ID: 1078764951

View in Genome Browser
Species Human (GRCh38)
Location 11:14287419-14287441
Sequence GGGTAAATATGATTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078764951 Original CRISPR GGGTAAATATGATTGGGGGA AGG Intronic
901070102 1:6512729-6512751 GGGTAAATGTGAGACGGGGAGGG - Intronic
902680083 1:18037157-18037179 GGCCAAATGTGATTGGGGTAGGG + Intergenic
904334232 1:29786571-29786593 GGGTCAAAATGCCTGGGGGAAGG + Intergenic
904847963 1:33435039-33435061 GTGTATATATGGATGGGGGAAGG - Intergenic
905707578 1:40073159-40073181 TGGTAAATGTGTTTTGGGGATGG + Exonic
906665170 1:47616275-47616297 GGGTGACTATGATTTCGGGATGG - Intergenic
907571406 1:55487496-55487518 TGGTGAATAGGCTTGGGGGAGGG + Intergenic
910727688 1:90355952-90355974 TGGGAAATATAATTGGGAGAGGG + Intergenic
914403028 1:147341646-147341668 GGGTGTATGTGATGGGGGGAAGG - Intergenic
915977737 1:160401462-160401484 GGGTAAATATGAGTGGGGAGAGG - Intronic
917067703 1:171114786-171114808 TGGAAAATATGATTGCTGGAAGG + Intronic
917507943 1:175646071-175646093 GGGTGAATGTGTTTGGGGCAGGG + Intronic
920026976 1:203006243-203006265 GTGTAAAGAGGCTTGGGGGAAGG - Intergenic
921971602 1:221155081-221155103 GGGTGAGAATGATTGGGGGTGGG + Intergenic
1064254330 10:13731278-13731300 GGGGAAACATCATTGGGTGAAGG + Intronic
1065214429 10:23437055-23437077 TGGTAAATATTATTTGGTGACGG + Intergenic
1066701010 10:38128229-38128251 GGGTTAATATAATAGGAGGAAGG + Intergenic
1069673356 10:70229843-70229865 GAGCAAATATAATTTGGGGAAGG - Intronic
1070854527 10:79595780-79595802 GGAAAACTAGGATTGGGGGAGGG - Intergenic
1071471595 10:85987521-85987543 GGGTAATTAGGTTGGGGGGAAGG - Intronic
1071928297 10:90436738-90436760 GGGGAAAGAGGAATGGGGGAAGG - Intergenic
1078764951 11:14287419-14287441 GGGTAAATATGATTGGGGGAAGG + Intronic
1078884686 11:15488615-15488637 GGGAAAATATAACTGGGGCAGGG + Intergenic
1079398255 11:20084553-20084575 GGGTAAAATTGAATGGGGGAAGG + Intronic
1079792207 11:24752559-24752581 GGGAAAATATGATTGGAGTGAGG + Intronic
1080802427 11:35619986-35620008 GGGTATGGATGATGGGGGGAAGG + Exonic
1081056496 11:38415885-38415907 TGTTAAATATGAGTGGAGGAGGG + Intergenic
1083043089 11:59707168-59707190 GGGTAAAGGAGATTGGGAGAAGG - Intergenic
1087450345 11:98313416-98313438 GCTTTAATATGACTGGGGGAGGG - Intergenic
1089981183 11:122773849-122773871 GGATATATTTCATTGGGGGAAGG + Intronic
1091068985 11:132545091-132545113 ACGTACATATGATTGGGGGAGGG + Intronic
1091521789 12:1252900-1252922 GTGTATATATGCTTAGGGGATGG + Intronic
1092286772 12:7133145-7133167 AGGTAATTGGGATTGGGGGATGG + Exonic
1093820900 12:23616389-23616411 GGGGAAAAGTGATTGGGGAAAGG + Intronic
1096096917 12:48941547-48941569 GGGTAAGTAAGGTTAGGGGAGGG - Intronic
1097013483 12:55969342-55969364 GGGGAAAGATGATGGAGGGAAGG + Intronic
1097847381 12:64380611-64380633 GGGTAAGTGTGATGGGGGAATGG + Intronic
1103517143 12:121515088-121515110 TGGGAAGTGTGATTGGGGGACGG - Intronic
1103517277 12:121515519-121515541 GGGCAAGTGTGATTCGGGGAGGG - Intronic
