ID: 1078766382

View in Genome Browser
Species Human (GRCh38)
Location 11:14302560-14302582
Sequence TCCAATGCCCACTTCAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 6, 3: 28, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078766377_1078766382 28 Left 1078766377 11:14302509-14302531 CCATTTCCTCAACAGAAAAGGGC 0: 1
1: 0
2: 1
3: 19
4: 272
Right 1078766382 11:14302560-14302582 TCCAATGCCCACTTCAGATGTGG 0: 1
1: 1
2: 6
3: 28
4: 217
1078766378_1078766382 22 Left 1078766378 11:14302515-14302537 CCTCAACAGAAAAGGGCAAGAAC 0: 1
1: 1
2: 0
3: 15
4: 243
Right 1078766382 11:14302560-14302582 TCCAATGCCCACTTCAGATGTGG 0: 1
1: 1
2: 6
3: 28
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078766382 Original CRISPR TCCAATGCCCACTTCAGATG TGG Intronic
900253542 1:1684437-1684459 TCCAAGGCCCACTTGGGTTGTGG - Intronic
900705201 1:4076159-4076181 TCCCATGCCCATTTCAGAGATGG - Intergenic
900923279 1:5687399-5687421 CCCCATGCCTACTTCACATGTGG + Intergenic
901072391 1:6528081-6528103 TCAAATGCACATTTCAGATTTGG - Intronic
902848116 1:19128291-19128313 TCTAATGCTCACTACAGATCTGG - Exonic
905283183 1:36861996-36862018 TTCAATGCCTACTTCACAGGGGG - Intronic
905528604 1:38658687-38658709 TACAAAACCCACTTCAGATGGGG - Intergenic
906152116 1:43593558-43593580 TCACATGGCCACATCAGATGTGG - Intronic
906864004 1:49395985-49396007 TTCAATACCCAGTTAAGATGAGG - Intronic
907906555 1:58787328-58787350 TCCAATGCCTGCTTTAGCTGTGG - Intergenic
910279077 1:85478771-85478793 GTCAATGACCACTTCTGATGAGG - Intronic
916738495 1:167629107-167629129 CCCATTGCCCACCTCTGATGGGG + Intergenic
917091795 1:171360136-171360158 TCCACTGCCCTCTTCAGAGCTGG - Intergenic
919855099 1:201700255-201700277 TCCTTTGCCCACTTTTGATGGGG - Intronic
921148655 1:212382791-212382813 TCTAATGTCCACTTCAGATATGG + Intronic
922125032 1:222713165-222713187 TCCAATGACCAATGGAGATGCGG - Intronic
922560827 1:226568462-226568484 TCCAATTCCCACTCTGGATGGGG - Intronic
924604651 1:245522300-245522322 GCCTATGCCCAATTTAGATGTGG + Intronic
1064955983 10:20910590-20910612 TCCACTGCCCACCCCAAATGTGG - Intronic
1065920228 10:30386785-30386807 TGCAATGACCACTTCTGATGGGG + Intergenic
1066124606 10:32328546-32328568 TCCAATGACTACTTCAGATGAGG + Intronic
1066599463 10:37089102-37089124 TCCTTTGCCCACTTTTGATGGGG + Intergenic
1069194513 10:65532641-65532663 TCCAATGACTACTTCAGGTTGGG - Intergenic
1070884592 10:79879013-79879035 ACCAATGCACACTTAAGAAGTGG + Intergenic
1071570141 10:86692263-86692285 TCCAATGCCAACTCCAGCAGTGG + Intronic
1072358461 10:94635167-94635189 TCCTTTGCCCACTTTTGATGAGG + Intergenic
1072551692 10:96483230-96483252 TCTGATGCCCTCTCCAGATGTGG + Intronic
