ID: 1078760261

View in Genome Browser
Species Human (GRCh38)
Location 11:14245826-14245848
Sequence AAGGAGAAGCAACACGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 243}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078760249_1078760261 8 Left 1078760249 11:14245795-14245817 CCCACCCAGCCCAGGAAATGCCT 0: 1
1: 0
2: 0
3: 29
4: 308
Right 1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG 0: 1
1: 1
2: 0
3: 16
4: 243
1078760247_1078760261 24 Left 1078760247 11:14245779-14245801 CCAGGGCAGGAGAAAACCCACCC 0: 1
1: 0
2: 3
3: 27
4: 221
Right 1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG 0: 1
1: 1
2: 0
3: 16
4: 243
1078760251_1078760261 4 Left 1078760251 11:14245799-14245821 CCCAGCCCAGGAAATGCCTTGCC 0: 1
1: 0
2: 0
3: 59
4: 295
Right 1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG 0: 1
1: 1
2: 0
3: 16
4: 243
1078760254_1078760261 -2 Left 1078760254 11:14245805-14245827 CCAGGAAATGCCTTGCCCTCCAA 0: 1
1: 0
2: 1
3: 8
4: 177
Right 1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG 0: 1
1: 1
2: 0
3: 16
4: 243
1078760253_1078760261 -1 Left 1078760253 11:14245804-14245826 CCCAGGAAATGCCTTGCCCTCCA 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG 0: 1
1: 1
2: 0
3: 16
4: 243
1078760250_1078760261 7 Left 1078760250 11:14245796-14245818 CCACCCAGCCCAGGAAATGCCTT 0: 1
1: 1
2: 1
3: 40
4: 363
Right 1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG 0: 1
1: 1
2: 0
3: 16
4: 243
1078760252_1078760261 3 Left 1078760252 11:14245800-14245822 CCAGCCCAGGAAATGCCTTGCCC 0: 1
1: 0
2: 3
3: 24
4: 403
Right 1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG 0: 1
1: 1
2: 0
3: 16
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078760261 Original CRISPR AAGGAGAAGCAACACGAGGC AGG Intronic
900545746 1:3228215-3228237 AAAGAGAAGCAAACCGAGGATGG + Intronic
900955184 1:5882450-5882472 AAGGAGAAAGAACAAGAGGCGGG - Intronic
902626290 1:17678264-17678286 CTGGAGAAGAAACACTAGGCTGG + Intronic
903443709 1:23407326-23407348 AAGGAACAGCAACACCAGCCAGG - Intronic
904324565 1:29719943-29719965 AAGGGAAAGCAGCACGAGGGTGG - Intergenic
904389641 1:30173793-30173815 GAGGAGAATAAACACCAGGCAGG - Intergenic
904576251 1:31506915-31506937 AATGAGAAGCAAAGGGAGGCAGG + Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906271642 1:44484026-44484048 AAGGAGAACCAGCCCAAGGCTGG - Intronic
907112773 1:51941404-51941426 AAGGAGAAGAGATAGGAGGCAGG + Intronic
913162342 1:116155622-116155644 TAGGAGAGGCAACATGGGGCAGG + Intergenic
914919907 1:151839603-151839625 AAGGAGGAGCCAGAGGAGGCAGG - Intronic
915038623 1:152949020-152949042 CAGGAGAGGCAGCACCAGGCTGG + Intergenic
915449722 1:155996216-155996238 AAAAAGAAGCAACACGATGATGG - Intronic
918200912 1:182266100-182266122 AAGGTGAAGCAAGACAAGGGTGG + Intergenic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
920036228 1:203067552-203067574 AAGGAGGAGCATGAGGAGGCTGG + Intronic
922564703 1:226594088-226594110 GAGGAGGAGGAAAACGAGGCAGG + Intronic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922975064 1:229777631-229777653 AAGGGGAAGCAACAGGAAGAGGG + Intergenic