1103718587 12:122961123-122961145 GGGTAAATAGGATGGGGTGAGGG + Intronic
1104505712 12:129330390-129330412 GTGTCAACATGATTTGGGGAGGG - Intronic
1106340554 13:28822732-28822754 GGGTTTATATAATTGGGGGGTGG - Intronic
1106934599 13:34704316-34704338 GGGTAAGTGTGAGTGTGGGAAGG - Intergenic
1106997049 13:35496879-35496901 TGGTAAATTTGTTTGGGGGAAGG - Intronic
1107908899 13:45086821-45086843 GGGTAAATATGAATTTTGGAGGG + Intergenic
1112102277 13:96202412-96202434 GGTTATAGATGATTGGGGCAGGG - Intronic
1117480130 14:56134858-56134880 TGGGAAATTGGATTGGGGGATGG - Intronic
1117861104 14:60093349-60093371 GGGTAAGGATAATGGGGGGAGGG - Intronic
1118283201 14:64447869-64447891 TGGTAAATATAATTTGGGTAAGG + Intronic
1119151713 14:72366348-72366370 GGATAGATATGTTTGGGAGAAGG + Intronic
1119155727 14:72408823-72408845 GGATAAAAATGATGGGAGGATGG + Intronic
1121517972 14:94566158-94566180 GGGTAAGTATGATAGAGGGAGGG - Intronic
1125121071 15:36159320-36159342 GTGTATATGTGGTTGGGGGAAGG - Intergenic
1128701720 15:69809485-69809507 GGGCAGATCTGATTTGGGGAGGG - Intergenic
1128736792 15:70058111-70058133 GGGTTAATCTGATTGGGGGGAGG - Intronic
1129356902 15:74997334-74997356 GGCTTAATCTGATTGGGGGAGGG + Intronic
1131935410 15:97498893-97498915 GGGTAACTATGCTTTGGGAAAGG - Intergenic
1132370856 15:101297058-101297080 AGGAAAATATGATGGGGGTAAGG - Intergenic
1133630727 16:7617914-7617936 GGGTAAAGATCATTGCAGGAGGG + Intronic
1135270240 16:21063096-21063118 GGTTTAATAGGACTGGGGGATGG + Intronic
1138544385 16:57706985-57707007 GGGGAAAGAGGATTGGAGGAAGG - Intronic
1140140514 16:72252302-72252324 GGGTAAGAATGATTGGGAGTGGG + Intergenic
1140452063 16:75079019-75079041 GGGTAGATAAGAATGGGAGAAGG - Intronic
1140774276 16:78235768-78235790 TGGTCAAGGTGATTGGGGGAAGG + Intronic
1142478632 17:204623-204645 GGGTGAGGATGGTTGGGGGATGG - Intergenic
1143485487 17:7251612-7251634 GGGGAAGGATAATTGGGGGAGGG + Intronic
1146498870 17:33347334-33347356 GTGTAAGTATTTTTGGGGGAAGG + Intronic
1146622676 17:34411758-34411780 TGGTAAATATGTTGGTGGGAGGG - Intergenic
1146773947 17:35595633-35595655 TGGTAGATTTGATTGGGGGGAGG + Intronic
1147318899 17:39634282-39634304 GGGAAAACCTGATTGGGAGAGGG - Intronic
1147544300 17:41388428-41388450 GTGTGAACATGTTTGGGGGAGGG + Intronic
1147766868 17:42842914-42842936 GTGGAAATATTATTGGGGGTTGG - Exonic
1148744759 17:49912024-49912046 GGGTAAATTAGATTGGGGGTGGG + Intergenic
1149366149 17:55946914-55946936 GGGTGTATATGTTTGGGTGACGG - Intergenic
1151246962 17:72802632-72802654 GGGTTAATTTGAGTGGGGAAGGG + Intronic
1152628346 17:81398655-81398677 GGGCGAATTTGATTGGGGGGCGG + Intronic
1153582918 18:6593651-6593673 AGGTACACATGACTGGGGGAGGG - Intergenic
1153735863 18:8066537-8066559 GGGTCAATATCAATGGGGGTAGG - Intronic
1154046264 18:10908025-10908047 GGGAAAATGTGATTGTGTGAAGG + Intronic
1166132540 19:40754827-40754849 GGGTAAATGCGAATGGGCGAGGG + Intronic
928816415 2:35300175-35300197 TGGTAAAATTGATTGTGGGAGGG - Intergenic
