ID: 1078778970

View in Genome Browser
Species Human (GRCh38)
Location 11:14419315-14419337
Sequence CAGTGAGTGTGTCAGGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078778963_1078778970 20 Left 1078778963 11:14419272-14419294 CCCAATTAGTCTAAGTCAGTTAT No data
Right 1078778970 11:14419315-14419337 CAGTGAGTGTGTCAGGAAGCCGG No data
1078778962_1078778970 30 Left 1078778962 11:14419262-14419284 CCTCTTAGATCCCAATTAGTCTA No data
Right 1078778970 11:14419315-14419337 CAGTGAGTGTGTCAGGAAGCCGG No data
1078778964_1078778970 19 Left 1078778964 11:14419273-14419295 CCAATTAGTCTAAGTCAGTTATG No data
Right 1078778970 11:14419315-14419337 CAGTGAGTGTGTCAGGAAGCCGG No data
1078778966_1078778970 -9 Left 1078778966 11:14419301-14419323 CCAACTCCACTTACCAGTGAGTG No data
Right 1078778970 11:14419315-14419337 CAGTGAGTGTGTCAGGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078778970 Original CRISPR CAGTGAGTGTGTCAGGAAGC CGG Intergenic
No off target data available for this crispr