1075702867 10:124480425-124480447 TCCAAACACAACTTCAGATGTGG - Intronic
1076125786 10:127972659-127972681 TTCAATGGCCACTACACATGAGG - Intronic
1076510201 10:131008042-131008064 TCCAATGCCCCCTCCAGGTTGGG - Intergenic
1077197928 11:1290713-1290735 TCTAATGCCCTCCTCAGAAGTGG + Intronic
1077452270 11:2655559-2655581 TGAAATACCCACTTCAGAGGTGG + Intronic
1078766382 11:14302560-14302582 TCCAATGCCCACTTCAGATGTGG + Intronic
1080347180 11:31338041-31338063 TCCATTGACCACATCAGATGTGG + Intronic
1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG + Intergenic
1082240965 11:49870213-49870235 TCCTTTGCCCACTTTTGATGGGG - Intergenic
1082285410 11:50312498-50312520 TCCTTTGCCCACTTTTGATGGGG + Intergenic
1083459144 11:62799367-62799389 TCCCACGCCCAGTTCAGATCGGG - Intronic
1083696136 11:64443943-64443965 CCCAATGCCCGTATCAGATGTGG + Intergenic
1086176987 11:83902623-83902645 TCCACTGCCCATTTCAGATGAGG - Intronic
1086438825 11:86807862-86807884 TCCACTGCCCACTTACGAAGAGG + Exonic
1086913541 11:92500850-92500872 TCTACTGCCTACTTTAGATGAGG + Intronic
1088403337 11:109444830-109444852 TCCTTTGCCCACTTTTGATGGGG - Intergenic
1088484266 11:110325619-110325641 TCCAATGGCCACAGCAGGTGAGG + Intergenic
1089195514 11:116692134-116692156 TCTAATGCTCCCTTCAGCTGGGG - Intergenic
1090109862 11:123895691-123895713 TCCATTGCCCACTTTTAATGAGG - Intergenic
1090972424 11:131654807-131654829 TCCAATGCCAGCTTCTGGTGAGG - Intronic
1091009376 11:131984551-131984573 CACAATGACCACTTCAGATGTGG - Intronic
1093679973 12:21991084-21991106 TACAATACTCACTTCAGATTTGG + Intergenic
1093717978 12:22405341-22405363 TCCTTTGCCCACTTTTGATGGGG - Intronic
1094230064 12:28092698-28092720 TCCAAAGTCCGCTTTAGATGTGG + Intergenic
1095201273 12:39387324-39387346 TCCAATGTCCACTTTAAATTTGG + Intronic
1095387202 12:41665019-41665041 TCCTTTGCCCACTTTTGATGGGG - Intergenic
1095489715 12:42720678-42720700 TCCTTTGCCCACTTTTGATGGGG + Intergenic
1096188910 12:49601878-49601900 AACAATGCTAACTTCAGATGAGG + Intronic
1096588302 12:52639320-52639342 CCCAATGGCCACTTAAAATGGGG + Intergenic
1098094779 12:66943325-66943347 ACAAATGCCCACTTGGGATGAGG + Intergenic
1098803827 12:74996514-74996536 TCCTTTGCCCACTTTTGATGGGG - Intergenic
1099097241 12:78389939-78389961 TCCAATGTCTACTTCATATCTGG + Intergenic
1100065056 12:90633872-90633894 TCCTTTGCCCACTTTTGATGTGG - Intergenic
1100410816 12:94317240-94317262 TCCTTTGCCCACTTTTGATGGGG + Intronic
1101843060 12:108341798-108341820 TCCACTGTCCACAGCAGATGAGG - Intergenic
1103835157 12:123813195-123813217 TAGAATGCCCACCTCAGAAGGGG + Exonic
1104397892 12:128450432-128450454 TCCAATTCCCTCAGCAGATGAGG + Intronic