929001287 2:37349405-37349427 AGTTAAAGATGCTTGGGGGAGGG + Intronic
929467326 2:42156732-42156754 GGGGAAATGTGATGGGGGCAGGG + Intergenic
929594990 2:43170241-43170263 GGCTAAGTGTGAATGGGGGATGG + Intergenic
930167018 2:48212902-48212924 AGGTAAATATAATTGGGCAAAGG - Intergenic
930747316 2:54898041-54898063 GAGAAAATAAGGTTGGGGGAGGG + Intronic
932202442 2:69843361-69843383 GGAAAAATAGGATAGGGGGATGG + Intronic
935568164 2:104631441-104631463 AGGTAGATGTGACTGGGGGAGGG + Intergenic
935865229 2:107380797-107380819 GGGAAAATATGAATTAGGGAGGG - Intergenic
936963483 2:118101563-118101585 GGATATATATGGTGGGGGGATGG + Intronic
939709718 2:145502104-145502126 GGGTCACTAAGATTGGGGGCAGG + Intergenic
941862411 2:170297307-170297329 GGGTGCATGTCATTGGGGGAGGG - Intronic
942441293 2:176039549-176039571 GGGTAAAAGTGATTGGGGAAGGG - Intergenic
942532003 2:176921118-176921140 GGGAAAATAGGAATTGGGGAGGG - Intergenic
944379813 2:199095111-199095133 GGCTAAATATGTGTGGGGGCAGG + Intergenic
944770333 2:202907840-202907862 GGGTATATATGCTTAGGAGAGGG - Intronic
948958256 2:241312048-241312070 GAGGAAACATGATTAGGGGAAGG + Intronic
1169140506 20:3224785-3224807 GGGTACATAGGCTTGGGGCAGGG + Intergenic
1169386697 20:5156019-5156041 AGGCAAAAATGAATGGGGGAGGG + Intronic
1169717170 20:8632782-8632804 GGGTAAGCAAGATTGAGGGAAGG + Intronic
1169788688 20:9386847-9386869 GGGGAAATATGAATGTGGGCTGG - Intronic
1172176127 20:32972862-32972884 GGCTAGAGATGAGTGGGGGATGG + Intergenic
1173445845 20:43117415-43117437 AGGAAAATAAGATTGGAGGAAGG - Intronic
1175461307 20:59153619-59153641 GGGCAAATGTGGTTGGGGGCTGG + Intergenic
1177318614 21:19492898-19492920 GGGTAAATCTGAGTTTGGGATGG - Intergenic
1177548087 21:22584910-22584932 GGGAAAATATATTTTGGGGAGGG + Intergenic
1178573836 21:33766828-33766850 GCGTAAAAAGGATTGGGAGACGG + Intronic
1179472639 21:41621803-41621825 GGGTGAAGCTGGTTGGGGGAGGG - Intergenic
1183679453 22:39319186-39319208 AGGTAAAGAAGCTTGGGGGAGGG - Intronic
950180525 3:10909931-10909953 GGGTAAATACAATTTGGGGGAGG - Intronic
950981953 3:17316436-17316458 GAGTAGATATGATATGGGGATGG - Intronic
951246793 3:20350400-20350422 GTGTCAATTTGATTGGGGTAAGG + Intergenic
952052056 3:29395874-29395896 GGGTAAATATGGATGGAGGCTGG + Intronic
953295358 3:41710427-41710449 GGCTAAATATGGCTGGGGGCAGG - Intronic
953810652 3:46109557-46109579 GGCTAAACAAGATGGGGGGAAGG + Intergenic
955429067 3:58823031-58823053 GGAGAAATATGATTGGGCAAAGG - Intronic
957536309 3:81508600-81508622 GAGTAAGTTTGTTTGGGGGAAGG - Intronic
957954359 3:87164778-87164800 TGGTAAGTTTGATTTGGGGAAGG - Intergenic
959714451 3:109417286-109417308 GGGTAATTATGGTTGAGGGTAGG - Intergenic
959768923 3:110069273-110069295 GGGTAAATATGAGAGGGGCAAGG + Intergenic
960114969 3:113884960-113884982 GGGGAAGGATAATTGGGGGAGGG - Intronic
960325703 3:116293056-116293078 TGGTACATATGATAGGGTGAAGG - Intronic
962596069 3:136944984-136945006 GGTTACATATGACTGGGGTAAGG + Intronic