923370188 1:233302618-233302640 AAGGAGAAGCAAAAAAATGCAGG - Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062837051 10:642424-642446 AGGGAGGAGCCACACGGGGCAGG + Intronic
1063789028 10:9419910-9419932 AAGGAGAAATTACATGAGGCTGG + Intergenic
1065475646 10:26135450-26135472 AAGGAGAATCAACATAAGGCAGG + Intronic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067251598 10:44591362-44591384 AAGGAGAAGCAAGGGGTGGCTGG - Intergenic
1067545521 10:47189927-47189949 AGGGAGGAGCAACAACAGGCAGG + Intergenic
1067829819 10:49605157-49605179 AAGGAGAGGCAAAACTGGGCAGG + Intergenic
1068150576 10:53125533-53125555 AAGGAGGAGGAAGACGAGGAGGG - Intergenic
1070175427 10:73965710-73965732 AAGGAGAAGAAGCACAAGGACGG + Intergenic
1070530980 10:77337309-77337331 AGGAAGAAGAAACACTAGGCCGG + Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1072450022 10:95532334-95532356 AAGGAGCAGGAACCAGAGGCCGG - Intronic
1072605873 10:96982301-96982323 AGGGAGAGGCCACACCAGGCTGG - Exonic
1072931350 10:99665833-99665855 AAGGAAAAGAAAGTCGAGGCTGG - Intronic
1075254088 10:120910544-120910566 AAGGACAGGAAACACGAGCCAGG - Intergenic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076375447 10:129980784-129980806 AAGGAGAAGGAAGACAAGCCAGG + Intergenic
1077256713 11:1587733-1587755 AAGAAGAAGAAACAAAAGGCTGG - Intergenic
1078547259 11:12255493-12255515 CAGGAGAAGCAAAACCAGCCAGG - Intronic
1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG + Intronic
1079689243 11:23401747-23401769 TAGGAGAAGCAAAACTAGGATGG - Intergenic
1080429316 11:32184143-32184165 AAGGAACAGCAACTGGAGGCTGG + Intergenic
1080463710 11:32477555-32477577 AATGAGAAGAAAAACAAGGCTGG + Intergenic
1080719111 11:34831980-34832002 AAGGTGAGGCACCAAGAGGCTGG + Intergenic
1080872370 11:36248109-36248131 AAGGAGAAGGAACAAGAAGGAGG - Intergenic
1082079296 11:47999778-47999800 AAGGAGAAGGAAAACTAGGGGGG + Intronic
1083291453 11:61692617-61692639 GGGGAGAAGGAACACCAGGCTGG + Intronic
1083551050 11:63590470-63590492 AAGGATAAGCAACAAGTGGAAGG + Intronic
1085235165 11:75008994-75009016 AAAGAGAAAAAACATGAGGCAGG - Exonic
1085691532 11:78668072-78668094 AAAGGGAACCAACACGAGCCAGG + Intronic
1086268798 11:85034544-85034566 AAGGAGAAAGAAGTCGAGGCTGG + Intronic
1088303750 11:108386615-108386637 ATGGAAAAGCACCAAGAGGCAGG + Intronic
1090100744 11:123794446-123794468 AAGGTGAGGCAACATGAAGCGGG + Intergenic
1090275605 11:125417240-125417262 AAGGAGCAGAATCACGTGGCAGG - Intronic
1090840035 11:130479392-130479414 AAGGAGCAGCAGCACCGGGCAGG - Intergenic
1090936394 11:131346719-131346741 AAGCAGAAGCCACACGAGCATGG - Intergenic
1093611469 12:21164401-21164423 GAGGAGAACCAACAGGAGGTGGG - Intronic
1093680492 12:21996538-21996560 ATGGAAAAGCAACAGGAGACAGG - Intergenic
1094144960 12:27219170-27219192 AATGAGAAGAAACTCTAGGCAGG - Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1095244920 12:39908544-39908566 AAGGAGAAGAAAGGCAAGGCGGG + Intronic
1095885984 12:47188891-47188913 AATAAGAAGCAACAGGAGTCTGG - Intronic
1100974875 12:100112036-100112058 AAGGAGAAGTAAATCTAGGCTGG - Intronic
1102625895 12:114235291-114235313 CAGGAGAATCAACAGGGGGCTGG - Intergenic