1106117910 13:26832799-26832821 TCTAATCACCACTGCAGATGAGG + Intergenic
1108264274 13:48689079-48689101 TCCTTTGCCCACTTTTGATGGGG + Intronic
1109282729 13:60375769-60375791 TCCTTTGCCCACTTTTGATGGGG - Intergenic
1109882314 13:68495566-68495588 TCCAATGTCAACTTGAGATTTGG + Intergenic
1114580788 14:23757537-23757559 TCCTTTGCCCACTTTTGATGGGG + Intergenic
1116136817 14:40935248-40935270 TCCATTGCCCACTTTTAATGGGG + Intergenic
1117118839 14:52547228-52547250 TCCAAAGCCAATTTCAGATGTGG + Intronic
1119622242 14:76139648-76139670 TCTAATACCCACTTCACAGGTGG + Intergenic
1121882949 14:97516600-97516622 TGCACTGCCCACTGCTGATGAGG + Intergenic
1126337760 15:47605541-47605563 TCAGATGCCAACTGCAGATGGGG + Intronic
1126405954 15:48322758-48322780 TCCAAACCCCAACTCAGATGGGG + Intergenic
1126674396 15:51146887-51146909 TCCAATCCCCACTTCTGCTCAGG - Intergenic
1127430133 15:58897583-58897605 TCTAAAGCCCACAGCAGATGTGG - Intronic
1128403976 15:67316182-67316204 TCCATTTCTCACTTAAGATGGGG + Intronic
1128419916 15:67482086-67482108 TCTAATATCCACTTCAGATGTGG + Intronic
1128916229 15:71565420-71565442 TCCAGAGCCCACATCAGATTAGG + Intronic
1129298680 15:74613370-74613392 TCCCATCCCCACCTCAGAGGAGG - Intronic
1129405422 15:75313777-75313799 TGCAACGTCCACTTCTGATGGGG - Intergenic
1129479085 15:75808699-75808721 TGCAATGACCACTTCTGATGGGG - Intergenic
1130406045 15:83602867-83602889 TCCAAAGCCCACTTACAATGTGG - Intronic
1130510006 15:84581667-84581689 TGCAATAACCACTTCTGATGGGG + Intergenic
1133669334 16:8002604-8002626 TCCTTTGCCCACTTATGATGGGG - Intergenic
1133912438 16:10078349-10078371 TATAATGCCCACTTCACAGGTGG + Intronic
1134138683 16:11697818-11697840 CCAAATGCCCTCTTCTGATGTGG - Intronic
1136060695 16:27724283-27724305 TCCATTGCCCATTCCAGAAGAGG - Intronic
1137769831 16:51007188-51007210 TCCAATGCTGACAGCAGATGTGG - Intergenic
1138208369 16:55142066-55142088 TACAATGACCCTTTCAGATGAGG - Intergenic
1139293025 16:65874998-65875020 ACCAATGCCCACTCCAGCTTGGG - Intergenic
1139659207 16:68409473-68409495 TAAAATGCCCACTTCAGAGATGG - Intronic
1142762207 17:2049485-2049507 CCCAATGCCCACTTCAGCTAGGG + Intergenic
1144617073 17:16786600-16786622 TCCTTTGCCCACTTTTGATGGGG + Intronic
1144895619 17:18529074-18529096 TCCTTTGCCCACTTTTGATGGGG - Intergenic
1145136597 17:20415157-20415179 TCCTTTGCCCACTTTTGATGGGG + Intergenic
1147261208 17:39210604-39210626 CCCAATGCCCACTGTACATGAGG - Exonic
1148600874 17:48893257-48893279 TCTAATGCCCTCCTCAGCTGGGG + Intronic
1150811416 17:68360077-68360099 CCCTATGCCCACTTCGGAGGGGG - Intronic
1150926911 17:69541901-69541923 TCCAAGGCCCCCTTAAGAGGGGG - Exonic
1153088394 18:1316322-1316344 CCCAATGCTCCCTTCAGATAAGG - Intergenic
