ID: 1078765422

View in Genome Browser
Species Human (GRCh38)
Location 11:14292260-14292282
Sequence TCTGCCACTGCCTACCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078765414_1078765422 22 Left 1078765414 11:14292215-14292237 CCTCTTTGGGGTTCTAGTGGGCA 0: 1
1: 0
2: 2
3: 9
4: 109
Right 1078765422 11:14292260-14292282 TCTGCCACTGCCTACCCTACAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1078765415_1078765422 -5 Left 1078765415 11:14292242-14292264 CCCTCCTCCCTTCCCTAATCTGC 0: 1
1: 1
2: 10
3: 97
4: 833
Right 1078765422 11:14292260-14292282 TCTGCCACTGCCTACCCTACAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1078765416_1078765422 -6 Left 1078765416 11:14292243-14292265 CCTCCTCCCTTCCCTAATCTGCC 0: 1
1: 0
2: 1
3: 66
4: 715
Right 1078765422 11:14292260-14292282 TCTGCCACTGCCTACCCTACAGG 0: 1
1: 0
2: 1
3: 22
4: 179
1078765417_1078765422 -9 Left 1078765417 11:14292246-14292268 CCTCCCTTCCCTAATCTGCCACT 0: 1
1: 0
2: 1
3: 28
4: 345
Right 1078765422 11:14292260-14292282 TCTGCCACTGCCTACCCTACAGG 0: 1
1: 0
2: 1
3: 22
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078765422 Original CRISPR TCTGCCACTGCCTACCCTAC AGG Intronic
901101803 1:6724885-6724907 TCTCCCACAGCCTACCCTGTGGG - Intergenic
901445369 1:9305047-9305069 TCTGGCATTGCCTTCCCTACAGG + Intronic
904494639 1:30879702-30879724 CCAGCCACTGCCCAGCCTACTGG - Intronic
904871595 1:33622482-33622504 TCTGCCACTGCTCATCTTACAGG - Intronic
906420883 1:45665894-45665916 TCTGCCTCAGCCTCTCCTACTGG + Intronic
910108978 1:83661679-83661701 TCTGCCACTGCCAATGCTCCAGG + Intergenic
910813682 1:91265191-91265213 TTTCTCACTGCCTACCATACAGG + Intronic
912856878 1:113177531-113177553 TCTGCCTCTGCCTACTTTCCAGG - Intergenic
915061535 1:153189915-153189937 CCTGAGACTGCCCACCCTACAGG - Intergenic
915657643 1:157375024-157375046 CCTGCATCTGCCCACCCTACAGG + Intergenic
916188558 1:162157006-162157028 TCTGCCACTGGCTCTCTTACTGG - Intronic
916497559 1:165358889-165358911 TACCCCACTGCCTACCCCACTGG - Intergenic
916922759 1:169485998-169486020 TCTGCCACCGCCTCCACTCCGGG + Exonic
918109133 1:181440541-181440563 TCTGCCTCTGCCTACCCTGCAGG - Intronic
918950096 1:191125894-191125916 TCTGCCTCTGCCTCCCCTCCAGG - Intergenic
919016534 1:192044813-192044835 TCTCCCACTGCCTCCTCTCCTGG + Intergenic
921053422 1:211526960-211526982 TCTACCCCTGGCTTCCCTACTGG + Intergenic
921847299 1:219897723-219897745 TCTGCCCCTGCCTGCCTTCCAGG - Intronic
922199502 1:223389987-223390009 TCTGCCCCAGCCTACCTTTCTGG + Intergenic
922420924 1:225460805-225460827 TATGACACTGCCCACCCCACAGG + Intergenic
923433444 1:233946845-233946867 TCTGCCACTGCCTGGCAGACAGG + Intronic
923758645 1:236818420-236818442 CCTGCCACTGCCTCACCTCCAGG + Intronic
924439654 1:244075515-244075537 CCTACCACTTCCTACCCTCCTGG + Intergenic
924810637 1:247398633-247398655 TCTCCCTCTGCACACCCTACAGG - Intergenic
924957602 1:248944602-248944624 TCTGCCATTGCGCCCCCTACTGG - Intergenic
1063177739 10:3567586-3567608 CCTGCCTCTGCTTACCCCACGGG + Intergenic
1063592930 10:7409919-7409941 TCAGCCACTTCCCACCCTCCAGG + Intronic
