ID: 1078771699

View in Genome Browser
Species Human (GRCh38)
Location 11:14358392-14358414
Sequence TCCGGGCGTGGGGCTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 8, 3: 40, 4: 435}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078771699_1078771715 25 Left 1078771699 11:14358392-14358414 CCAGCTCCAGCCCCACGCCCGGA 0: 1
1: 0
2: 8
3: 40
4: 435
Right 1078771715 11:14358440-14358462 GGTGGCCCAGCCTCTCCCGGAGG 0: 1
1: 0
2: 1
3: 33
4: 238
1078771699_1078771711 7 Left 1078771699 11:14358392-14358414 CCAGCTCCAGCCCCACGCCCGGA 0: 1
1: 0
2: 8
3: 40
4: 435
Right 1078771711 11:14358422-14358444 AGCAGTAAAGCCCGGCTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1078771699_1078771707 -1 Left 1078771699 11:14358392-14358414 CCAGCTCCAGCCCCACGCCCGGA 0: 1
1: 0
2: 8
3: 40
4: 435
Right 1078771707 11:14358414-14358436 ACCCTCGGAGCAGTAAAGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 71
1078771699_1078771710 4 Left 1078771699 11:14358392-14358414 CCAGCTCCAGCCCCACGCCCGGA 0: 1
1: 0
2: 8
3: 40
4: 435
Right 1078771710 11:14358419-14358441 CGGAGCAGTAAAGCCCGGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 51
1078771699_1078771714 22 Left 1078771699 11:14358392-14358414 CCAGCTCCAGCCCCACGCCCGGA 0: 1
1: 0
2: 8
3: 40
4: 435
Right 1078771714 11:14358437-14358459 CTCGGTGGCCCAGCCTCTCCCGG 0: 1
1: 0
2: 0
3: 25
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078771699 Original CRISPR TCCGGGCGTGGGGCTGGAGC TGG (reversed) Intronic