1102788597 12:115624341-115624363 AAGGAGGATCAAAACAAGGCTGG + Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105985659 13:25563685-25563707 AAGGAGAAGAAACAGAAGCCAGG - Intronic
1106109393 13:26763128-26763150 AAGGAGAAGCTACAGGAAACAGG + Intergenic
1106279877 13:28257251-28257273 AGGGAGAAGGAACAGGAGTCAGG + Intronic
1106548107 13:30747848-30747870 AGGGAGAAGCGACATGAGGGTGG - Intronic
1106553868 13:30793798-30793820 AATCAGAAGCAACTGGAGGCAGG + Intergenic
1108892969 13:55284796-55284818 AAGGAGAAGAAAGAAGAAGCAGG + Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1111282824 13:86049840-86049862 TAGAAAAAGCTACACGAGGCTGG + Intergenic
1112384248 13:98923271-98923293 AAAGAGAAGCAACAGCAAGCAGG + Intronic
1113558210 13:111255386-111255408 ATGGGCAAGCAACATGAGGCAGG - Intronic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1118767721 14:68921322-68921344 AAGCAGAAGAAAGAAGAGGCAGG - Intronic
1124685988 15:31782447-31782469 AAGGACAAGCCAAACTAGGCAGG + Intronic
1125301046 15:38253135-38253157 ATGGAGGAGCAACAGCAGGCGGG - Exonic
1125557077 15:40594643-40594665 ACGGACAAGCAACCCGAGCCGGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128681309 15:69653955-69653977 CAGGAGAAAGAACACGATGCTGG - Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1130612331 15:85372597-85372619 AAGAGGAAGAAACACCAGGCTGG - Intergenic
1130719597 15:86373532-86373554 GAGGAGAAGGTACACTAGGCAGG + Intronic
1131790417 15:95958441-95958463 AAGGAGAAGCATCTGGAGGCTGG - Intergenic
1136585327 16:31180658-31180680 AAGCTGAACCAACACGAGGCGGG - Intronic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG + Intronic
1138763529 16:59572215-59572237 AAGCAAAAGCAACCAGAGGCTGG - Intergenic
1139021054 16:62749897-62749919 AAGGAGGAGGAAGAAGAGGCAGG + Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139844528 16:69910703-69910725 AAGAAGAAGCCACAGTAGGCTGG - Intronic
1140209229 16:72958053-72958075 AAGGAGAAGCACCCGGAGCCGGG - Exonic
1140924013 16:79565642-79565664 AAGGGGAAGCAACATGAAGGCGG - Intergenic
1141196111 16:81862534-81862556 AAGGAAAAGCAACACCAGTGGGG - Intronic
1142002237 16:87670528-87670550 AAGGATAACCAACAGGAGGCTGG - Intronic
1142379048 16:89721501-89721523 AGCGAGAAGCAAAGCGAGGCGGG - Intronic
1143879467 17:10019066-10019088 AAGGGGATGCACCACGTGGCAGG - Intronic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150222115 17:63501544-63501566 AAGAAGAGGCAACACGGGGAGGG - Intronic
1155409880 18:25532140-25532162 AAAGAGAAGCAACAGGAAGAGGG + Intergenic
1156032442 18:32728187-32728209 AAGGTGAAGCAAGACGAGACAGG - Intronic
1157690086 18:49674456-49674478 AAGGAGAGGGAAGGCGAGGCAGG + Intergenic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1159949459 18:74471477-74471499 GAGGAGAAGGAGCAAGAGGCAGG - Intergenic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1162530035 19:11230677-11230699 AAGGAGGAGAAAGACAAGGCAGG + Intronic
1163143897 19:15368251-15368273 AAGGAGAAGAGACAGGACGCGGG - Exonic
1166088398 19:40492143-40492165 ATGGGGAAGCAACAAGGGGCAGG + Intronic
1167198010 19:48044034-48044056 AAGGAGAAGCCAAGAGAGGCAGG - Exonic