1066054686 10:31669792-31669814 TCAGCCTCTGCCAACCCCACAGG + Intergenic
1069617939 10:69818095-69818117 GCTGCCCATGCCTACCCTGCTGG + Intronic
1069813221 10:71177872-71177894 TCTGCCTCTGCTTTGCCTACTGG - Intergenic
1072538591 10:96381484-96381506 GCTCACACTGCCTCCCCTACTGG + Intronic
1074114221 10:110443642-110443664 TCTGCCATTGCCTCCCCAAAAGG + Intergenic
1075637884 10:124042679-124042701 TCTGCCACTGTCTAGCTTAGTGG - Intronic
1075726726 10:124614386-124614408 TTTGGCACTGCCTTCCCTAACGG + Intronic
1076963445 10:133786120-133786142 TCTGCCATTGCGTCCGCTACTGG - Intergenic
1077202735 11:1319757-1319779 TTTACCAGAGCCTACCCTACTGG + Intergenic
1078765422 11:14292260-14292282 TCTGCCACTGCCTACCCTACAGG + Intronic
1079220407 11:18555542-18555564 TCTGCCACTGCCCTCCATCCTGG + Intronic
1081630735 11:44687948-44687970 TCTGCCTCTGCCTTCCCTGCTGG - Intergenic
1082818464 11:57526818-57526840 TCTGCCACTGTCTACCTGGCTGG + Intergenic
1082888161 11:58110106-58110128 TCTGCCACTGACAACCCTGGAGG - Intronic
1083708257 11:64531296-64531318 TCTGCTGCTGCCTTCCGTACAGG + Intergenic
1089366575 11:117924463-117924485 TCTGCCCGTGCCCACCCTATGGG - Intronic
1089497234 11:118913939-118913961 GCCACCACTGCCTGCCCTACTGG - Intronic
1092916346 12:13192877-13192899 TGTGCCACTGCATACCATCCTGG + Intergenic
1093646448 12:21590429-21590451 TCTGCCACTGCCATCACAACTGG + Intronic
1094296641 12:28914558-28914580 TCTGCCTCTGCCTACTCTCTGGG - Intergenic
1097798916 12:63891277-63891299 ACTGTCACTGCCTGTCCTACGGG + Intronic
1100406387 12:94276009-94276031 TCTGCCACTGCCTCCACAGCTGG - Intronic
1100549840 12:95636949-95636971 CCTGCCATGGCCTACCCTACTGG - Intergenic
1103571374 12:121847214-121847236 TGTTCCACCGCCCACCCTACAGG - Exonic
1105642397 13:22279294-22279316 TCTCCCACTCCCAACCCCACTGG - Intergenic
1113198829 13:107841271-107841293 TCTGTCACTGCCCAAACTACTGG + Intronic
1113544897 13:111140735-111140757 TCTGCCACTGCACTCCCTCCTGG - Intronic
1113619003 13:111700544-111700566 TCTCCCTCAGCCTACCCTAGGGG - Intergenic
1113624532 13:111785805-111785827 TCTCCCTCAGCCTACCCTAGGGG - Intergenic
1113932484 13:113975662-113975684 TCTGGCACTGCCTGGCCTCCTGG + Intergenic
1116952481 14:50892459-50892481 TCCTCCACTGCCTACCTTAGCGG - Intronic
1116984452 14:51204258-51204280 TCTGCCTCTGCCTACTCTCCAGG + Intergenic
1119678390 14:76573447-76573469 TCTCCCTCTGCCCTCCCTACAGG - Intergenic
1120033664 14:79670998-79671020 TCTGCCACTTCCTACACCTCTGG - Intronic
1121044163 14:90775725-90775747 TCTGGCACAGTCTCCCCTACTGG + Intronic
1124417116 15:29481169-29481191 TCAGCCTCTGCCTGCCCTGCAGG - Intronic
1125216122 15:37277418-37277440 CCTGACACTGCCTATCCTACAGG - Intergenic
1126110469 15:45172078-45172100 CCTGGCACTGGCTTCCCTACAGG - Intronic
1127846468 15:62875511-62875533 TCTGCCATTGCCTGCCCGGCTGG - Intergenic
1128991320 15:72262820-72262842 TCTTCCTCTGCCTACCCTGCTGG + Intronic
1129254882 15:74328656-74328678 CCTGCCACTGTCTAGCCTTCTGG - Intronic
1132132131 15:99292192-99292214 TCTGTTACTGCCTATCCTCCAGG + Intronic
1134103138 16:11466712-11466734 TGTGCCACTGGCTACCATATGGG + Intronic
1135168276 16:20159880-20159902 TTTGCCAGTGCCTACCCTATTGG + Intergenic
