ID: 1078766194

View in Genome Browser
Species Human (GRCh38)
Location 11:14300815-14300837
Sequence TCCTTACCACTGAAGGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078766194_1078766197 13 Left 1078766194 11:14300815-14300837 CCTTCCGCCTTCAGTGGTAAGGA 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1078766197 11:14300851-14300873 TTCTTCTGACACCAAGCTATTGG 0: 1
1: 0
2: 1
3: 21
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078766194 Original CRISPR TCCTTACCACTGAAGGCGGA AGG (reversed) Intronic
900254944 1:1693132-1693154 GCCGTTCCACTGAAGGCAGAAGG + Intronic
900263693 1:1746411-1746433 GCCGTTCCACTGAAGGCAGAAGG + Intergenic
901726567 1:11247618-11247640 TCCTCACCTGTGAAGGCAGAAGG + Exonic
910354788 1:86341951-86341973 TCCTTGCTACTGAAGACTGATGG + Intergenic
911096556 1:94059947-94059969 TCCTTATCACTGAGGAAGGATGG + Intronic
911942830 1:104069331-104069353 GCCTCACCACTGCAGGCTGAAGG - Intergenic
913554158 1:119948446-119948468 TCCATACCACTGAAGCCTGGTGG + Exonic
914448288 1:147769117-147769139 TCCTGACCACTGTGGGCTGAGGG - Intronic
916123667 1:161550629-161550651 TCCTTACCAGAAAAGGTGGAGGG + Intronic
916133554 1:161631992-161632014 TCCTTACCAGAAAAGGTGGAGGG + Intronic
917082313 1:171268682-171268704 TCCTTACCTCTGACAGGGGAGGG - Intronic
919131995 1:193463118-193463140 TACTTATCACTGACTGCGGAGGG - Intergenic
922685950 1:227639015-227639037 GCCTTGCCACTGAAGACTGACGG - Intronic
924006345 1:239615801-239615823 TCTTTAACACTGAATGCGGCGGG + Intronic
924326646 1:242901408-242901430 TCCTTATCTCTGAAGGCACAGGG + Intergenic
1064576022 10:16747176-16747198 TCCTAAACACTGAAGCCAGAAGG - Intronic
1065499760 10:26367970-26367992 TCCTTACCACAGAAGGTGAAGGG + Intergenic
1066171298 10:32849932-32849954 TCCCTACTTCTGAAGGCGGGGGG + Intronic
1067309683 10:45101195-45101217 TCCTAAACACTGAAGCCAGAAGG - Intergenic
1069847005 10:71379175-71379197 TCCTTACCAGTGAGGGCAGAGGG + Intergenic
1070919489 10:80175211-80175233 TCCTCACCAGTGAAGTCTGAGGG - Intronic
1072121232 10:92407102-92407124 TCCTCACCAGTGAAGGCTGTGGG + Intergenic
1073385348 10:103122759-103122781 TCCTTACCTCTGAAGACCCAGGG + Intronic
1078766194 11:14300815-14300837 TCCTTACCACTGAAGGCGGAAGG - Intronic
1088071386 11:105790145-105790167 TGCTTACCAATGCAGGTGGAAGG - Intronic
1091433443 12:455299-455321 TCCTTCTCCCTGAAGGAGGAAGG + Intergenic
1094585335 12:31772524-31772546 TCCTTACAACTGAAAGAGGGAGG - Intergenic
1096199678 12:49672721-49672743 TCCTTCCCACTGCAGGGGAAGGG + Intronic
1096287155 12:50310137-50310159 TCCTTATCTCTGAAGACAGAGGG - Intergenic
1102161133 12:110770013-110770035 TGCTTACCTCTGATGGCTGACGG + Intergenic
1107712842 13:43167844-43167866 TCCTTATCTCTGAAGGCAAAGGG - Intergenic
1107833763 13:44397337-44397359 TCCCTCCCACTGGAGGCGGGAGG + Exonic
1109237696 13:59844841-59844863 TCCATACCACAGAAGGCAAAAGG + Intronic
1110462208 13:75757500-75757522 TTCTTACCACTGAGGTAGGATGG - Intronic
1110565851 13:76957013-76957035 TTCCTACCACGGAAGGGGGATGG - Exonic
1111915201 13:94353081-94353103 TCCTTAGCACTGAGGAAGGAAGG - Intronic