1167423836 19:49419291-49419313 AAGGAGAAGGATCACGAGATTGG + Intergenic
926335118 2:11857189-11857211 AAGGGGCAGAAACACGGGGCAGG + Intergenic
926574462 2:14564708-14564730 AAGAAGAAGAAACAGGAGGGAGG + Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
928373777 2:30759162-30759184 AAGGAGGAGAAAAACGAGGGAGG - Intronic
928719868 2:34107806-34107828 AAGCAGAAGCAACAAGATTCTGG - Intergenic
929341552 2:40825008-40825030 AAGGAAAAGAAACAGGAGGATGG + Intergenic
930673710 2:54177874-54177896 AAAGAAAAGAAACAGGAGGCCGG - Intronic
931209349 2:60177961-60177983 AAGGAGTAGCCTCAAGAGGCAGG + Intergenic
931967677 2:67551338-67551360 AAGGAGAAGCAACAAGGAGAAGG + Intergenic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
935135653 2:100298750-100298772 TGGGGGAAGCAACACGAGACAGG + Intronic
935305733 2:101734715-101734737 AAGAAGAAGCAACAGAAGGCAGG - Intronic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
937839660 2:126512592-126512614 ATGGAAACGCAGCACGAGGCAGG - Intergenic
938709186 2:133960733-133960755 AAGTAAAAGAAACATGAGGCCGG - Intergenic
939953998 2:148509698-148509720 AACAAGAAGCAACACAGGGCCGG + Intronic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
944084900 2:195834366-195834388 AAGGAGGAGAAAGACGATGCTGG + Intronic
945239266 2:207661191-207661213 AAGGAGAAGCGACAGCACGCAGG + Intergenic
945389579 2:209247659-209247681 ATAGAAAAGCAACAGGAGGCCGG + Intergenic
946080029 2:217109893-217109915 AAGGAGAATGAAGAGGAGGCTGG + Intergenic
947420003 2:229933562-229933584 AAAGAGAAGCATCATGAGCCGGG + Intronic
948831716 2:240601530-240601552 AGGGACAAACAACACCAGGCCGG - Intronic
1168833685 20:862157-862179 AGGATGAAGCAACATGAGGCTGG + Intergenic
1169792058 20:9421631-9421653 GAGGAGAACCAAAAGGAGGCAGG - Intronic
1170686219 20:18571852-18571874 AAGGAGAAGGAACAAGAAGAGGG - Intronic
1170728297 20:18948884-18948906 AAGGAGAGGGAACAAGGGGCTGG + Intergenic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1174775681 20:53341165-53341187 AAGGACAAGCAAACTGAGGCAGG - Intronic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1177069743 21:16489295-16489317 AAAGATAAGCAACAACAGGCTGG - Intergenic
1178759596 21:35389006-35389028 AAGCAGAACCAACACTGGGCGGG - Intronic
1179548613 21:42128548-42128570 ATAGAGAAGCAACACAAGGAAGG + Intronic
1182715094 22:32351935-32351957 AAGCAGAAGAAAAACCAGGCTGG + Intergenic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1184349651 22:43935471-43935493 AAGGAGAAGACACAGGATGCTGG + Intronic
1185088950 22:48755369-48755391 CAGGAGAAGCCACACTGGGCTGG + Intronic
955641642 3:61091959-61091981 AAAAAGAAGCAACAGGAGTCAGG + Intronic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
962866011 3:139448498-139448520 AAGGAGCTGCCACACTAGGCAGG - Intergenic
963111235 3:141689839-141689861 AAGAAGAAGCAACACGAGGCTGG + Intergenic
966396274 3:179506984-179507006 AAGGAGAAGCAACAGGTTGGAGG - Intergenic
966648032 3:182268711-182268733 AAGGAGAGGCAGCACTGGGCAGG - Intergenic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
968152258 3:196346176-196346198 AGTGAGAAGAAACACCAGGCAGG + Intergenic
969055701 4:4401386-4401408 CAGGAGAGGGAACACGAGCCCGG - Intronic