1135954966 16:26948837-26948859 TCTGCAACTGCCTCCACTTCAGG + Intergenic
1137223676 16:46481660-46481682 TCTGCCTCTTCCTACTCTCCTGG - Intergenic
1137323509 16:47410776-47410798 TCTGTCTCTGCCTACTCTCCAGG - Intronic
1138807105 16:60103209-60103231 TCTCCTCCTGCCTCCCCTACAGG + Intergenic
1141190327 16:81819994-81820016 TCTCCCATTGACTACCCTCCAGG + Intronic
1141586379 16:85036329-85036351 TCTGCCCCTGCCTCCCAAACTGG + Intronic
1143243593 17:5464824-5464846 TCTGCCTCTGCCCACACTATGGG + Intronic
1144284313 17:13758061-13758083 TCTGCCACTTACTAGCCTTCTGG + Intergenic
1144515823 17:15917258-15917280 TGTGCCACTGCATTCCCTCCTGG + Intergenic
1146726924 17:35163973-35163995 CTTGCCACTGTCTACCCTGCAGG + Exonic
1146919556 17:36701389-36701411 TCTGCCACTGACTCCTCTAGGGG - Intergenic
1147438357 17:40431646-40431668 TCTGCCCCTGCTTTCCCTGCTGG + Intergenic
1147647149 17:42040636-42040658 TCGGCCACTGCTTCCACTACAGG + Intronic
1148147572 17:45375756-45375778 TGTGGCACTGCCTACCCATCAGG + Intergenic
1148210584 17:45806228-45806250 TATGCCACTCCCTTCCCAACTGG + Intronic
1150864603 17:68836389-68836411 TCTGCCACTGCCTATTCCAGGGG + Intergenic
1151446017 17:74164598-74164620 TCTGCCACTGCCCATCCCCCAGG + Intergenic
1158193642 18:54859873-54859895 TCAGCCACTTCATCCCCTACTGG - Intronic
1160972487 19:1775688-1775710 TCTGTCACTCCCTCCCCTCCGGG - Exonic
1162305685 19:9872007-9872029 ACAGCCTCTGCCTAGCCTACTGG - Intronic
1162602381 19:11678705-11678727 CCTGCCACTCCCTACCATTCAGG + Intergenic
1162730296 19:12714750-12714772 TATGCCTCTGCCTTCCCTTCTGG - Intronic
1163732945 19:18960601-18960623 TCTGCCCCTGCCCAACCTGCTGG + Intergenic
1165043032 19:33082326-33082348 TCTTCCTCTGCCTTCCCTACAGG - Intronic
1168728583 19:58606569-58606591 TCTGCCATTGCGCCCCCTACTGG - Intergenic
925411872 2:3644158-3644180 TCTGTCCCTGCCAACCCTGCAGG - Exonic
926402841 2:12516367-12516389 TGTCCCACTGCCTACCCTTGTGG + Intergenic
927789738 2:26000995-26001017 TCCGGCCCTGCCTACCTTACTGG - Intergenic
928270417 2:29850276-29850298 TCTGGCACTGCCCTCCCTGCAGG - Intronic
931385593 2:61795117-61795139 TCTGCCTCTCCCTACCCTGAGGG + Intergenic
934925356 2:98378369-98378391 TCTAACAGTGCCTACCCCACAGG + Intronic
935144204 2:100383452-100383474 TCTGCCACTCCCTCCCCTCTAGG - Intergenic
935545633 2:104396934-104396956 TCTGCCACTGCTTAACAAACAGG - Intergenic
936569921 2:113604130-113604152 TCTGCCATTGCGCCCCCTACTGG + Intergenic
938638607 2:133255659-133255681 GCTGCCACTGCCCACCCAAGGGG - Intronic
939656004 2:144826143-144826165 TCTGCCACTGTCTGCCCTATTGG - Intergenic
941337827 2:164267358-164267380 TCAGCCACTCCCCACGCTACTGG - Intergenic
942817583 2:180070439-180070461 TCTCCCACTGCCTCCCCGCCTGG - Intergenic
942973295 2:181983166-181983188 ACTGCCACTGACTTCTCTACTGG + Intronic
947276917 2:228401981-228402003 TCTGTTTCTGCCTACCCTAGGGG + Intergenic
948536491 2:238651091-238651113 TCTGGCACTGCCCACCCTCAGGG - Intergenic
948942852 2:241204678-241204700 TCTGGCACGGCCCACCCTCCTGG - Intronic
949088841 2:242182211-242182233 TCTGCCATTGCGTCCCCTACTGG - Intergenic
1168730842 20:79562-79584 TCTGCATCTGCCTACTCTCCAGG - Intergenic