1155005674 18:21727060-21727082 TCCAATGCCCACTTAGCATGGGG - Intronic
1155229654 18:23759938-23759960 TCCATTGCTCACCCCAGATGAGG + Intronic
1158081607 18:53599127-53599149 TCACATACCCCCTTCAGATGAGG - Intergenic
1158265859 18:55660034-55660056 TTCAAAGCCCAGTTCGGATGTGG - Intronic
1159482934 18:69014317-69014339 TCCAATGGCAAATTCAGATATGG + Intronic
1165949732 19:39467563-39467585 GCTTATGCCCACTTGAGATGGGG + Intronic
925091952 2:1163307-1163329 TCCCATGCCCACTTCCTATTGGG - Intronic
925233883 2:2260245-2260267 TCCAATGCCCATTTCACAGATGG - Intronic
925944110 2:8844955-8844977 TCAAAGGCCCAGTTCAAATGGGG + Intergenic
928388231 2:30887926-30887948 TCCCATGCCTACCTCAGCTGGGG + Intergenic
928709839 2:33991444-33991466 TCCAATGCATTCTTCATATGGGG - Intergenic
928754735 2:34510562-34510584 TCCTTTGCCCACTTTTGATGGGG - Intergenic
929308153 2:40389685-40389707 TCCAATTCCCATGTCAGTTGTGG + Intronic
929569665 2:43014054-43014076 TCCAGTGGCCTCTTCAGATGTGG + Intergenic
929768208 2:44868535-44868557 CCTAATGCCCATCTCAGATGTGG - Intergenic
931791649 2:65669021-65669043 TCCAAGGCCCTTTTCAGATGTGG + Intergenic
932709192 2:74049265-74049287 TCTTCTGGCCACTTCAGATGTGG - Intronic
935977698 2:108595307-108595329 TCCAGTGCCTTTTTCAGATGAGG + Intronic
936770677 2:115909289-115909311 TCCAATGCCTATGTCAGATGTGG - Intergenic
938377102 2:130815205-130815227 TCCAAGGCCCGCTTCACATCTGG - Intergenic
938734209 2:134171749-134171771 TCCAATGTCCACTTTAGAATAGG - Intronic
938861100 2:135370718-135370740 TCCAATTCCCAATACAGATGTGG + Intronic
939027046 2:137026375-137026397 TCCCAAACTCACTTCAGATGTGG - Intronic
940482868 2:154257481-154257503 TCCAAAACCCACATCAGGTGAGG + Intronic
940926779 2:159372380-159372402 TCAAATGCCAAATTCTGATGGGG - Intronic
941050149 2:160723479-160723501 TCCTTTGCCCACTTTTGATGGGG + Intergenic
946039828 2:216773968-216773990 TCCAGGGCCCACTTTAGATTAGG + Intergenic
946205414 2:218103404-218103426 TCCTTTGCCCACTTTTGATGGGG + Intergenic
947386508 2:229595812-229595834 TCCAATGCCATCTTCTGATGAGG + Intronic
947712849 2:232325860-232325882 GCCAGTGCCCACATCAGAGGAGG + Intronic
947891222 2:233622552-233622574 TCCTTTGCCCACTTTTGATGGGG + Intronic
1169690831 20:8329727-8329749 ACCACAGCCCACGTCAGATGAGG - Intronic
1170808535 20:19655128-19655150 TCCAGAGCCCACTTCAGCTGAGG + Intronic
1171100001 20:22373997-22374019 CCAACTGCCCACTACAGATGTGG + Intergenic
1173394410 20:42665264-42665286 TCCTTTGCCCACTTTTGATGGGG - Intronic
1175156132 20:56972910-56972932 TCCTTTCCCCACTTCAGATCTGG + Intergenic
1176239240 20:64068294-64068316 TGCACTGACCACTTGAGATGTGG + Intronic
1177659777 21:24067648-24067670 TCCTTTGCCCACTTTTGATGAGG + Intergenic