970107723 4:12603742-12603764 AAGGAGAAACAACGAAAGGCAGG + Intergenic
970388054 4:15576558-15576580 AAGAAAAAGAAACAAGAGGCAGG - Intronic
970422098 4:15914890-15914912 ATGGGGAAGCACCAGGAGGCAGG + Intergenic
975029850 4:69601301-69601323 CAGGAGCAAGAACACGAGGCTGG - Intronic
976022540 4:80646750-80646772 AAAGAGAAGCAACAGGAGAAGGG - Intronic
976379057 4:84378882-84378904 AATGAGAAGGAAGATGAGGCTGG + Intergenic
977474031 4:97481901-97481923 AATGAGAAGCAAGACAAGGATGG - Intronic
978804458 4:112785825-112785847 AACAAAAAGCAACACCAGGCTGG - Intergenic
980988501 4:139718376-139718398 AAGGAGAAGCAAGGGGAGGCTGG + Exonic
981358961 4:143825654-143825676 AAGGAGAAGGAAAACGAAGTTGG + Intergenic
983547498 4:168979102-168979124 AAGGAGGAGTAACAGGAGGAGGG - Intronic
983699972 4:170580080-170580102 AAGGAGAAGCAAGAGAGGGCAGG + Intergenic
984586399 4:181569507-181569529 AAGGGGAAACAACCCCAGGCTGG - Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
986386746 5:7242317-7242339 AAGGACAAGCACGACGTGGCAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
990290041 5:54340773-54340795 AAGGACAAGCAAGACGATGCAGG - Intergenic
990363143 5:55042150-55042172 AGGCAGAAGAAACAAGAGGCTGG + Intergenic
990609296 5:57441428-57441450 TAGGAGAAGCCACACTGGGCTGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995496930 5:112755988-112756010 AGGGAGAAACAACACAAAGCAGG - Intronic
996488919 5:124069025-124069047 AAGGAGAATCAACAGAAAGCCGG + Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
1000666281 5:164001546-164001568 GAGGACAAGAAACACGATGCAGG - Intergenic
1000850429 5:166333294-166333316 AAAGAGAAGCAGCAGGAGCCAGG + Intergenic
1003154544 6:3579672-3579694 CAAGAGAAGGAACATGAGGCCGG - Intergenic
1003881945 6:10487184-10487206 AAGCAGAAACAAAACGAGGGAGG + Intergenic
1004272814 6:14210815-14210837 ATGGATAAGCAACAAGTGGCTGG + Intergenic
1006500516 6:34456023-34456045 AAGGAGTATCCACATGAGGCAGG + Intergenic
1006896158 6:37472427-37472449 AAGAAGGAGCCACACGAGCCTGG - Exonic
1006905216 6:37528643-37528665 ATGGAGAAACAACACGATTCGGG + Intergenic
1007691732 6:43706839-43706861 AAGGTGAAACAACAGGAGTCCGG - Intergenic
1007755121 6:44094477-44094499 AAGATGAAGCAAAACCAGGCGGG + Intergenic
1008539548 6:52534825-52534847 AAGGAGCAGCAAGGCCAGGCAGG - Intronic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010508013 6:76684596-76684618 AAGGAGAAGCATCCTGAGCCTGG - Intergenic
1012349244 6:98231185-98231207 AAGGAAGAGCAACACAAGGAAGG - Intergenic
1013226191 6:108120756-108120778 AAGGAGGAGCAAGGCGAGGGAGG - Intronic
1013351928 6:109313605-109313627 GAGGAGAAGAAACAGGAGGTAGG + Intergenic
1014648522 6:124006229-124006251 AAGGAAAAGCAACAAGAGCAAGG + Intronic
1015647044 6:135403795-135403817 AAGGGGAAGGAAGACGAGGGGGG - Intronic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1018254721 6:161906482-161906504 AAGGAGAAGCCACTCGACTCTGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1019416204 7:927603-927625 AATCACAAGCAACAAGAGGCTGG + Intronic
