205-98083227 AGATTCACCATGTCCAAATTTGG - Intergenic
959874101 3:111361434-111361456 AAACCCATCATCTCATAAATAGG - Intronic
960178777 3:114549613-114549635 AAACTGTTTATGTCCTAAATTGG - Intronic
960814617 3:121659907-121659929 AAACTCTTTATTTCAAAAATGGG - Intronic
961969555 3:130946084-130946106 AAAATCATCAGATCAAAAATAGG - Intronic
962027714 3:131566242-131566264 AAACTCTTCGTGACCAAAATGGG + Intronic
962270214 3:133972237-133972259 AAATTCATAATGTAAAAAATGGG + Intronic
962271735 3:133982487-133982509 AAACTAATCACTTCCCAAATAGG + Intronic
962622409 3:137192808-137192830 AAAATCATCATATCCCAAACAGG - Intergenic
962748968 3:138418682-138418704 TAACTCATCATCTCCAAGAGTGG + Intergenic
963662652 3:148146995-148147017 AAACTCTTCAGTTCCAAAAGTGG + Intergenic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965781136 3:172287288-172287310 AAACTCAGCATGTCCAAGAATGG - Intronic
966643545 3:182217073-182217095 AAACACAGCAAGTCTAAAATAGG + Intergenic
967921820 3:194619629-194619651 AACCTCACCATGGCCAAATTAGG + Intronic
970889672 4:21028803-21028825 AAACTCACCATGTCTAAGTTGGG + Intronic
970917129 4:21349147-21349169 AATTTCCTCAAGTCCAAAATAGG + Intronic
971376635 4:26061080-26061102 AAACTCTTCATGTACAACTTGGG - Intergenic
975941908 4:79658116-79658138 ATACTAATGATGTCCAAACTGGG + Intergenic
977463878 4:97358939-97358961 AAACCTTTCATGTCCAAAACTGG + Intronic
977885598 4:102249372-102249394 AAACCCATTATGTCCAGAATTGG + Intergenic
977890447 4:102304449-102304471 AAAGTTATCATTTCCAAAGTGGG + Exonic
978157254 4:105504199-105504221 AAACTCATCAGCTCCAAAAAAGG - Intergenic
979073648 4:116242723-116242745 AAAATCATCATGCCCAACAATGG + Intergenic
980165458 4:129220890-129220912 AAGCTAAACATGTCCCAAATTGG + Intergenic
983618261 4:169731783-169731805 AAAGTCATCATTTCCTGAATGGG + Exonic
987002123 5:13670347-13670369 AAACACATAATCTCCAGAATGGG - Intergenic
987483749 5:18495574-18495596 AAACTCAAAATAACCAAAATAGG + Intergenic
987518287 5:18944397-18944419 ACACACAACATGTCCACAATGGG - Intergenic
988266862 5:28962841-28962863 ATCCTCATCATGTTAAAAATTGG - Intergenic
989271432 5:39538073-39538095 AAACTTAACATGTCCCAAATTGG - Intergenic
990652767 5:57921224-57921246 AAGCTCTTCATGTCTTAAATGGG - Intergenic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
992810583 5:80383898-80383920 AAACTCAACATCTCCAAATATGG + Intergenic
995253073 5:110016595-110016617 GAACTCAACATGTCCTAAACTGG + Intergenic
995265969 5:110161082-110161104 AAACTCAAGTTGTCTAAAATTGG + Intergenic
995366052 5:111362168-111362190 AATTTCATCATGTGTAAAATGGG - Intronic
995447026 5:112255846-112255868 AAATTCAACATGTTCAAAACGGG + Intronic
996148296 5:120002502-120002524 AAACTCAAAATGTTAAAAATGGG + Intergenic
996547260 5:124693742-124693764 TCACTCATCATATCCAAATTTGG + Intronic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
998019256 5:138755744-138755766 AAACTCAAGGTGTCCAAAGTGGG + Intronic
998088142 5:139343421-139343443 AAACTCATTCTGACCAAAAGAGG - Intronic
999222397 5:149991311-149991333 ATACTCATTATGTTCCAAATAGG + Intronic
1001121399 5:168983611-168983633 AATTTCCTCATGTGCAAAATGGG + Intronic
1001693338 5:173649263-173649285 ATGCTTATCATGTGCAAAATAGG + Intergenic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1002333029 5:178458192-178458214 AAACTCATTATTTGGAAAATTGG + Intronic
1002561593 5:180085924-180085946 AAAGTCATCATTTCCTGAATGGG + Intergenic
1002902359 6:1419808-1419830 AGTCTCCTCATCTCCAAAATGGG + Intergenic
1003447717 6:6200067-6200089 AAGCTCATCCTGCCCAGAATTGG - Intronic
1005717222 6:28561492-28561514 AAACTCATCAAGTCAGAAAAAGG + Intergenic
