ID: 1078765414

View in Genome Browser
Species Human (GRCh38)
Location 11:14292215-14292237
Sequence TGCCCACTAGAACCCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078765414_1078765422 22 Left 1078765414 11:14292215-14292237 CCTCTTTGGGGTTCTAGTGGGCA 0: 1
1: 0
2: 2
3: 9
4: 109
Right 1078765422 11:14292260-14292282 TCTGCCACTGCCTACCCTACAGG 0: 1
1: 0
2: 1
3: 22
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078765414 Original CRISPR TGCCCACTAGAACCCCAAAG AGG (reversed) Intronic
900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG + Intronic
900946033 1:5831925-5831947 TGCCCACTGGAAGCCCAGACGGG + Intergenic
901559744 1:10060618-10060640 TGGCTACTAGAACCCCAGAAAGG - Intronic
901877396 1:12174740-12174762 TGCCCACTAGTGTCCAAAAGAGG - Intronic
902147038 1:14410809-14410831 CGGCCACCAGAACCCGAAAGAGG + Intergenic
904090537 1:27941894-27941916 TGCCCACCTGGACCCCAAGGAGG + Intronic
907713337 1:56904792-56904814 TGCCATCTAAGACCCCAAAGAGG - Intronic
908480296 1:64533041-64533063 TTCCCAACAGAGCCCCAAAGAGG + Intronic
910547143 1:88431284-88431306 TGGACATTAGAAACCCAAAGTGG - Intergenic
915689983 1:157679299-157679321 TGCTCATTATAACCCCAGAGGGG + Intronic
916884430 1:169053158-169053180 TGCCAATTAGAAATCCAAAGCGG + Intergenic
917589167 1:176459412-176459434 TGACCTCTGGAGCCCCAAAGGGG + Intergenic
919105742 1:193148310-193148332 TGCCAAAAAGAACCCCAAACTGG - Intronic
920209284 1:204316346-204316368 TGCCCACAAGAAACCCAAGTAGG + Intronic
920298795 1:204975961-204975983 TGCACACTGGAACCCCCAGGGGG - Intronic
921491105 1:215776984-215777006 TGCCCAATACAGCCCTAAAGAGG - Intronic
922169751 1:223144288-223144310 TGCCCACCCGAACCCCACTGTGG + Intergenic
1065585111 10:27210327-27210349 TGCCAAGTTAAACCCCAAAGAGG + Intronic
1067820921 10:49529452-49529474 AGCCCACTAGAAGCCCAAGAAGG + Intronic
1073323106 10:102627642-102627664 TGCCCACCAGAACTCCCCAGCGG - Intronic
1075580469 10:123614033-123614055 AGCCAAGTAAAACCCCAAAGTGG + Intergenic
1078481316 11:11678503-11678525 TTCCTCCTAAAACCCCAAAGAGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079966798 11:26989915-26989937 TGCAGCCTAGAAACCCAAAGGGG - Intergenic
1080940365 11:36910867-36910889 TGCCCAGTGGAACCTCATAGAGG - Intergenic
1081237859 11:40667664-40667686 TGCCCTCTAGGAGCCCAGAGTGG + Intronic
1081558858 11:44193828-44193850 TGCCCACTTGCATCCCAAATAGG - Intronic
1085604212 11:77882690-77882712 CCACCACTAGAACCCCAAAGGGG + Intronic
1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG + Intronic
1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG + Intronic
1097767497 12:63542797-63542819 TGCCCACTCAGACCCCAAAGTGG + Intergenic
1097783867 12:63737845-63737867 TGCCCACTCAGACCCCAAAGTGG + Intergenic
1099470481 12:83042005-83042027 TGCAAACAAGAACCTCAAAGTGG - Intronic
1100013518 12:89981585-89981607 TGACCACTTGCACCACAAAGAGG - Intergenic
1101499840 12:105292934-105292956 TGCCAACTAGAACTCCAAAGTGG - Intronic
