ID: 1078776982

View in Genome Browser
Species Human (GRCh38)
Location 11:14402875-14402897
Sequence AGTTGTCAGCAGAGGATAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078776979_1078776982 -4 Left 1078776979 11:14402856-14402878 CCCAAACGGTGTCGGCAGTAGTT No data
Right 1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG No data
1078776980_1078776982 -5 Left 1078776980 11:14402857-14402879 CCAAACGGTGTCGGCAGTAGTTG No data
Right 1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG No data
1078776978_1078776982 -3 Left 1078776978 11:14402855-14402877 CCCCAAACGGTGTCGGCAGTAGT No data
Right 1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG No data
1078776975_1078776982 17 Left 1078776975 11:14402835-14402857 CCAAGTTCTGTCTACTTGAACCC No data
Right 1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG No data
1078776974_1078776982 26 Left 1078776974 11:14402826-14402848 CCATAGAAACCAAGTTCTGTCTA No data
Right 1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078776982 Original CRISPR AGTTGTCAGCAGAGGATAGC CGG Intergenic
No off target data available for this crispr