1021850292 7:24801401-24801423 GAGGAGAAGAATCAGGAGGCTGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1024220659 7:47284113-47284135 AAGGCAAAGCCACACCAGGCGGG - Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028831133 7:95327602-95327624 AATGAGAAGCCACAAGAGGGAGG - Intergenic
1029202644 7:98849310-98849332 AAGGAGATGCAACAAGAAGAGGG + Intronic
1030006094 7:105121664-105121686 AAGGAAAACCAACAGGAAGCAGG + Intronic
1030114982 7:106056056-106056078 AGGAAGAAGCAACTTGAGGCCGG + Intergenic
1032018516 7:128394097-128394119 AAGGACAAGGAACAGGGGGCTGG + Intronic
1032128630 7:129211994-129212016 GAGGAGAGACAACACGAGCCTGG - Intronic
1032166909 7:129552804-129552826 CTGGAGAAGCAGCACCAGGCTGG - Intergenic
1032241423 7:130162256-130162278 AAGGATAAGCAGCACACGGCTGG - Intergenic
1033656610 7:143379842-143379864 CAGGTGAAGCAACACTGGGCAGG - Intergenic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1034393345 7:150802033-150802055 AAGGAGAAAGAAGAAGAGGCAGG - Intronic
1034487579 7:151375637-151375659 AAGGAGGAGCAAGACTAGTCAGG - Intronic
1035731650 8:1857712-1857734 ACAGAGAAGAAACAAGAGGCTGG - Intronic
1036705506 8:11043392-11043414 AAGGAGCAGGAAGAGGAGGCTGG - Intronic
1037141509 8:15525885-15525907 TAGGAAAAGAAACAAGAGGCAGG + Intronic
1037908809 8:22731215-22731237 GAGGAGGTGCAACAGGAGGCGGG - Intronic
1038547473 8:28436505-28436527 AAGGCTAAGCAACTCGAGCCAGG + Intronic
1039108654 8:34018097-34018119 AAGGGGAAGCATCCCAAGGCAGG + Intergenic
1039714717 8:40095040-40095062 AAGGGGAGGCACCAGGAGGCAGG - Intergenic
1039805499 8:40994276-40994298 AAGGAAAAGCAACAGGATGGTGG + Intergenic
1041265729 8:56062803-56062825 AAGAAGAAACCACAAGAGGCCGG + Intergenic
1045834863 8:106507965-106507987 AAGAAGAAGCCAGAGGAGGCTGG - Intronic
1046840175 8:118847452-118847474 AAGGAGAAGGAACACTATGGTGG + Intergenic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1047680267 8:127247571-127247593 AGGGAGAAGCATCTGGAGGCTGG + Intergenic
1047919786 8:129622982-129623004 AAGGAGAAAGAACATGAGACTGG + Intergenic
1048963814 8:139600700-139600722 AAGGAGCAGCAAAAAGGGGCAGG + Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1050643107 9:7690297-7690319 AAGGAGAAAAAACAGGAAGCAGG + Intergenic
1052563926 9:30122152-30122174 AAGCAGAAGCAAGACAAGGGGGG + Intergenic
1052786364 9:32831829-32831851 GAGGAGAAGGAAGACAAGGCAGG + Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1057111803 9:92479132-92479154 AAGGAGAAGGCACACAGGGCAGG + Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057480234 9:95439557-95439579 GAGGAGAAGCAAGACAAGGCAGG - Intergenic
1058574736 9:106388525-106388547 AATGAGAAGCAACATGATCCAGG - Intergenic
1059443903 9:114326325-114326347 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059445110 9:114333102-114333124 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1061147258 9:128807381-128807403 AGGGAAAAGCAACTCTAGGCTGG - Intronic
1187288559 X:17930233-17930255 AGGGAGAAGAAACAGTAGGCAGG + Intergenic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1196842199 X:119869227-119869249 AGGGAGATGGAACACGAGGCCGG - Intergenic
1199408576 X:147492717-147492739 GAGGAGAGGCAACACTAGGCAGG + Intergenic
1199756689 X:150871381-150871403 AAGCACTAGAAACACGAGGCAGG + Intronic