1005870795 6:29972923-29972945 AGGCTCATCATGTACAAGATGGG + Intergenic
1005878193 6:30031562-30031584 AATGTCATCATGTTCAAAGTAGG + Intergenic
1006786105 6:36668443-36668465 AATATCTTCATGTCTAAAATGGG - Intergenic
1007007786 6:38383156-38383178 ATAATCATCATGACCAAATTAGG + Intronic
1007799491 6:44379980-44380002 ATACTCATGCTGTCCAAAGTTGG - Intergenic
1007899614 6:45398840-45398862 AACGTCCTCATGTCTAAAATGGG - Intronic
1008313891 6:50014992-50015014 AAACTCTACATGTCCAAAATTGG + Intronic
1010669386 6:78669810-78669832 AAGTTCATCATGTGTAAAATGGG - Intergenic
1011842628 6:91520587-91520609 AAACAAATCATAACCAAAATTGG - Intergenic
1012109259 6:95205536-95205558 AAACTTAAAATGTCCAAAAAAGG - Intergenic
1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG + Intergenic
1015066255 6:129032640-129032662 AAACTCATTATGTAAAAAAAGGG + Intronic
1016154617 6:140789423-140789445 AAACACATCAGGACCAAATTAGG - Intergenic
1017258302 6:152359732-152359754 AAACTGATTATGTCCAGAAATGG + Intronic
1017416574 6:154227289-154227311 AAACTAATCATGCCATAAATTGG - Intronic
1017808484 6:157966892-157966914 AAACTCATCCTGTCCCTAGTAGG + Intergenic
1018409557 6:163529905-163529927 GAACTCCACATGTCCAAACTGGG - Intronic
1018766239 6:166935277-166935299 AAACTCAATATATCAAAAATAGG - Intronic
1021800020 7:24295776-24295798 AAGTTCAGTATGTCCAAAATTGG + Intergenic
1021831923 7:24621531-24621553 AAATAGATAATGTCCAAAATGGG + Intronic
1022062194 7:26808745-26808767 AATTTCTTCATGTACAAAATGGG + Intronic
1024365095 7:48510958-48510980 GAACTCCTAATGTGCAAAATAGG + Intronic
1024823367 7:53360592-53360614 AAACTCAAAATGGCTAAAATTGG - Intergenic
1026615569 7:71900058-71900080 AACTTTATCATGTCAAAAATAGG + Intronic
1027994119 7:85402175-85402197 AAGCTCCTAATGTCCAAAGTTGG - Intergenic
1028210319 7:88066459-88066481 ACACTTAACATGTCCAAACTTGG - Intronic
1028656871 7:93218730-93218752 AAAATCTTCATGACAAAAATAGG + Intronic
1028772858 7:94647165-94647187 AAACTAAGCTTGTCCAAACTAGG + Intronic
1030333162 7:108294810-108294832 AAACTAAGCATGTCCAAAAAAGG - Intronic
1031588017 7:123556238-123556260 AAACTTAACATGTCCAAAATGGG - Intronic
1031824881 7:126551576-126551598 AAGCTCATCATGTCTACAAATGG + Intronic
1032183606 7:129703806-129703828 AACCTCATCAAGTCAAAAAATGG - Intronic
1032733390 7:134666575-134666597 AAAGTCATCATATCCAGAATGGG - Intronic
1032759280 7:134924223-134924245 ATACTCATCATGTTCAAATCTGG + Intronic
1032870468 7:135979149-135979171 AAACTTAACATGTCCAGAATAGG + Intergenic
1032913652 7:136462527-136462549 GAACTCATCATGTCCCAAAAGGG + Intergenic
1034220238 7:149438763-149438785 AAACTCATCAGGCTGAAAATGGG + Intronic
1035131416 7:156657735-156657757 AAACTCATGATTTTCAAAATAGG - Intronic
1035945902 8:3962244-3962266 AACCTCATCATGACCAAATCTGG - Intronic
1037546491 8:19929023-19929045 AAACTCATCTTCTGCTAAATGGG + Intronic
1039341841 8:36658998-36659020 ACAATCATCATAGCCAAAATAGG + Intergenic
1040595008 8:48828992-48829014 AACCTCATGTTGTCCAAAGTAGG + Intergenic
1040742313 8:50592869-50592891 AAATTCTTCATGTACACAATGGG - Intronic
1040872165 8:52111064-52111086 AAACACATCAAGTACAAAGTAGG + Exonic
1041215262 8:55594246-55594268 AAACTCATAAAGTCAAAAAATGG + Intergenic
1041430277 8:57773703-57773725 TAACTTATCATGTTCAAAAGAGG - Intergenic
1042687506 8:71458767-71458789 AAACTCAACGTGTACAAAATTGG - Intronic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1044288378 8:90437834-90437856 AAACTCAAGATCTCAAAAATTGG + Intergenic
1045145950 8:99344812-99344834 AAACTCATTATATAAAAAATTGG - Intronic
1045575629 8:103417026-103417048 AAAATGATAATGTCCATAATTGG - Intronic