964060449 3:152515612-152515634 GGGAAAATTGGATTTGGGGAGGG + Intergenic
965017688 3:163179504-163179526 AGGTAAATATGATTGTGTAATGG - Intergenic
966491718 3:180534688-180534710 TGGTAAATAGCATAGGGGGAAGG - Intergenic
969836240 4:9844289-9844311 GGAGAAAAATGAGTGGGGGAAGG - Intronic
972893952 4:43595680-43595702 GAGTAAATGTGTTTGGGGGTGGG - Intergenic
975707129 4:77122338-77122360 TGGTAAATAGGTTTGGGGAAAGG - Intergenic
975893947 4:79063486-79063508 GGGAAAACATGATTAGGGGAGGG - Intergenic
977120576 4:93094641-93094663 GTGCATAGATGATTGGGGGAAGG + Intronic
978789195 4:112643273-112643295 TATTAAATATGATTGTGGGAGGG + Intronic
983481937 4:168285738-168285760 GGGTGGATATGCATGGGGGATGG + Intronic
984784392 4:183554256-183554278 GGGTAAGTGTGGATGGGGGAGGG + Intergenic
984875623 4:184365016-184365038 GGGCAGATTTGAGTGGGGGATGG + Intergenic
985272433 4:188206927-188206949 GAGTGAATATGAGTGAGGGAGGG + Intergenic
986302171 5:6486379-6486401 GGCTCACTATGCTTGGGGGAGGG - Intronic
986460475 5:7965593-7965615 GGGTAAAGATCATTGTGGTAGGG - Intergenic
986920255 5:12671609-12671631 GTGTATATATGTGTGGGGGATGG + Intergenic
987453225 5:18111756-18111778 GTATATATATGATTGGGGAAAGG + Intergenic
987913678 5:24184279-24184301 CGGCAAATATGATTGTGGGGAGG - Intergenic
987985302 5:25138132-25138154 GACTACATATGATTGGGGGAGGG + Intergenic
988181725 5:27803638-27803660 GGGTAAAGATTAATGGGGCAAGG - Intergenic
988289749 5:29270273-29270295 GGGAAACTGTGAGTGGGGGATGG + Intergenic
989263189 5:39442268-39442290 GGGTAAATTTTCTTGGGGCAGGG - Intronic
990432170 5:55746770-55746792 GGGGAAAAATGATGGTGGGAGGG - Intronic
991340838 5:65606742-65606764 GGGTAAGCATTATTGAGGGAAGG - Intronic
993320594 5:86464353-86464375 GGATAACTATGATTTGGGGGTGG - Intergenic
993573830 5:89576991-89577013 GGTTGAATTTGATTGGGGCAGGG - Intergenic
993908614 5:93652773-93652795 GGTCAAATATGTTTGGGAGATGG - Intronic
994262695 5:97678842-97678864 GGTTAATTATTAGTGGGGGAGGG + Intergenic
995194518 5:109348770-109348792 GGGAAAATATGACTGGGTCATGG + Intronic
997845589 5:137283151-137283173 GGGTATCTTTGATTGGGGTAAGG + Intronic
998290512 5:140909916-140909938 GAGTAACTGTGATTGGGGAAAGG - Intronic
998358345 5:141560927-141560949 GGGGAAAGATGAGGGGGGGAAGG + Intronic
998529985 5:142875517-142875539 GGTTCAATAAGATGGGGGGAGGG - Intronic
999151627 5:149430224-149430246 AGATGAATAAGATTGGGGGAAGG - Intergenic
999329101 5:150660696-150660718 GGGTAAACAAGCTTTGGGGAAGG - Intergenic
1001416661 5:171549536-171549558 GCGTAAAAATGAGTGTGGGATGG + Intergenic
1002816465 6:685686-685708 TGTTAACTATGATTTGGGGATGG - Intronic
1003467475 6:6394579-6394601 GAGTGAAAATGATTGGGTGAAGG + Intergenic
1004796805 6:19095403-19095425 GGGTAGATATGAATGGAGGAAGG - Intergenic
1007548680 6:42712519-42712541 GGGAAAATGTGTTTGGGGGAGGG + Intronic
1011620487 6:89237804-89237826 GGGAAAATATCATAGGGAGAAGG - Intergenic
1015902672 6:138083724-138083746 GAGGAAATTGGATTGGGGGATGG + Intergenic
1015973583 6:138767389-138767411 GAGTAAACAGGATTAGGGGATGG - Intronic