1169491461 20:6074687-6074709 TCTGCCACTCCCCACACCACGGG + Intergenic
1169495291 20:6109356-6109378 TCTGTCACTGCCTCACCTCCAGG - Intronic
1169841507 20:9943214-9943236 GCAGCCACTGCCTACCCTCAAGG + Intergenic
1172007097 20:31825011-31825033 TCTGCCCCTGCCTTCTCCACTGG - Intronic
1172427241 20:34863588-34863610 TCTGGCCCTGCCCACCCTCCAGG + Intronic
1176292768 21:5055076-5055098 CCTGCCTCTGCCTGCCCTCCAGG + Intergenic
1178147823 21:29759814-29759836 TCTATCACTGCCTACCTTCCAGG - Intronic
1179864492 21:44208574-44208596 CCTGCCTCTGCCTGCCCTCCAGG - Intergenic
1180264064 21:46698493-46698515 TCTGCCATTGCGCCCCCTACTGG - Intergenic
1180699130 22:17772326-17772348 TCTGCCCCTGCCCACCCCACAGG - Intronic
1182349107 22:29688696-29688718 TCTGCCACTGAATACCCAAGGGG - Intronic
1183432235 22:37772785-37772807 TCAGCCCCTGCCCACCCTGCAGG - Intronic
1183490056 22:38111301-38111323 GCTGCCTCTGCATACCCTAAGGG + Intergenic
1184518721 22:44979488-44979510 TCTGCCACTGGCTGCCCTCCAGG - Intronic
1185205459 22:49535645-49535667 TCAGCCTCTGCCCACCCTCCTGG - Intronic
1185205493 22:49535736-49535758 TCAGCCCCTGCCTACCCTCCCGG - Intronic
950276120 3:11662567-11662589 TCTCCCACTGCCTCCACTAGAGG + Intronic
951502730 3:23407783-23407805 TCTGCCTCTGCTTACCCTTCTGG + Intronic
951569227 3:24044568-24044590 TCTGCCACTGCTTATCATAATGG - Intergenic
953551375 3:43906405-43906427 CTGGCCACTGCCTACCCTGCTGG + Intergenic
954535405 3:51355950-51355972 GATGCCACTGCCTCCCCTACTGG + Intronic
959419996 3:106117257-106117279 TTTCCCACTGCCTCCCCTTCTGG - Intergenic
960826365 3:121789301-121789323 CTAGCCACTGGCTACCCTACTGG + Intronic
960943174 3:122947678-122947700 CCTGGCACTGCCTCCCCAACAGG + Intronic
966886598 3:184380572-184380594 TCTGCCCCCGCCCACCCTCCGGG - Intronic
968319494 3:197752120-197752142 TCTGCCTTGGCCTCCCCTACAGG + Intronic
969995892 4:11312779-11312801 TCTGAGACTGACTACCATACTGG - Intergenic
970092911 4:12430274-12430296 CCTGCCAGTCCCTCCCCTACGGG - Intergenic
970328949 4:14958993-14959015 TCTGTCATTTCCTACTCTACAGG + Intergenic
972254704 4:37340658-37340680 TCTCCCACTGCCTAACCTTGAGG - Intronic
975344879 4:73282213-73282235 TCTGCCTCTGCCTAATCTCCGGG + Intergenic
975676486 4:76832361-76832383 TCTGCCCCATCCTGCCCTACTGG - Intergenic
980594956 4:134942409-134942431 TTTGCCAGAGCCTAACCTACTGG + Intergenic
982183066 4:152766483-152766505 TCTGCCAGTCCCTACCAAACTGG + Intronic
985466670 4:190203418-190203440 TCTGCCATTGCGTCCCCTACTGG - Intergenic
987883467 5:23781040-23781062 TGTGCCACTGCATTCCCAACTGG - Intergenic
989075212 5:37558360-37558382 TCTGCCACTGCATTCCAGACTGG - Intronic
991493872 5:67209320-67209342 CCTGCCACTGCCTACCGTGTAGG - Intergenic
997324179 5:133006026-133006048 TGTGCCACTGCATTCCCGACTGG - Intronic
999252763 5:150192414-150192436 TCTCCCACTCCCTACCCCAGGGG - Intronic
999368574 5:151038934-151038956 TCTGCCATTGCCTCCCACACTGG - Intronic
1001110375 5:168891252-168891274 TGTGCCTCTGCCTATCCCACAGG - Intronic
1002568595 5:180127793-180127815 TCTGCAACTGCCCTCCCCACTGG + Intronic
1004651878 6:17617799-17617821 TCTGCCACTGCCTTCCAGCCTGG + Intronic