1177916103 21:27089770-27089792 CCTAATGTCTACTTCAGATGTGG + Intergenic
1177943925 21:27444117-27444139 TCCAGAGGTCACTTCAGATGTGG - Intergenic
1182269956 22:29147158-29147180 TCCATTACCCTTTTCAGATGGGG - Intronic
1182524641 22:30907671-30907693 TACAATGCCCACTGGAGAGGCGG + Exonic
1184913131 22:47549353-47549375 TCCAATGCCCAGCTGAGCTGAGG + Intergenic
1185080865 22:48708648-48708670 TCCAATGCCAACCTCAAAGGAGG - Intronic
951322120 3:21257814-21257836 TTCAGTGCCCATTTCAGAAGTGG + Intergenic
952060923 3:29509021-29509043 TCCTTTGCCCACTTTTGATGGGG + Intronic
952810983 3:37402551-37402573 TCCAATGCTCAATTTAGATATGG + Intronic
953578452 3:44131941-44131963 TCCTATGCCCACCTCTGCTGTGG + Intergenic
954783657 3:53077922-53077944 TGCAAAGCCCTTTTCAGATGTGG + Intronic
955420083 3:58727197-58727219 TTCAATGCTCACTTTAGATGTGG - Intronic
955929592 3:64043336-64043358 TCCTTTGCCCACTTTTGATGGGG + Intergenic
956190425 3:66602561-66602583 GCCAATTCTCACTTGAGATGTGG + Intergenic
958854625 3:99369779-99369801 TCCTCTCCCCATTTCAGATGGGG + Intergenic
960278070 3:115749700-115749722 TCCTTTGCCCACTTTTGATGGGG - Intergenic
960928049 3:122815804-122815826 TCCAACAACCACTTCAGGTGTGG - Intronic
961105081 3:124233811-124233833 TCCAGTGGCCACCTGAGATGTGG + Intronic
961668702 3:128510683-128510705 CCCAATGCCCACTTCAGATGTGG - Intergenic
962665888 3:137653275-137653297 TTCAATGCGCACTTCAGATGTGG + Intergenic
962679474 3:137783726-137783748 TCCACTGGCCATTTCAGCTGGGG + Intergenic
962818890 3:139027444-139027466 TCCTTTGCCCACTTTTGATGGGG + Intronic
964075283 3:152684968-152684990 TCCAATGCCCACTCCAATTTTGG - Intergenic
966282279 3:178245890-178245912 TCCAATGCCCACATCAGTCATGG + Intergenic
966565422 3:181375477-181375499 TCCAGTGCCCTTTTCAGATGTGG + Intergenic
966906818 3:184532223-184532245 TCCAGTGCCCACTTGAGATGTGG - Intronic
970520786 4:16881747-16881769 TCCACTGAAGACTTCAGATGTGG - Intronic
970874631 4:20855277-20855299 ACCAATCCACACCTCAGATGAGG + Intronic
971473157 4:27048840-27048862 TCCAACGTGCACTGCAGATGTGG - Intergenic
971736283 4:30456647-30456669 TCTGATGCCCATTTCAGTTGTGG - Intergenic
972881381 4:43427396-43427418 TCCTTTGCCCACTTTTGATGGGG + Intergenic
973853543 4:54986753-54986775 TCTCATGCCCAATTCTGATGAGG - Intergenic
974928481 4:68331958-68331980 TCCAATGGCCACTTAGGATCTGG - Intronic
974933292 4:68384948-68384970 CCCAGTTCCCACTGCAGATGCGG + Intergenic
976123336 4:81806593-81806615 TCCAGTGCCATCTTCACATGTGG + Intronic
979965695 4:127074188-127074210 TCCAATGCCCTCTTAAGATATGG - Intergenic
981841103 4:149113234-149113256 TCCAATGCCCACTTCCAAGATGG - Intergenic