1017955245 6:159171673-159171695 GGATGAATATGAGTGGAGGAGGG - Intronic
1018089959 6:160337731-160337753 GGGGTCACATGATTGGGGGATGG + Intergenic
1022233319 7:28436395-28436417 GGGCAAACATGGTCGGGGGAGGG - Intronic
1022561969 7:31358764-31358786 GGGTAGAGATGACTGGAGGAAGG - Intergenic
1022691280 7:32657787-32657809 AGGTGAATAGGATTGGGAGAGGG - Intergenic
1022918843 7:34991692-34991714 AGGTGAATAGGATTGGGAGAGGG - Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1028380331 7:90192671-90192693 GAGTAAATAGGCTTGGGGGGTGG + Intronic
1039000708 8:32976887-32976909 GGGTAAAGGAGGTTGGGGGAGGG - Intergenic
1041379197 8:57235239-57235261 TGGTAAACCTGGTTGGGGGAAGG + Intergenic
1041423304 8:57693200-57693222 GGATAAATATTGTTGGGGAAGGG + Intergenic
1042043726 8:64623982-64624004 GGGAAACTGTGATTGGGGGGAGG + Intronic
1042706863 8:71672727-71672749 GGGAAAATGTCATTTGGGGAAGG - Intergenic
1044187324 8:89269978-89270000 AGGTAAAGATGAATGAGGGAAGG + Intergenic
1044517661 8:93157878-93157900 GTGGAAATTGGATTGGGGGATGG - Intronic
1047576586 8:126162290-126162312 GGGGGTATATCATTGGGGGAGGG + Intergenic
1047594449 8:126364253-126364275 GCGTTAAGATGACTGGGGGAAGG + Intergenic
1047760499 8:127950588-127950610 GAGAAAAGCTGATTGGGGGATGG + Intergenic
1051140719 9:13976453-13976475 GGGAAAATATACCTGGGGGATGG + Intergenic
1051606991 9:18926163-18926185 GGGGAAATATCAATGGGGGAAGG + Intergenic
1051997108 9:23230947-23230969 TTGTAAGTATGATTAGGGGAGGG - Intergenic
1055024683 9:71707189-71707211 GGGTAAACTTAATTTGGGGAAGG + Intronic
1055178856 9:73357761-73357783 AGATAAATAATATTGGGGGAGGG - Intergenic
1055988845 9:82083506-82083528 TGGTAAATATAAATGGGTGATGG + Intergenic
1056518253 9:87375365-87375387 GTGTAAATGTGGTTGGGGGTGGG + Intergenic
1056589612 9:87955613-87955635 GGGTAGATAGGATGGGGGAATGG - Intergenic
1056970421 9:91196440-91196462 GGGGTACTATGATTGGAGGAGGG - Intergenic
1058466726 9:105236341-105236363 GGGTATACATTTTTGGGGGATGG + Intergenic
1060214226 9:121728800-121728822 GTGTAAATGAGATTTGGGGAGGG + Intronic
1187221642 X:17332345-17332367 GGGTAATTATGATTGTAGGAAGG + Intergenic
1187296061 X:18001787-18001809 GGGTTAATATTATTGTGGGCAGG + Intergenic
1190730081 X:53220116-53220138 GGGTACATAATAATGGGGGAGGG + Intronic
1192370856 X:70511873-70511895 GGGTAAATCGGATTGGAGAAGGG - Intergenic
1192602262 X:72477481-72477503 GGGTAAAGAAGAGTGAGGGAAGG - Intronic
1194046873 X:89018168-89018190 GGGTAAATTTTTTTGGGGGGGGG + Intergenic
1194711786 X:97244654-97244676 GGAAAAATATGATAGGGAGAAGG + Intronic
1195708759 X:107757650-107757672 GGGTGAATATGAGGGAGGGAAGG - Intronic
1196059558 X:111392842-111392864 TGCTAAACAGGATTGGGGGAGGG - Intronic
1197464391 X:126784853-126784875 GAGTACATGAGATTGGGGGAGGG + Intergenic
1198219866 X:134589244-134589266 GGGAAAATAAGTATGGGGGATGG + Intronic
1199252395 X:145678337-145678359 GGGTAAACCTGTTTGGGGGAAGG - Intergenic
1201510079 Y:14749417-14749439 TGCTAAATATGATAGGTGGAGGG - Intronic