1112440802 13:99423334-99423356 TCCTTACCTCTGAAGGCACCAGG + Intergenic
1118449774 14:65889585-65889607 TCCTTACCTCTGAAGATGGAGGG - Intergenic
1121175836 14:91890040-91890062 TCCTTCCCACTGGAGCAGGAGGG - Intronic
1122757498 14:103993799-103993821 TCCTAACCCCAGAATGCGGAAGG - Intronic
1124633218 15:31349109-31349131 GCCTAACCACGGAAGGCAGATGG + Intronic
1127243733 15:57148499-57148521 TCCCTCCCACTGAAGGCTGCTGG - Intronic
1127367490 15:58305297-58305319 TCCTTACCTCTGAAGACAAAGGG + Intronic
1140072542 16:71664034-71664056 TCCTCTCCAGTGCAGGCGGATGG + Exonic
1142067863 16:88073022-88073044 TTCTAAGCACTGAAGGTGGATGG - Intronic
1145080357 17:19889836-19889858 TCCTCTCCACTCAAGGCAGATGG - Intergenic
1152134220 17:78494517-78494539 TCCTTCCCACTGATGTTGGACGG - Intronic
1154001606 18:10486607-10486629 TCCTTATCACTAAACGAGGAGGG + Intronic
1157550762 18:48580469-48580491 ATGTTACCACTGAAGGCGGGTGG - Intronic
1167304343 19:48698357-48698379 TCCTTACCCAGGAAGGAGGAAGG - Intronic
925901040 2:8509750-8509772 TCCTTCACACTGAGGGCTGAGGG + Intergenic
926552863 2:14320943-14320965 TCCTTACCACTGAGTGAAGAAGG + Intergenic
933220671 2:79684004-79684026 TCCATACCACTGAAGGAGAGGGG + Intronic
934675532 2:96247110-96247132 TCCTTCCCACTGGAGGTGCAGGG - Intergenic
934709750 2:96507131-96507153 TCCTTACCTCTGAAGACACAGGG + Intronic
944456725 2:199902675-199902697 TCCTTATCTCTGAAGGCACAGGG - Intergenic
944484889 2:200195151-200195173 TCCTGCACACTGAAGGAGGATGG + Intergenic
944691595 2:202163588-202163610 TCCTTGCCCCTGAAGGCTCATGG + Intronic
944901479 2:204221090-204221112 TCATTACCACTGTAGGCCGCTGG + Intergenic
946564965 2:220954138-220954160 TCGTTACCAGAGAAGGAGGAAGG + Intergenic
946959883 2:224973399-224973421 TCCTTACGAGTGAAAGAGGAAGG + Intronic
948362773 2:237434545-237434567 TTCTTACCACTGTAGCCAGAAGG + Intergenic
1183031309 22:35108405-35108427 TCATTACCACTGGAGGGGGTGGG + Intergenic
955623629 3:60893159-60893181 TCCTTATCTCTGAAGATGGAGGG + Intronic
955637879 3:61049906-61049928 TCCTTACCTCTGAAGACACAGGG + Intronic
956066221 3:65400074-65400096 TCCATTTCTCTGAAGGCGGATGG + Intronic
957425570 3:80034967-80034989 TCCTTCCTGCTGAAGGAGGAAGG - Intergenic
958266295 3:91441368-91441390 TCCTTATCACTGAAGACACAGGG + Intergenic
962038878 3:131683790-131683812 TCTTTGCCACTGCAGGCTGAAGG - Intronic
963733952 3:148998365-148998387 TTGTTACAACTGAAGGGGGAGGG + Intronic
965155084 3:165041433-165041455 TCCCTACCAGTGAAGGTGGAGGG + Intronic
972118628 4:35671422-35671444 TCCTTACAAGTGAAGAAGGAAGG - Intergenic
977755199 4:100661976-100661998 CCATTACCTCTGAAGGCTGAAGG + Intronic
978302967 4:107292075-107292097 CCCTCACCACTCAAGGCAGATGG - Intergenic
981002872 4:139844662-139844684 TCCTTACCACTGCAGCCACATGG + Intronic
981744950 4:148043989-148044011 TCCTGAACAGTGAAGGAGGAAGG + Intronic
985203505 4:187507467-187507489 TCCTTAGCTATGAAGGCGAATGG + Intergenic
989585785 5:43073059-43073081 GCCTTGCCACTGAAGACTGATGG - Intronic
990258549 5:53996849-53996871 ACCTTACGCCTGAAGGCAGAAGG + Intronic