983066796 4:163219611-163219633 TCTAAAATCCACTTCAGATGTGG - Intergenic
983124047 4:163928008-163928030 TCAAATGCCTAATTCAGAAGTGG - Intronic
986087562 5:4466900-4466922 TCCTATGCACACTTCAAATCTGG + Intergenic
987118971 5:14748617-14748639 TGGCATGCCCACCTCAGATGGGG - Intronic
987778417 5:22399511-22399533 TCCATTGCCTACTTCACATGTGG + Intronic
987885062 5:23801930-23801952 TTCATTGCCCACTTTAGATGGGG - Intergenic
988229154 5:28451408-28451430 TCCAACATCCACTTCAGTTGTGG - Intergenic
989698540 5:44233732-44233754 TCTAATGCCCACTTTAGATGTGG - Intergenic
995326166 5:110892593-110892615 TCCACTGCTCTCTTCAGATCTGG + Intergenic
996303879 5:122023651-122023673 TTAAATACCCACCTCAGATGTGG - Intronic
996776486 5:127137891-127137913 ACCAATGTCCACTTCAAATGAGG - Intergenic
996966536 5:129312805-129312827 TCCTTTGCCCACTTTTGATGGGG - Intergenic
997579323 5:135007422-135007444 ACAAATGCCCACTTCATACGGGG + Intronic
999000848 5:147921533-147921555 TCCCCTGTCCACTTCAAATGAGG + Intergenic
999134578 5:149309983-149310005 TCCAGTGCCAACCTCAGATGTGG - Exonic
999270887 5:150295764-150295786 TTCCATCCCCACTGCAGATGTGG - Intergenic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1003162110 6:3644883-3644905 TCCACTGCCCATTTCAGATTTGG - Intergenic
1004458140 6:15810787-15810809 TCTAATGCCCAAGTCAGCTGAGG - Intergenic
1005442935 6:25890686-25890708 TCCAATGTCCTCTTCAAATGTGG - Intergenic
1005763009 6:28985100-28985122 TTCAAAGCCCACTTCAAATAGGG - Intergenic
1005801233 6:29427228-29427250 TCCACTACCCACTCCTGATGGGG - Exonic
1006563742 6:34936179-34936201 TTCAATGCACACTACAGATCAGG - Intronic
1007896666 6:45369099-45369121 TCCAAAGTCCACTTAAAATGGGG - Intronic
1008719198 6:54328068-54328090 TCCACTGCTCTCTTCAGATCTGG - Intronic
1009756593 6:67947976-67947998 TCCTTTGCCCACTTTTGATGGGG + Intergenic
1010994491 6:82517584-82517606 TCCTTTGCCCACTTTTGATGGGG - Intergenic
1013538001 6:111081133-111081155 TCCAATCCCCTCTTCTGATGTGG + Intergenic
1015299917 6:131641687-131641709 AGCAATGCCAACCTCAGATGTGG - Intronic
1015316958 6:131827776-131827798 TCCAAAGCCCGCTGCAGGTGGGG + Intronic
1015397495 6:132751584-132751606 TCACATGCCCAATTCTGATGGGG - Intronic
1015845572 6:137516910-137516932 GTCAATGCCTTCTTCAGATGCGG - Intergenic
1018513706 6:164555087-164555109 TCAAATGCTCACTGCAGAAGTGG + Intergenic
1019875600 7:3807971-3807993 ACCAATGCGCAGGTCAGATGGGG - Intronic
1022458312 7:30579000-30579022 ACCACTGCCCAATTCAGGTGAGG - Intergenic
1023854549 7:44174356-44174378 ACCAATGCCTACTTCTGATGAGG - Intronic
1024118229 7:46212743-46212765 TCCTATGCTTGCTTCAGATGGGG - Intergenic
1024632279 7:51259721-51259743 TCCCAGGCAGACTTCAGATGTGG + Intronic