1046253341 8:111663710-111663732 AGGCTCATCATCTCTAAAATGGG - Intergenic
1046647818 8:116805085-116805107 AAATTCCTCATCTGCAAAATGGG + Intronic
1046668292 8:117029800-117029822 AAAATCATCAAGTCCAATGTCGG + Intronic
1046900172 8:119515360-119515382 AAAGTCATCATCTCCTGAATCGG + Intergenic
1047707420 8:127513770-127513792 AAATTTCTAATGTCCAAAATGGG + Intergenic
1048144537 8:131827884-131827906 ATAGTCTTCATTTCCAAAATAGG + Intergenic
1048153413 8:131916487-131916509 ATACTCATCATATCCTAAAATGG - Intronic
1049951901 9:653196-653218 AGACTCTTCATGTCCAGACTAGG - Intronic
1050993279 9:12179711-12179733 AAACTCATTATGTTCTGAATTGG + Intergenic
1051237518 9:15017426-15017448 AAAGTCATCATTTCCTGAATGGG - Intergenic
1051262049 9:15273961-15273983 TAAATCAAGATGTCCAAAATGGG + Intronic
1052157876 9:25217023-25217045 ATCCTCAGCATCTCCAAAATTGG - Intergenic
1053223087 9:36327583-36327605 AAACTCAACATATCCAAATATGG - Intergenic
1053349923 9:37406956-37406978 AATCTCATCATGTTCAAAGAAGG - Intergenic
1053682501 9:40494824-40494846 ACACTCAACATGTCCAGAAAGGG - Intergenic
1053932484 9:43123150-43123172 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG + Intergenic
1054295600 9:63330324-63330346 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054393621 9:64634828-64634850 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054428269 9:65140041-65140063 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054502110 9:65881502-65881524 ACACTCAACATGTCCAGAAAGGG + Intronic
1055152140 9:73014307-73014329 TAACTTATCATGTGTAAAATGGG + Intronic
1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG + Intergenic
1056111573 9:83401393-83401415 AAACTCTTCATCTCAGAAATGGG + Intronic
1058801022 9:108544521-108544543 AATCTCATCATCTATAAAATGGG - Intergenic
1058926935 9:109675229-109675251 AAACTTATCATGTTCAAATTTGG + Intronic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1060724908 9:126000247-126000269 AATTTCCTCATCTCCAAAATGGG - Intergenic
1061459662 9:130726836-130726858 AAACCCTTCTTGTCCAACATAGG + Intronic
1186280981 X:7992838-7992860 AACCTCATCATTTCAAATATCGG + Intergenic
1186753067 X:12641615-12641637 AAACTTACCAAATCCAAAATTGG + Intronic
1187806870 X:23130256-23130278 ATACTCATCAATTCCAAAAGAGG + Intergenic
1188048072 X:25451073-25451095 AAAATAATTATTTCCAAAATAGG - Intergenic
1188246796 X:27845297-27845319 AAACACATCATGACCAAGAAGGG - Intergenic
1189280028 X:39814522-39814544 AGACACAGCATGACCAAAATGGG + Intergenic
1189328582 X:40129022-40129044 AGCTTCATCATGTGCAAAATAGG - Intronic
1190119005 X:47645173-47645195 AAACTGACCATCTCCAAAACTGG - Intronic
1192024822 X:67438461-67438483 AAACTCAACATATTCAAAATTGG + Intergenic
1193511979 X:82413510-82413532 GAACACAGCATGTCCAAAAATGG - Intergenic
1194914706 X:99691330-99691352 AATCTCTTCATTTCCAAGATAGG + Intergenic
1195336886 X:103863941-103863963 AAAAACATAATGTCCAATATTGG - Intergenic
1196194799 X:112828345-112828367 AATTTCATCATCTGCAAAATAGG + Intronic
1196318757 X:114264004-114264026 AAATGCACCATGTTCAAAATAGG + Intergenic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1198019356 X:132643227-132643249 AACCTCATCTTGTGCAAAACGGG + Intronic
1198453688 X:136793996-136794018 AAACTCAGTATGACCCAAATTGG + Intergenic
1198589200 X:138157608-138157630 ATACTCATCAAGTACAAACTAGG + Intergenic
1199046780 X:143183605-143183627 TAACTCATCAACTCTAAAATTGG - Intergenic
1199543866 X:148986745-148986767 AAACACTTGATGTCCAATATTGG - Intronic
1200021069 X:153209291-153209313 AACCTCATAATGTCCAATATTGG - Intergenic
1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG + Intronic