994248609 5:97510492-97510514 TCCTTATCTCTGAAGACAGATGG + Intergenic
995533673 5:113114949-113114971 TCTCCACCACTGAAGGCAGAGGG - Intronic
995702172 5:114948336-114948358 CCCTTACCAAGGAAGGAGGAAGG - Intergenic
996576919 5:124985759-124985781 TCCCTACCTCTGAAGAGGGAGGG + Intergenic
998260896 5:140631281-140631303 CCCTTACCACTCAAGGAAGAGGG - Intergenic
1001754376 5:174157156-174157178 TCCCTCCCACTGAAGGAGCAGGG - Intronic
1003420224 6:5950918-5950940 TTCTTATCACTGAAGACAGAGGG + Intergenic
1004518483 6:16340753-16340775 TTCTTATCACTGAACGCTGATGG - Intronic
1006466131 6:34196018-34196040 TCCTGACCACTGCAGACAGATGG - Intergenic
1006599997 6:35218993-35219015 TCCTTCCTGCTGAAGGCAGAAGG + Intronic
1009177523 6:60478846-60478868 TCCTTATCACTGAAGACACAGGG - Intergenic
1012726277 6:102814926-102814948 TCCTTATCACTGAAGACACAGGG - Intergenic
1013662871 6:112316398-112316420 TCCATACCACTGAAGAAGCATGG - Intergenic
1014554734 6:122831717-122831739 TCCTTATCTCTGAAGGCACAGGG + Intergenic
1016508284 6:144810122-144810144 TCCTTATCACTGAAAACAGAAGG - Intronic
1018962519 6:168458573-168458595 TCCTTAGCAATGAAGGCAAAGGG - Intronic
1023704864 7:42931243-42931265 TCCTGACAACTGAAGGCAGGCGG - Intronic
1023828254 7:44024260-44024282 TCCTGACCACTGCAGCTGGAAGG - Intergenic
1024738900 7:52334707-52334729 TCCTCCCCACTCAAGGCAGATGG - Intergenic
1025875747 7:65478522-65478544 GCCTTGCCACTGAAGACTGATGG + Intergenic
1029756555 7:102577706-102577728 TCCTGACCACTGCAGCTGGAAGG - Intronic
1029774497 7:102676775-102676797 TCCTGACCACTGCAGCTGGAAGG - Intergenic
1030611467 7:111694237-111694259 TTCATGCCACTGAAGGAGGAAGG - Intergenic
1032005745 7:128300930-128300952 TCCTCACAACTGCAGGCAGAAGG - Exonic
1032675042 7:134122013-134122035 CCCTTACCACTGTTGGCAGACGG - Intergenic
1033126224 7:138709617-138709639 TCCTTACCAGTGCAGTCGCAGGG + Exonic
1037025985 8:14038692-14038714 TCCTTACGACTGAAGGCATTGGG + Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1042158053 8:65865745-65865767 GCCTTGCCACTGAAGACTGACGG + Intergenic
1042938338 8:74082863-74082885 TCCTTACCTCTGAAGACACAGGG - Intergenic
1044300835 8:90581138-90581160 TCCTTACAAGAGAAGGCAGAGGG - Intergenic
1049981467 9:907970-907992 TCAGTACCACTGATGGCAGATGG + Intronic
1055580147 9:77699714-77699736 TCCTCAGCACTTAAGGTGGAAGG + Intergenic
1057256005 9:93547552-93547574 TCCTTACCACAGAAGGGTGGGGG - Intronic
1057466890 9:95322387-95322409 TTCTTACCTCTGAAGACTGACGG - Intergenic
1191636268 X:63380788-63380810 TCCTTATCTCTGAAGATGGAGGG - Intergenic
1193287613 X:79731557-79731579 GCCTTACCACTGAGGGCTAAAGG + Intergenic
1193517291 X:82482810-82482832 TCCTTACATTTGAAGGCAGAAGG + Intergenic
1193698977 X:84740890-84740912 GCCTTGCCACTGAAGACTGATGG + Intergenic
1196779157 X:119366924-119366946 TGTTTACCTCTGAAGGTGGAGGG - Intergenic
1198914074 X:141647559-141647581 TACTGGCCACTGAAGGTGGATGG - Intronic
1200124140 X:153805335-153805357 TCCTGGCCTCTGAAGGCTGAGGG - Intronic
1201224075 Y:11799975-11799997 TCCTTATCTCTGAAGGCACAGGG + Intergenic