1026792107 7:73340806-73340828 GCCAAGGCCCTCTTCAGGTGTGG + Exonic
1028832138 7:95339935-95339957 TTCAAGACCCACTTCAGAGGTGG + Intergenic
1028907971 7:96175999-96176021 TCTGAGGCCCACTACAGATGTGG + Intronic
1030904739 7:115168592-115168614 TCCTTTGCCCACTTTTGATGAGG + Intergenic
1031005791 7:116469803-116469825 TCCAAAGGACATTTCAGATGAGG + Intronic
1031591833 7:123602898-123602920 TCCACTGCCCACTAGATATGTGG + Intronic
1031598556 7:123675548-123675570 TCCAATATCTACTTCAAATGTGG - Intergenic
1031853424 7:126892980-126893002 TCCTTTGCCCACTTTTGATGGGG - Intronic
1033474819 7:141681823-141681845 TCCAATGCCCACTGTAGATGTGG + Intronic
1037118172 8:15251195-15251217 TCCAACACTCATTTCAGATGTGG - Intergenic
1040783891 8:51142406-51142428 TCCAAGGCCCATTTAAGAAGAGG + Intergenic
1041135993 8:54759835-54759857 TCCCATGCCCACAACAGATTGGG - Intergenic
1042333475 8:67606805-67606827 ACCAATATCCACTTTAGATGTGG - Intronic
1042615691 8:70646368-70646390 TCCTTTGCCCACTTTTGATGGGG - Intronic
1043176588 8:77029153-77029175 TCCCATGCCCTCTTCAAGTGTGG - Intergenic
1044140175 8:88641083-88641105 GCCAATGCTCACTTCAGCTACGG + Intergenic
1044896812 8:96901167-96901189 TCTAATGATCAATTCAGATGGGG + Intronic
1047401099 8:124548163-124548185 TCAGAAGCCAACTTCAGATGTGG + Intronic
1048754919 8:137727909-137727931 TCCAATACTCACTTTATATGAGG - Intergenic
1050371186 9:4922917-4922939 TTTAATGCCCTCTTCAGAAGAGG - Intergenic
1050645794 9:7718217-7718239 TCCTTTGCCCACTTTTGATGGGG - Intergenic
1052452529 9:28650477-28650499 TGAAATCCCCACATCAGATGAGG + Intronic
1052581390 9:30359609-30359631 TCCAATGTCCTATTCAGATATGG - Intergenic
1053377511 9:37620103-37620125 TCCAATGCCCACTTAAGTCAAGG + Intronic
1062438270 9:136556739-136556761 TCCTGGGCCCACTGCAGATGGGG - Intergenic
1062465703 9:136680168-136680190 ACCAATGTCCCTTTCAGATGTGG - Intronic
1187253630 X:17621961-17621983 TCCAACTCCCAATTCAGAAGAGG - Intronic
1187346213 X:18466869-18466891 GCCAATGCCCTCTGCAAATGCGG - Intronic
1191881961 X:65851520-65851542 CCCTTTGCCCACTTCTGATGGGG + Intergenic
1193932934 X:87579462-87579484 TCCATTTCCCTCTTCAGATTTGG - Intronic
1194335225 X:92638708-92638730 TCCATTGCCCACTTTTTATGAGG - Intergenic
1195174306 X:102300221-102300243 TCCAATGCCCAATCCAGCAGTGG - Intergenic
1195184559 X:102386872-102386894 TCCAATGCCCAATCCAGCAGTGG + Intronic
1196367762 X:114942752-114942774 TCCACTGCTCTCTTCAGAGGTGG + Intergenic
1199452164 X:147989557-147989579 TCCACTGCTCTCTTCAGAAGTGG + Intronic
1200036499 X:153334717-153334739 TACAATGCCCCCTCCAGATCGGG - Intronic
1200643694 Y:5755742-5755764 TCCATTGCCCACTTTTTATGAGG - Intergenic
1201459427 Y:14206004-14206026 TCCTTTGCCCACTTTTGATGGGG + Intergenic