1004817858 6:19332239-19332261 TGTGCCACTGCCTTCCATCCTGG - Intergenic
1007119649 6:39369398-39369420 ACTGCCACTGCCTTCCCCTCAGG + Intronic
1007130249 6:39465736-39465758 TCTGCCACTCCCCACCATAAAGG + Intronic
1007835234 6:44668744-44668766 TCTGCCACTCCCTCCCCAGCAGG - Intergenic
1008413907 6:51217133-51217155 ACTGCCACTTCCTGCCCTCCAGG + Intergenic
1010565916 6:77413339-77413361 TCTGCTTCTGCCTACCCAAATGG + Intergenic
1017447915 6:154526150-154526172 TCTGCCATGGCCCTCCCTACAGG + Intergenic
1019454012 7:1115304-1115326 CCTGCCACTGCCCACCCTTCGGG + Intronic
1020397918 7:7738188-7738210 TCTTCCAATGCCTACACTAGTGG - Intronic
1021342141 7:19478607-19478629 TCTGCAAATGCCTACCAGACAGG + Intergenic
1022425816 7:30267659-30267681 TCTGCCACTGTTTTCCATACTGG - Intergenic
1023222146 7:37930286-37930308 TCTGCCACTGTCTTCCCTGGTGG - Intronic
1023875437 7:44283955-44283977 TCTGCCACAGCCTCCACTCCAGG + Intronic
1027694562 7:81393540-81393562 TCTCCCAGTTACTACCCTACAGG + Intergenic
1028630327 7:92926811-92926833 TCCTCCAGTGCCTACCCCACCGG - Intergenic
1032163373 7:129527183-129527205 TCTGCCTCTGCCCACCACACTGG + Intergenic
1033523164 7:142182570-142182592 TCTGCCTCTGCCTACTCTCCAGG + Intronic
1034377950 7:150663379-150663401 TCTCCCACTGCCCAACCAACAGG - Intergenic
1034507046 7:151500938-151500960 TCTGCCACTGCATACCAGCCTGG + Intronic
1037794275 8:21978793-21978815 TCTGCCACTGCATAGCCAGCTGG + Intronic
1038173600 8:25161194-25161216 TCTGCCACTTACTACCTGACAGG - Intergenic
1038876601 8:31558005-31558027 TCTACCTCTGCCTACTCTTCAGG - Intergenic
1040549581 8:48427906-48427928 CCTGCCACTGCCCACCCAACAGG - Intergenic
1041181398 8:55252822-55252844 TCTGCCTCTGCCTCTCCCACTGG - Intronic
1045133202 8:99181465-99181487 TCTGCCACTTCCTAGCCTTGTGG + Intronic
1045435630 8:102160767-102160789 TCAGCCACTGCCAACATTACAGG + Intergenic
1046687521 8:117244018-117244040 TTTGCCAATGCCTGCCCTACAGG + Intergenic
1049587877 8:143440363-143440385 TCTGCCCCTTCCTTCCCTGCAGG - Exonic
1051180487 9:14406577-14406599 TCTGCCCCAGCCTATCCTTCTGG - Intergenic
1051687973 9:19678338-19678360 TCTGCAGCTGCCTAACCTGCAGG + Intronic
1052781005 9:32782628-32782650 TCTGCCCCTGCCTACCAGAGCGG + Intergenic
1053048207 9:34937080-34937102 TCTGCCCCGGCCGCCCCTACTGG + Intergenic
1055694610 9:78870440-78870462 TCTGCCACTTCCTAGCCTAGTGG + Intergenic
1056667006 9:88589172-88589194 TCTGCCTCTGTCTGCCCTGCTGG + Intergenic
1056933256 9:90896032-90896054 TCTGCCTTTGCCTTCCCTTCAGG - Exonic
1058884769 9:109314775-109314797 TTAGCCAATACCTACCCTACAGG + Intronic
1059734386 9:117086851-117086873 CCTGCTACTCCCTACCCTGCAGG - Intronic
1062000440 9:134213273-134213295 GCTGCCTCTGCCTCCCCTAGTGG + Intergenic
1192396827 X:70790514-70790536 TCTGCCTCTGTCTACTCTCCTGG - Intronic
1194210711 X:91066086-91066108 TCTGTCTCTGCCTACTCTTCAGG - Intergenic
1199382007 X:147182196-147182218 TCTGCAACTGCCTATTCTCCTGG - Intergenic
1199848303 X:151707376-151707398 TCTTCCTCTCCCTGCCCTACTGG + Intergenic
1199988374 X:152968922-152968944 TCTGCCCCTGCCTATACTCCTGG - Intronic
1200657889 Y:5925705-5925727 TCTGCCTCTGCCTACTGTTCAGG + Intergenic