ID: 1078780622

View in Genome Browser
Species Human (GRCh38)
Location 11:14435673-14435695
Sequence TCCTTTCCCCAACCGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078780622_1078780629 -7 Left 1078780622 11:14435673-14435695 CCAGGAGGCGGTTGGGGAAAGGA No data
Right 1078780629 11:14435689-14435711 GAAAGGAGGGATGGGGAGGTTGG No data
1078780622_1078780631 27 Left 1078780622 11:14435673-14435695 CCAGGAGGCGGTTGGGGAAAGGA No data
Right 1078780631 11:14435723-14435745 CATGAAAAAGATTGTATAGTGGG No data
1078780622_1078780630 26 Left 1078780622 11:14435673-14435695 CCAGGAGGCGGTTGGGGAAAGGA No data
Right 1078780630 11:14435722-14435744 ACATGAAAAAGATTGTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078780622 Original CRISPR TCCTTTCCCCAACCGCCTCC TGG (reversed) Intergenic
No off target data available for this crispr