1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1101831816 12:108263779-108263801 TCCCCACTGTAACCCCAAGGTGG + Intergenic
1104351578 12:128048576-128048598 TGTCCACTAGAACCTTAGAGTGG - Intergenic
1115449702 14:33532397-33532419 TGCTGAAGAGAACCCCAAAGAGG - Intronic
1116082944 14:40199391-40199413 TTCCCACCAGAACCACAGAGAGG - Intergenic
1119046462 14:71321629-71321651 TGTCCCCAAGACCCCCAAAGGGG - Intronic
1119887139 14:78152583-78152605 TGCCCACACCAACACCAAAGTGG - Intergenic
1120076248 14:80161934-80161956 TCTTCACTAGAACCCCAAAATGG - Intergenic
1120174348 14:81277394-81277416 TGCCCACCACCACCACAAAGTGG - Exonic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1124438694 15:29671754-29671776 AGCCCACAAGGACCCCAGAGAGG - Intergenic
1128462866 15:67884587-67884609 TTCCCTCCAGAACCCCACAGCGG + Intergenic
1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG + Intergenic
1128894971 15:71364573-71364595 AGCCCTCTTGAACCCCTAAGGGG - Intronic
1129078840 15:73021839-73021861 TGACCCTTAGACCCCCAAAGAGG + Intergenic
1134099737 16:11443614-11443636 TGCCTACTAGAACCCCATCCGGG - Intronic
1135717002 16:24779998-24780020 TGACCACTTAGACCCCAAAGAGG + Intronic
1142131031 16:88431556-88431578 TGGCAACTGGAACCCCCAAGGGG - Exonic
1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG + Intronic
1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG + Intronic
1144013937 17:11175833-11175855 CTTCCGCTAGAACCCCAAAGTGG + Intergenic
1147129307 17:38397252-38397274 TCCCCACTGGAACCACAGAGAGG - Intronic
1148783466 17:50134195-50134217 TCCCCACTTTAACCCCAAATTGG - Exonic
1151492352 17:74440139-74440161 TGGCGAACAGAACCCCAAAGAGG - Exonic
1153578142 18:6543556-6543578 TGCCCACTAGTAATTCAAAGGGG + Intronic
1154071413 18:11155544-11155566 AGCACACAAAAACCCCAAAGTGG - Intergenic
1157856173 18:51107569-51107591 TGCCCACCATACCACCAAAGAGG + Intergenic
1157988362 18:52465561-52465583 TTCACAATAGATCCCCAAAGAGG + Intronic
1163003324 19:14382332-14382354 TGCCCCCAAGAAACCCAAGGTGG - Intronic
935688858 2:105712305-105712327 TGGCCACTGGAACCCCCAGGGGG - Intergenic
936261853 2:110966563-110966585 TGCCCCCTAAACCCCTAAAGGGG + Intronic
936683050 2:114797087-114797109 TGCCCACAAGAATACCAAACTGG + Intronic
937167913 2:119837743-119837765 GGAACACAAGAACCCCAAAGAGG - Intronic
938224919 2:129607320-129607342 TGCCCACCCCAACCCAAAAGGGG + Intergenic
938382268 2:130843372-130843394 TGCCCTCTTGAACCCTACAGAGG + Intronic
940677769 2:156746234-156746256 TGGCAACTAAAACCCCAAACAGG + Intergenic
946193738 2:218021392-218021414 TGCCTAATAGCACCCCCAAGAGG + Intergenic
1172611367 20:36255303-36255325 TGTCCAGTAGAACCCCCCAGGGG + Intronic
1179798645 21:43799983-43800005 TCCCCACCAGCACCCCAACGAGG - Intronic
1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG + Intronic
1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG + Intronic
1184199519 22:42957166-42957188 TGCCCACTAGAACACCAGGAGGG + Intronic
1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG + Intronic
952701781 3:36336182-36336204 TCCCCACTAGAACTGTAAAGTGG + Intergenic
952985966 3:38783628-38783650 TGCCCATAAAAACCCCAAACCGG - Intronic
953150871 3:40323166-40323188 GGCCAATTAGAACCCCATAGTGG + Intergenic
955957136 3:64302552-64302574 TGGCAACTAGAATCACAAAGAGG + Intronic
957405271 3:79767351-79767373 TGCCCCCAAGAAGCCAAAAGCGG + Intronic
964406746 3:156356472-156356494 GGGACAATAGAACCCCAAAGAGG + Intronic
965242738 3:166224770-166224792 TGCCCTTTGGAACCCCTAAGGGG + Intergenic
968764559 4:2461510-2461532 TGCCCACCAGCTCCCCAAGGTGG + Intronic
971084062 4:23249873-23249895 GGTTCACTAGAACCACAAAGGGG - Intergenic
977357082 4:95960010-95960032 TGCCCATTGCAGCCCCAAAGAGG - Intergenic
984580841 4:181508363-181508385 TTCACACTGGAACTCCAAAGAGG + Intergenic
986339880 5:6779837-6779859 TTCCCACTAGAGCCCCCAAAAGG + Intergenic
986339981 5:6780551-6780573 TGCCCTCTAGTAGCCCAAAGGGG - Intergenic
987068735 5:14315551-14315573 TGCTTACTAGAAACTCAAAGAGG + Intronic
987606625 5:20144166-20144188 TGCCCTCTGGAACCTCAAAGAGG - Intronic
993521939 5:88913729-88913751 AGTCCAATAGAACTCCAAAGAGG - Intergenic
997432010 5:133847359-133847381 TGCCCATTGGTGCCCCAAAGGGG - Intergenic
998252657 5:140563289-140563311 TGTGGACCAGAACCCCAAAGTGG + Intronic
998766673 5:145496258-145496280 TGCCCACTAGACATCCAAATAGG + Intronic
1000719790 5:164692586-164692608 TGCCCTCTAGAAGCTGAAAGTGG + Intergenic
1001034399 5:168287198-168287220 TGTCCACAAGACCCCCCAAGGGG - Intergenic
1001483615 5:172104867-172104889 TACCCACTAAAAACCCTAAGGGG + Intronic
1005894958 6:30170194-30170216 TGCCCTCTAGAGACCAAAAGGGG + Intronic
1005976501 6:30804125-30804147 TTCACACAAGAACCCCAGAGGGG - Intergenic
1006686094 6:35835429-35835451 TCTCCACTAGAACCTCAAAAAGG + Exonic
1011386192 6:86801369-86801391 TGCCCACTATAACCACTAACTGG + Intergenic
1014270539 6:119330946-119330968 TGCCCACATGGAGCCCAAAGGGG - Intronic
1014486005 6:121999966-121999988 TGCCCACTAAAACCACAAATGGG - Intergenic
1018060805 6:160088204-160088226 TGCCCATGAAAACCCCAAGGAGG - Intronic
1026093952 7:67325940-67325962 AGTCCAATAGAACTCCAAAGAGG + Intergenic
1032485541 7:132284582-132284604 TGTCCACTAGAACACCCAAGGGG + Intronic
1034973967 7:155437186-155437208 TGTCCACTTGGACCCCCAAGTGG - Intergenic
1039105265 8:33982992-33983014 TGCACACTGGCAGCCCAAAGTGG - Intergenic
1049337806 8:142095850-142095872 TGCCCCCTAGACACCCCAAGGGG - Intergenic
1058192257 9:101933145-101933167 TGCTTGCTAAAACCCCAAAGAGG + Intergenic
1060876694 9:127089070-127089092 TGCCCACTCCAACCTCAACGGGG - Exonic
1061791527 9:133061648-133061670 TGTCCCCTAGGTCCCCAAAGGGG - Intergenic
1188511880 X:30944965-30944987 TGCCCACTGGATCCACAATGAGG - Intronic
1191705753 X:64092985-64093007 TCCCCAATAGATCCCCAAAATGG - Intergenic
1192746615 X:73944904-73944926 TGCCCACTATACCCCAAATGTGG + Intergenic
1196616216 X:117769421-117769443 TGCCCACTAGTCCCGCAAGGCGG - Intergenic
1200293988 X:154899242-154899264 TGCCTTCTAGAAGCCCAAACAGG - Intronic